ID: 1057171153

View in Genome Browser
Species Human (GRCh38)
Location 9:92963975-92963997
Sequence GTGTAGATCTTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057171153_1057171161 23 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668
1057171153_1057171158 16 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171153_1057171164 26 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865
1057171153_1057171159 19 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057171153 Original CRISPR GTGTAGATCTTCAGGGAGGA GGG (reversed) Intronic
901089870 1:6634121-6634143 GTGTTCATCTTCAGGAGGGAGGG - Intronic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
903397418 1:23012515-23012537 GTGATGATATTCAGGGAGGGAGG - Intronic
903705155 1:25280189-25280211 GTGTAGAGCCTTGGGGAGGAAGG + Intronic
903722070 1:25413132-25413154 GTGTAGAGCCTTGGGGAGGAAGG - Intronic
906121293 1:43393201-43393223 GTGAAGATCTTCAGGTGAGAAGG + Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907009544 1:50950770-50950792 TAGTAGATCTTCAGGAAGGAAGG - Intronic
907563485 1:55412637-55412659 GATCAGATCTTAAGGGAGGAGGG + Intergenic
909332040 1:74425130-74425152 GAGTAGAGCTTCAGGCAGAAGGG + Intronic
910131456 1:83912177-83912199 GGGTAAATTTTCATGGAGGAAGG + Intronic
910689949 1:89955455-89955477 ATGAAGGTCTTCAGGGAAGAGGG - Intergenic
912189299 1:107318929-107318951 CTGTATATCTTCAGACAGGAAGG - Intronic
916437074 1:164787344-164787366 GGGCAGATCTACAGGGAGGGTGG - Intronic
919381908 1:196870486-196870508 GAGTATCTCTTCAGGGATGAGGG - Intronic
920460733 1:206137950-206137972 GTGTAGCTTTTCAGTAAGGATGG + Intergenic
920671888 1:208010001-208010023 GTACAGATTTGCAGGGAGGAGGG + Intergenic
921763593 1:218944607-218944629 GCGTATATCTACAGGGTGGACGG - Intergenic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
1063923275 10:10952246-10952268 GTGCGGAACTTCAGGGGGGAAGG - Intergenic
1065957906 10:30709415-30709437 GTATAGATCTTCCTGCAGGAAGG - Intergenic
1066996955 10:42572741-42572763 CAGTAGATCTTCAGGGATCAAGG + Intergenic
1069622142 10:69844240-69844262 GTGTGGCTGTCCAGGGAGGATGG + Intronic
1070467434 10:76737753-76737775 GTGCAAAGCTTCAGAGAGGATGG + Intergenic
1073215519 10:101834051-101834073 GAGTAGATATGGAGGGAGGAGGG - Intronic
1073983280 10:109178799-109178821 GAGTAGGCCTTCTGGGAGGAAGG + Intergenic
1075730066 10:124630720-124630742 GTAAATATCTTCAGGGTGGAAGG + Intronic
1075926726 10:126257091-126257113 GTGTCAGTGTTCAGGGAGGAAGG - Intronic
1078570669 11:12455150-12455172 GTGTGTCTCTTCAGGGAAGATGG + Intronic
1079497652 11:21063967-21063989 GTGTAGATCTTCTAGGAGAGTGG + Intronic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1084256588 11:67947035-67947057 GTGCAGATCTGGAGGGTGGAAGG - Intergenic
1085486491 11:76868131-76868153 AGGTTGCTCTTCAGGGAGGATGG - Intronic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089460567 11:118650675-118650697 GTGTACATTTTCAGGGAAGGAGG - Intronic
1089561533 11:119345739-119345761 GGGCAGATCTTCCGGGAGAAGGG - Intronic
1090040059 11:123282973-123282995 TTGTAGATTTGCAGGCAGGAAGG - Intergenic
1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG + Exonic
