ID: 1057171158

View in Genome Browser
Species Human (GRCh38)
Location 9:92964014-92964036
Sequence AAAGTCCACCCAGCAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057171150_1057171158 27 Left 1057171150 9:92963964-92963986 CCCTGCTGGGCCCCTCCTCCCTG 0: 1
1: 0
2: 11
3: 117
4: 813
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171152_1057171158 17 Left 1057171152 9:92963974-92963996 CCCCTCCTCCCTGAAGATCTACA 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171156_1057171158 9 Left 1057171156 9:92963982-92964004 CCCTGAAGATCTACACAGCAGAT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171153_1057171158 16 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171154_1057171158 15 Left 1057171154 9:92963976-92963998 CCTCCTCCCTGAAGATCTACACA 0: 1
1: 0
2: 2
3: 15
4: 213
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171157_1057171158 8 Left 1057171157 9:92963983-92964005 CCTGAAGATCTACACAGCAGATC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171151_1057171158 26 Left 1057171151 9:92963965-92963987 CCTGCTGGGCCCCTCCTCCCTGA 0: 1
1: 0
2: 5
3: 70
4: 586
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197
1057171155_1057171158 12 Left 1057171155 9:92963979-92964001 CCTCCCTGAAGATCTACACAGCA 0: 1
1: 1
2: 1
3: 9
4: 118
Right 1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057171158 Original CRISPR AAAGTCCACCCAGCAGAAGC AGG Intronic
901021699 1:6259362-6259384 AAAGTTTGTCCAGCAGAAGCAGG + Intronic
901165721 1:7220399-7220421 AGACTCAACCCAGCAGAAGGCGG - Intronic
902058791 1:13624214-13624236 AAGGGCCACCCAACAGGAGCTGG - Intergenic
902456656 1:16538558-16538580 ATACTCCATCCAGCAGAAACTGG - Intergenic
902474170 1:16672496-16672518 ATACTCCATCCAGCAGAAACTGG - Intergenic
902484633 1:16734946-16734968 ATACTCCATCCAGCAGAAACTGG + Intergenic
903604949 1:24568681-24568703 AAAGGCCACCCAGCCGAGCCAGG + Intronic
904501090 1:30913285-30913307 AAAGTCCTCCTAGGGGAAGCTGG + Intergenic
905887651 1:41500288-41500310 AGAGACCACCCAGCAGAAAGAGG - Intergenic
908319218 1:62964421-62964443 AAAGGCCACCCAGAAAAAGAGGG + Intergenic
910086325 1:83406940-83406962 GAAGGCCACCCAACAGGAGCTGG + Intergenic
910437163 1:87216972-87216994 GAAGTTCACCCAGCACATGCTGG + Intergenic
915051604 1:153080337-153080359 ACACTCCACCCAACAGCAGCAGG + Intergenic
915404635 1:155650401-155650423 ACATTCCACAGAGCAGAAGCAGG + Intergenic
916167165 1:161974351-161974373 AAAGTGCGGCCAGCAGCAGCAGG - Intergenic
920680015 1:208065042-208065064 AAAGTCCTGCAAGCAGTAGCTGG - Intronic
924610183 1:245567220-245567242 ACAGTCCACCCGGCAGCATCTGG - Intronic
1066314460 10:34230283-34230305 CTGGTCCACCCAGCAGCAGCAGG + Intronic
1066534585 10:36377219-36377241 AAATTCCATCCAGCAGCAGTAGG - Intergenic