1090111762 11:123918399-123918421 GTACACATCTTCAGAGAGGAGGG + Intergenic
1090304960 11:125683411-125683433 CTGAAAATCTTCAGGGTGGAGGG + Intergenic
1093467282 12:19462695-19462717 ATGTAGATGGTCAGCGAGGAGGG + Exonic
1098579236 12:72079343-72079365 AAGTAGACCTTCAGTGAGGAGGG - Intronic
1101661092 12:106766264-106766286 GTTTAGAACTTGAGGGTGGAAGG - Intronic
1103114007 12:118309466-118309488 GGGTAGATTTGCAGGGAGGAGGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1109913522 13:68948816-68948838 GTGTGTATGTTTAGGGAGGAGGG + Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1116797467 14:49407333-49407355 GTGAACATCTTAAGGCAGGATGG + Intergenic
1118315605 14:64724083-64724105 GTGGTGCTCTTCAGGTAGGAAGG + Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1120088282 14:80300809-80300831 GTATAGACATTCAGGGAAGATGG + Intronic
1125466549 15:39958787-39958809 GTGTAGATGTTGGGGCAGGAGGG - Intronic
1126955635 15:53930474-53930496 GAGTAGATTTTCTGGGAAGAGGG + Intergenic
1128263564 15:66250153-66250175 GTGCAGATCTTCTGCCAGGAAGG - Intronic
1131460909 15:92616917-92616939 GAGTAGCTCCTCAGGGAGGAGGG + Intergenic
1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG + Intergenic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1140121016 16:72082956-72082978 GAGGAGATCTTCGGGAAGGAAGG - Intronic
1140202835 16:72908190-72908212 GTGTCAATCCCCAGGGAGGAGGG - Intronic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1142343829 16:89541450-89541472 GGGGAGGTCTCCAGGGAGGAGGG + Intronic
1143272613 17:5686971-5686993 GTGCAGATGCTCAGAGAGGAAGG + Intergenic
1145910012 17:28537035-28537057 GTGAAGATTGACAGGGAGGAGGG + Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1148026372 17:44591713-44591735 GGGTAGAGATTCAGGCAGGAAGG - Intergenic
1151560840 17:74868778-74868800 GGTTAAATCCTCAGGGAGGAGGG - Intronic
1156034875 18:32754952-32754974 GTGTAGATCTGCAGCAAGGGAGG + Intronic
1156245438 18:35293476-35293498 CTGTAGGTCTTCAGGGACCAGGG + Intergenic
1158015685 18:52780752-52780774 GTGAAGGTCTTCAGGGGAGAAGG + Intronic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1162320608 19:9969075-9969097 GTGTAGACCATCAAGGTGGAAGG + Intronic
1162320625 19:9969177-9969199 GTGTAGACCATCAGGGTGGAAGG + Intronic
1162753578 19:12843657-12843679 GTGTGGGTCTTCAGGCTGGAGGG - Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1163889806 19:20000686-20000708 GCATAGATCTTCAGCCAGGAAGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG + Intergenic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
929093849 2:38245597-38245619 CTGTACATCCTCAGGAAGGAAGG + Intergenic
930228259 2:48816634-48816656 GTGCAGTTCTTAAGGGAGAAAGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
933669057 2:84989525-84989547 GGATGGATCTGCAGGGAGGAAGG + Intronic
933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG + Intronic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
934856198 2:97731915-97731937 GTGTAGCTTTACAGTGAGGAGGG - Intronic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
937251012 2:120523811-120523833 GAGTAGATCTTCCTGGAGTAGGG + Intergenic
939765225 2:146240013-146240035 GGTTAGACCTTCAGGGAGAAAGG - Intergenic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941064972 2:160891740-160891762 GTGGTGCTGTTCAGGGAGGAGGG - Intergenic