1067432089 10:46251523-46251545 AATGTCCACCCCACAGAAGTGGG - Intergenic
1068529126 10:58164863-58164885 AAAGTGCAGCAAGGAGAAGCAGG + Intergenic
1069844892 10:71364125-71364147 AAAGCCCAGCCAGCAGCAGGTGG + Intergenic
1070558795 10:77550313-77550335 GAAGTCTACCCAGCAGGTGCTGG - Intronic
1070831422 10:79420228-79420250 AGAGTCCCCCCAGCACAACCTGG + Intronic
1070897319 10:79995951-79995973 AAAGTCAGCCCTGCAGAAGGAGG + Intergenic
1073441003 10:103552756-103552778 GAGGTGCACCCAGGAGAAGCTGG + Intronic
1074774623 10:116758092-116758114 AAAATCCACTCAACAGAAGTGGG + Intergenic
1075826532 10:125361525-125361547 AAAATTCACTCAGCAGAAGGAGG - Intergenic
1076216899 10:128702040-128702062 AAAGTGGACTCAGCAGAAGATGG + Intergenic
1077084796 11:744114-744136 AAAGTCCTCTCAACAGATGCTGG + Intergenic
1077571062 11:3338985-3339007 ACAGGCCACACAGCAGAAGAAGG + Intergenic
1077667214 11:4123303-4123325 AAAGAGCAACCAGCAGAACCTGG + Exonic
1081773649 11:45664347-45664369 TAAGTCCACCAAGAGGAAGCCGG + Intronic
1082067209 11:47910642-47910664 AAAGGCCACCAACCAGAGGCTGG - Intergenic
1085304974 11:75480658-75480680 AAAGGACACCCAGCAGAGCCAGG + Intronic
1085744820 11:79105832-79105854 AGAGTTCACCCGGCATAAGCTGG - Intronic
1087131317 11:94671688-94671710 AGAGGCCAGGCAGCAGAAGCAGG - Intergenic
1090259195 11:125306407-125306429 AAAGCCAGCCCAGGAGAAGCGGG - Intronic
1091270923 11:134311311-134311333 ACAGTCCACCCGGAAGGAGCTGG - Intronic
1091289672 11:134430954-134430976 AAACACCACCCAGCACATGCAGG + Intergenic
1094013110 12:25829938-25829960 AAAGTACACCCCATAGAAGCTGG + Intergenic
1095672470 12:44876648-44876670 AAAGACCACCCAGCTGCAGGAGG + Exonic
1100981189 12:100164044-100164066 AAGGTCCGCCCAGCGGCAGCAGG - Intergenic
1101047210 12:100820861-100820883 AAAGTCCACCCAGCACAATCAGG - Intronic
1101415069 12:104501736-104501758 CAGGTCCACCCACCAGATGCTGG + Intronic
1103138965 12:118532386-118532408 AAAGTCAAACGAGGAGAAGCAGG + Intergenic
1105821765 13:24086739-24086761 AAGGGCCAGCCAGCAGAAGCGGG + Intronic
1109210827 13:59534174-59534196 AAAATCTGCCCAGCACAAGCTGG - Intergenic
1109221355 13:59643960-59643982 AATGCCCACCCAGCAGAGGATGG + Intergenic
1110261032 13:73485565-73485587 AACAGCCACCCAGCAGAGGCAGG + Intergenic
1111702384 13:91707159-91707181 AAAATTAACCCAGCAGAAGATGG + Intronic
1113609021 13:111630123-111630145 CAACTCCAGCCGGCAGAAGCAGG - Intronic
1113658395 13:112085962-112085984 CAAGGCCACCCAGCAGGAGGTGG - Intergenic
1114136502 14:19857878-19857900 AAAGTTCTCACAGCAGAAACTGG - Intergenic
1114185833 14:20401515-20401537 AAGGTTCACCCTGAAGAAGCTGG - Exonic
1114596156 14:23913937-23913959 AAGGACCACCCACCAGAAGTGGG + Intergenic
1117930796 14:60838798-60838820 AAAGGCCAGGCAGCAGGAGCAGG - Intronic
1119499296 14:75109780-75109802 AAAATCCACCCCCCAGAAACTGG - Exonic
1119502373 14:75140676-75140698 AGAGTCCACCCAGCCCAGGCTGG - Intronic
1124045747 15:26148368-26148390 CAATTCCAGCCAGCAGAATCGGG - Intergenic
1130512344 15:84600393-84600415 AGGCTCCACCCAGGAGAAGCTGG + Intergenic
1130959041 15:88647766-88647788 AACGTCAACCCAGCATAAGGAGG + Intronic
1132175055 15:99707063-99707085 AAAGTTCACACTGGAGAAGCCGG - Intronic
1132378612 15:101349509-101349531 AAATTCCAGCCTGGAGAAGCTGG - Intronic
1132862484 16:2078409-2078431 AAGTCCCACCCAGCAGAGGCCGG - Intronic
1139672083 16:68498859-68498881 AAAGCCAACATAGCAGAAGCTGG - Intergenic
1141383764 16:83600369-83600391 ACAAACCACCCAGCAGAACCAGG + Intronic
1142304822 16:89279317-89279339 CACGTCCACGCAGCAGACGCGGG - Exonic
1145406310 17:22599229-22599251 ATTGTCCTCCCAGCAGAAACAGG - Intergenic
1147422881 17:40331302-40331324 AGAGTCCACCCAGCATAGGGGGG - Exonic
1147935749 17:44009803-44009825 AAAGTCACCCCAGCAGCAGCCGG - Intergenic
1149035294 17:52127345-52127367 AAAGCCCACCCACCAGAAATGGG - Intronic
1150653520 17:67024903-67024925 ACAGGCCACCCAGCAGGAGCAGG - Exonic
1152264878 17:79288409-79288431 GAAGTCCAGCCTGCAGAAGAAGG - Intronic
1152755456 17:82085244-82085266 AGACTCCACCCAGCGGAAGCTGG + Exonic
1153932046 18:9887256-9887278 AAAGCCCATCCAGCCCAAGCTGG + Exonic
1154460766 18:14582884-14582906 AAAGTTCTCACAGCAGAAACTGG - Intergenic
1158146840 18:54323612-54323634 ATCTTCCACTCAGCAGAAGCAGG - Intergenic
1158931542 18:62328561-62328583 AAAGTCGACTAATCAGAAGCAGG + Intronic
1160387613 18:78505955-78505977 AAAGTCTCTCCAGCAGATGCTGG - Intergenic
1161207401 19:3048261-3048283 AAAGTGCTCACAGCAGAGGCTGG - Intergenic
1162923874 19:13919849-13919871 CAAGCCCACCCAGCAGAGTCTGG + Exonic
1164923182 19:32104917-32104939 CCAGTCCACCCAACACAAGCTGG + Intergenic
1164971676 19:32538369-32538391 AAAGTCCACCTAACAGAAATTGG + Intergenic
1165197508 19:34116469-34116491 AAACTCCACCCAGCATCTGCTGG + Intergenic
1166325269 19:42046107-42046129 CAAGGCCACCCAGCTGAAGCAGG + Intronic
1166940331 19:46359465-46359487 TAAGTCCCCAAAGCAGAAGCTGG - Intronic
1168600073 19:57710452-57710474 AAATTCCAGGCAGAAGAAGCAGG + Intronic
1168625462 19:57914671-57914693 AAGGTCCAACCAGATGAAGCCGG + Intronic
1202707547 1_KI270713v1_random:34900-34922 ATACTCCATCCAGCAGAAACTGG - Intergenic
927650010 2:24906779-24906801 AAGGTCCACCTACCATAAGCAGG + Intronic
930541442 2:52711838-52711860 AAAGTGCACCCAACACAATCAGG + Intergenic
932115371 2:69041932-69041954 AAACTCCACCAGGCAGAGGCTGG + Intronic
932130213 2:69180883-69180905 AAAATCCATCCATCAGAAGATGG + Intronic
932570045 2:72933816-72933838 AAAGTACAAACGGCAGAAGCTGG + Exonic
933354303 2:81195095-81195117 CACGTCCACGCAGCAGACGCGGG - Intergenic
934677270 2:96258447-96258469 AGAGTTCGCCCAGCAGAGGCTGG + Intronic