941766055 2:169297723-169297745 GTTTACATAATCAGGGAGGAGGG + Intronic
944658060 2:201896782-201896804 GTGCAGAAAATCAGGGAGGATGG - Intergenic
946349163 2:219137194-219137216 ATGAAAATCTCCAGGGAGGAAGG - Intronic
946642435 2:221799193-221799215 ATGTACACTTTCAGGGAGGAGGG - Intergenic
947068733 2:226261678-226261700 GTGTAAATCATCAGGGAGAAAGG - Intergenic
948253131 2:236546599-236546621 GAGTAAAGCTTCAGGCAGGAGGG - Intergenic
1168954030 20:1821661-1821683 GTGAATGTCTGCAGGGAGGAAGG - Intergenic
1169264691 20:4160773-4160795 GTCTCCACCTTCAGGGAGGAAGG + Intronic
1169553553 20:6726343-6726365 GTGTGGATTCTCAGGGAAGATGG + Intergenic
1172066727 20:32226589-32226611 GTGTATATGTTTAGGGAGGTGGG - Intronic
1173490141 20:43473157-43473179 GGGTAGATATGCAGGCAGGACGG + Intergenic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175587275 20:60151582-60151604 GTGAAGCTCTTAATGGAGGACGG - Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1177410663 21:20726434-20726456 AAATACATCTTCAGGGAGGAAGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1180169374 21:46050014-46050036 GTGTTGACCTCCAGGGATGAGGG - Intergenic
1181746783 22:24960761-24960783 ATGTGGAACTTTAGGGAGGAAGG + Intronic
1183225780 22:36548996-36549018 GTGAAGATCAACAGGGACGAGGG - Intergenic
1184879491 22:47295946-47295968 GTGTTGCTCTTTAAGGAGGAGGG - Intergenic
1185224021 22:49643001-49643023 GTCTGGATCTGCAGGCAGGAGGG - Intronic
952193687 3:31050063-31050085 GTGTACATCTTGGGGAAGGAAGG + Intergenic
953403184 3:42644784-42644806 GTGGAGATCTGCAGGGTAGATGG - Intronic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
956393386 3:68799106-68799128 GTGAACATCTTGAGGGAGGGGGG - Intronic
957840804 3:85666735-85666757 GTGAAGATCTTCAGGGGAGAAGG + Intronic
960433187 3:117594973-117594995 GTATAGTTCTTAAGGGAGGGTGG + Intergenic
960533560 3:118792528-118792550 GTGTTTTCCTTCAGGGAGGAAGG + Intergenic
961378469 3:126482294-126482316 GTGAGGATCGCCAGGGAGGAAGG + Exonic
963068907 3:141286494-141286516 GGGTAGATTTTCTAGGAGGAAGG + Intronic
965370413 3:167855277-167855299 GTTGAGATCTCCAGGGAGGTGGG + Intergenic
967060249 3:185865947-185865969 GTGTAGAGTTTCCAGGAGGAGGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967424919 3:189316125-189316147 GTGCATATGTTCAGAGAGGAGGG + Intronic
970652808 4:18197348-18197370 GAGTACATTTTCAGGGAGGCAGG + Intergenic
971415854 4:26428483-26428505 TTTTAGATGTTCAGGGAAGAGGG + Intronic
973142685 4:46788012-46788034 GTTTAGGACTTCAGGGACGAAGG + Intronic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
980852591 4:138401135-138401157 GTGTTTATTTTCAGGGAGTAGGG - Intergenic
987342134 5:16948622-16948644 GTGTAGAGCTCCAGAGAGGTAGG + Intergenic
987550998 5:19381436-19381458 GTTTATGTCTTCAGAGAGGATGG + Intergenic
988870654 5:35385364-35385386 GTGTAGGCCTGCAGGGAGGCAGG + Intergenic
990155806 5:52876053-52876075 GTGAAAATCCTCAAGGAGGAAGG - Intronic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990773391 5:59276935-59276957 GTGTAGATGTTCAGAGAGATAGG - Intronic
991650172 5:68844624-68844646 ATGCAGATCCTCAGAGAGGAAGG - Intergenic