934759586 2:96846448-96846470 AAAATGCACAGAGCAGAAGCAGG - Intronic
937365274 2:121256912-121256934 AAGGTGCACCCAGCAGAGACTGG + Intronic
941261349 2:163301750-163301772 AAAATCCAACCAGCAGATGCTGG + Intergenic
942496894 2:176549363-176549385 GAAGTAAAACCAGCAGAAGCTGG - Intergenic
943105198 2:183537625-183537647 AAAATCCTTCCAGCAGCAGCTGG + Intergenic
944823160 2:203451969-203451991 AAAATCCAGCCAGCAGAAGAGGG - Intronic
945782332 2:214191170-214191192 AGAGACCACCTAGCAGAAGCAGG + Intronic
946230257 2:218286891-218286913 AAACCCCACCCAGCAGGCGCAGG + Intronic
947621381 2:231593419-231593441 ACAGTCCACCCAGCACATGGAGG + Exonic
948294156 2:236848247-236848269 AGAGCCCACCCTGGAGAAGCAGG - Intergenic
948599398 2:239099818-239099840 ACAGACCACCCAGTAGAGGCCGG + Intronic
1169943640 20:10965209-10965231 TAAGCCCACCTAGCAAAAGCAGG + Intergenic
1170274838 20:14573972-14573994 AAAGTCAACCCTGAAGAAGGTGG - Intronic
1170867356 20:20171042-20171064 ACAGTCCACACAGCAGAAAGTGG + Intronic
1170924704 20:20712426-20712448 GAAGTCCACCCAGAAGGTGCTGG - Exonic
1171416417 20:24984087-24984109 AAAGCCCTCCCGGCAGGAGCAGG + Intronic
1172780201 20:37432077-37432099 TACGTCCACCCAGCAGGGGCTGG + Intergenic
1173935326 20:46857046-46857068 AAAATCCACATAGCAAAAGCTGG - Intergenic
1174066309 20:47868153-47868175 ACAGTGCACAAAGCAGAAGCTGG - Intergenic
1174157771 20:48527950-48527972 ACAGTGCACAAAGCAGAAGCTGG + Intergenic
1174747821 20:53081442-53081464 AAACTGCACCCAGCTGAACCAGG + Intronic
1175693348 20:61082369-61082391 GATGTCCTCCTAGCAGAAGCTGG + Intergenic
1178026355 21:28472750-28472772 AAAGTCGAAACAGCAGATGCTGG + Intergenic
1178694565 21:34781714-34781736 AAAGTTCACTCAGCTGAACCTGG + Intergenic
1179192861 21:39137890-39137912 AATTTCCACCCAGAAGAAACGGG + Intergenic
1181944148 22:26502621-26502643 AAAGTCCAGCCCACAGAAGTTGG + Intronic
1183994439 22:41622142-41622164 AAAGTCCATCCAGCAGAGATAGG - Intronic
950339443 3:12229693-12229715 AAAGTACACTCAACAAAAGCGGG - Intergenic
952439292 3:33309045-33309067 ATATTCCACCCAACAGCAGCAGG - Intronic
955192834 3:56777777-56777799 AAACACCACCCAGGAGAGGCTGG + Intronic
955238387 3:57159850-57159872 AAAACCCATCCATCAGAAGCAGG + Intronic
957968628 3:87354473-87354495 AAAGGTCACCCCACAGAAGCTGG + Intergenic
962525987 3:136237922-136237944 CAACTCCACACAGCAGAAGAAGG - Intergenic
962875629 3:139534033-139534055 GAAGTCCCCCCAGCATGAGCAGG - Intronic
963373518 3:144433951-144433973 AAAGTCAAAACAGCAGATGCTGG + Intergenic
963963663 3:151340185-151340207 TAAGACCACACAGCAGTAGCAGG - Intronic
968312954 3:197699308-197699330 AAATTTTACCCAGCAGAAGTGGG + Intronic
969342985 4:6553885-6553907 CCAGGCCACCCAGCAGCAGCAGG + Intronic
971217722 4:24676443-24676465 AAAGTCCACTCCCCAGAACCAGG + Intergenic