991958785 5:72021360-72021382 GTGTTGATTTTCTGGCAGGAAGG - Intergenic
999204909 5:149840848-149840870 ATGTGGCACTTCAGGGAGGAGGG + Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000800145 5:165715528-165715550 TTGAGGATCTTCAGGGAGCAGGG + Intergenic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002853355 6:1016184-1016206 TTATAGATCTTCAGGTGGGAGGG - Intergenic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007694722 6:43724959-43724981 ATGTAGATCATCAGGGTGGAAGG + Intergenic
1008026325 6:46640218-46640240 CTGTAGATTTTGAGGGAGAAGGG - Intronic
1008460089 6:51758539-51758561 TCCTAGATCTTCAGGGAAGAGGG + Intronic
1011823570 6:91280585-91280607 ATGTGGTTCTTCAGGGAGGCTGG + Intergenic
1012173292 6:96046557-96046579 GTGTAGGTCTTCAGGATGGGTGG - Intronic
1014293929 6:119594700-119594722 GTGTATGTATTTAGGGAGGAGGG - Intergenic
1018069202 6:160146955-160146977 GTGTAGTTCTCTAGGGAGAAAGG + Intronic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1018567637 6:165172319-165172341 GTGAAGATCTTCAGGAAAAATGG - Intergenic
1018888676 6:167964658-167964680 GTGTAGCTCTAGAGGGAGTAGGG + Intronic
1018977228 6:168574743-168574765 GTGCCGGTCTTCAGGGAGGTCGG - Intronic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023981812 7:45074784-45074806 GTGTAGGACTTCAAGGCGGAAGG + Intronic
1024081649 7:45861611-45861633 GTTTAGATCTGCAGGGTGGGTGG - Intergenic
1028573996 7:92325556-92325578 GTTTAGATGTTCAGGGAGAAAGG - Intronic
1030717774 7:112830550-112830572 ATGTATATCTTGAGGAAGGAAGG + Intronic
1033663500 7:143420066-143420088 GGCCAGACCTTCAGGGAGGACGG - Intergenic
1033832667 7:145272325-145272347 GTGAGAATCTTCAGGGAAGAGGG + Intergenic
1036719711 8:11162317-11162339 GTGTAGCTCTTCAGGGCCAAGGG - Intronic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1042069692 8:64917565-64917587 GTGTAGATCTTCAACCTGGAGGG - Intergenic
1047078425 8:121431732-121431754 GTGTACATGTTCTGGAAGGAAGG + Intergenic
1047694200 8:127386556-127386578 GTTTAGATCTACAGTGAGAAAGG + Intergenic
1047989065 8:130266336-130266358 GTCTAGACATTCAGGGATGAGGG + Intronic
1049404307 8:142444906-142444928 GTGCAGATGTTGAGGAAGGATGG - Intergenic
1051720695 9:20034156-20034178 GTGTAGATAATCAAGCAGGAAGG - Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057873106 9:98732861-98732883 TTCTAGATCGTCAGGGAGGAAGG - Exonic
1057873307 9:98734029-98734051 TTATAGATCGTCAGGGAGGAGGG - Exonic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059949817 9:119450628-119450650 GTGTACATCTTTAGGTATGAAGG + Intergenic
1060900245 9:127250680-127250702 GTCGAGATTTTCAGGGAGGGAGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1186104432 X:6191261-6191283 GGGTAGAACTTCAGTAAGGAGGG + Intronic
1186597803 X:11002818-11002840 GTGTGGATGTTGGGGGAGGAGGG - Intergenic
1191956133 X:66644250-66644272 GAATAGCTCTTCAGAGAGGATGG - Intergenic
1192055554 X:67769624-67769646 GTGTAGGTTTCCAGGGAAGAAGG - Intergenic
1192733812 X:73829104-73829126 ATGTTGATCTTCAGGTGGGAAGG + Intergenic
1194051727 X:89077839-89077861 GTGGAGTTCTTCAGGGAACAGGG + Intergenic
1196519544 X:116656883-116656905 GGGTAGATATTAAGGGAGGTGGG + Intergenic
1198939790 X:141941020-141941042 TGGTAGCTCTTCAGGGAAGAGGG + Intergenic