971287093 4:25301219-25301241 CAAGCCCACCGGGCAGAAGCTGG - Intergenic
971382935 4:26116493-26116515 AAAGTCCGCCCAGCAGTTTCTGG + Intergenic
971997224 4:33980262-33980284 ATTGTCCTCCCAGCAGAAACAGG + Intergenic
973913494 4:55608642-55608664 AAAGTTCTCCCAGAAGAATCAGG + Intronic
976918522 4:90408152-90408174 AGAGTCCACCCAGCTCAAGGAGG + Intronic
977011247 4:91636384-91636406 AAAGATCACCAAGCAGAATCAGG + Intergenic
977332202 4:95651462-95651484 AAACACGACCAAGCAGAAGCTGG + Intergenic
977487395 4:97665946-97665968 AGAGGCCAAGCAGCAGAAGCAGG + Intronic
979602850 4:122605109-122605131 AAATGACACACAGCAGAAGCTGG - Intergenic
980566494 4:134549670-134549692 AAAGTACCCCCAGCAGAACCAGG - Intergenic
981102290 4:140842589-140842611 CAAGGCCACCCAGCAGGAGATGG - Intergenic
982113339 4:152075992-152076014 AAAAGCACCCCAGCAGAAGCAGG + Intergenic
982436291 4:155385234-155385256 ACAGTTCACCTCGCAGAAGCTGG + Intergenic
982533407 4:156577194-156577216 AGAGTTCACCAAGCAGAGGCAGG + Intergenic
985172902 4:187171202-187171224 AAAGTCAAAACAGCAGAAGCTGG - Intergenic
985865408 5:2510436-2510458 CGAGTCCACTCAGCAGCAGCAGG + Intergenic
988480512 5:31626549-31626571 AAGGACCACCCACCAAAAGCTGG - Intergenic
988839051 5:35065523-35065545 AAAGGCAACCCAGCAGAGGGAGG - Exonic
989088312 5:37700030-37700052 AAAGTTCTCCCAGTACAAGCAGG + Intronic
990137018 5:52658285-52658307 AAAGACTTCCCAGCAGATGCAGG + Intergenic
990592446 5:57280206-57280228 AGAGACCACCCAGCAAAATCAGG + Intergenic
991446309 5:66703515-66703537 AGAGTTCACCCTGCAGAAGTTGG - Intronic
991982295 5:72245130-72245152 AAACTGCACCCAGAAGCAGCTGG + Intronic
992207198 5:74442492-74442514 AAAGTGCAGCCAGCAGATGGTGG - Intergenic
992986343 5:82234366-82234388 AGGGCCCACCCTGCAGAAGCAGG + Intronic
996237346 5:121147830-121147852 AAAGTCAAAACAGCAGATGCTGG - Intergenic
1002493093 5:179593549-179593571 AAAGGACACCCACGAGAAGCAGG + Exonic
1005425771 6:25701208-25701230 AAGGTCCACCCCGCTGATGCTGG - Exonic
1005481618 6:26260336-26260358 AAAGTGCAGCCCCCAGAAGCTGG - Intergenic
1007218046 6:40256541-40256563 AAAGTCTTCCCAGAAGAAACAGG + Intergenic
1019360212 7:601042-601064 AGCGTCCACCCTGCAGAAGTGGG + Intronic
1021577270 7:22115987-22116009 AAAGTCCAACCAGGAGAACTTGG + Intergenic
1023453182 7:40309997-40310019 ATACTCCACCCTCCAGAAGCAGG + Intronic
1024213291 7:47225856-47225878 AAAAACCACCCAGCAGATACAGG - Intergenic
1027303203 7:76863404-76863426 GAAGGCCACCCAACAGGAGCTGG + Intergenic
1027486548 7:78768990-78769012 AAGCTCCAGCCAGCAGAGGCAGG - Intronic
1029309128 7:99644931-99644953 GAAGCCCACCCAGCAGGAGCAGG + Intergenic
1032128094 7:129209179-129209201 AAAGTTCACCCAGCTGGGGCTGG - Intronic
1032302516 7:130700725-130700747 AAAGTCATCCCAGCATAAACTGG - Intergenic
1032305501 7:130730156-130730178 CACATCCTCCCAGCAGAAGCAGG + Intergenic
1033289864 7:140074518-140074540 GAAGTGCTCCCAGGAGAAGCTGG + Intergenic
1037444246 8:18948412-18948434 AAAGTCAGCCCAGCATAATCAGG + Intronic
1037904003 8:22704751-22704773 AAAGCCCACCCAGGGGAAGAGGG - Intergenic
1038335377 8:26641620-26641642 AAAGTCTCCCATGCAGAAGCTGG - Intronic
1039634814 8:39152936-39152958 ACACTCCACCCAGCAGAAAAGGG - Intronic
1039813873 8:41074707-41074729 AAAGTCCTGCAAGCTGAAGCTGG + Intergenic
1040423232 8:47260199-47260221 ATAGCCGGCCCAGCAGAAGCCGG - Intergenic
1040568223 8:48585756-48585778 AGAGTCCACACAGCAGCACCAGG - Intergenic
1042201730 8:66285300-66285322 TCGGTCCACTCAGCAGAAGCTGG - Intergenic
1042770408 8:72374679-72374701 AGTGTCCAGCCAGCAAAAGCAGG - Intergenic
1045466951 8:102478760-102478782 AAAGACCACCCAGCAGACCATGG - Intergenic
1047173855 8:122521863-122521885 AAACTCCACCCAGCAGCTGAAGG - Intergenic
1047298743 8:123594428-123594450 AAAGTCTACCAAGAAGAAGCAGG - Intergenic
1050025627 9:1331774-1331796 AAAGACAACCCAGCAGAAAAAGG - Intergenic
1052234912 9:26199545-26199567 GAGGTCCACACAGCAGATGCAGG - Intergenic
1052359741 9:27541117-27541139 AAAGTTCACCCAGGTGAAGTGGG + Intergenic
1052582123 9:30371579-30371601 AAAGTTCATTCAGCAGAAGAAGG + Intergenic
1053826245 9:42027473-42027495 AAAGCACACCCAGCTGAACCTGG - Intronic
1054604316 9:67159924-67159946 AAAGCACACCCAGCTGAACCTGG + Intergenic
1054810286 9:69428802-69428824 CAGGTCCACCCAGCTGAAGTGGG - Exonic
1055600385 9:77911206-77911228 ATAGGCCACCAAGCATAAGCTGG + Intronic
1055601623 9:77925038-77925060 GAGGGCCACCCAGCAGGAGCTGG - Intronic
1057129797 9:92646291-92646313 AAAATCCACCCAGCAACAGCAGG + Intronic
1057138958 9:92715351-92715373 CATGGCCATCCAGCAGAAGCTGG - Exonic
1057171158 9:92964014-92964036 AAAGTCCACCCAGCAGAAGCAGG + Intronic
1057755296 9:97830136-97830158 AAAGTCCTCCCAGATGAGGCTGG - Intergenic
1058547929 9:106081027-106081049 AAAGCCCACCCAGCAAGAGATGG + Intergenic
1060038486 9:120279711-120279733 ATACTCCACCCACCAGAGGCAGG + Intergenic
1060745255 9:126126962-126126984 AAGGACCCCCCAGCTGAAGCTGG - Intergenic
1061935610 9:133855996-133856018 AAGGTTCACCCAGCCGTAGCCGG - Intronic
1187590421 X:20711588-20711610 AAAGCACACCCACCAGGAGCAGG + Intergenic
1189031450 X:37455561-37455583 ATAGTCCACACAGCACAAACAGG + Exonic
1189824037 X:44898837-44898859 ACCCTCCACCCAGCAAAAGCAGG - Intronic
1191864200 X:65690740-65690762 AAAGGCCATCCAGCTGAAGCAGG - Intronic
1192829938 X:74741002-74741024 AAAGTTCACCCAGCAAGAGTGGG - Exonic
1195687709 X:107601309-107601331 TAAGCCCACCCTGCAGAAGCAGG + Exonic
1196799671 X:119531320-119531342 AAGGACCACCCAGCAGAAGCAGG - Intergenic
1197127443 X:122964047-122964069 AGAGTCCATACAGCTGAAGCAGG + Intergenic
1197481041 X:126986163-126986185 AAATCCCACCCAGCAGCTGCCGG - Intergenic