ID: 1057171159

View in Genome Browser
Species Human (GRCh38)
Location 9:92964017-92964039
Sequence GTCCACCCAGCAGAAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 267}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057171155_1057171159 15 Left 1057171155 9:92963979-92964001 CCTCCCTGAAGATCTACACAGCA 0: 1
1: 1
2: 1
3: 9
4: 118
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171156_1057171159 12 Left 1057171156 9:92963982-92964004 CCCTGAAGATCTACACAGCAGAT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171151_1057171159 29 Left 1057171151 9:92963965-92963987 CCTGCTGGGCCCCTCCTCCCTGA 0: 1
1: 0
2: 5
3: 70
4: 586
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171150_1057171159 30 Left 1057171150 9:92963964-92963986 CCCTGCTGGGCCCCTCCTCCCTG 0: 1
1: 0
2: 11
3: 117
4: 813
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171152_1057171159 20 Left 1057171152 9:92963974-92963996 CCCCTCCTCCCTGAAGATCTACA 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171157_1057171159 11 Left 1057171157 9:92963983-92964005 CCTGAAGATCTACACAGCAGATC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171153_1057171159 19 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267
1057171154_1057171159 18 Left 1057171154 9:92963976-92963998 CCTCCTCCCTGAAGATCTACACA 0: 1
1: 0
2: 2
3: 15
4: 213
Right 1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG 0: 1
1: 0
2: 1
3: 26
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057171159 Original CRISPR GTCCACCCAGCAGAAGCAGG AGG Intronic
900289612 1:1918391-1918413 CACCACACAGCAGAAGCAGGAGG + Exonic
900408584 1:2502973-2502995 GTCCACGCAGAAGCAGCAGCAGG - Intronic
900478863 1:2888728-2888750 CACCACACAGCAGAAGCAGATGG + Intergenic
900731129 1:4261096-4261118 GTACACCCTGCAGAATCATGAGG + Intergenic
903549914 1:24150681-24150703 GGCGACCCAGCAGTAGGAGGAGG + Intergenic
904120332 1:28193962-28193984 GCCCACCCAGCAGAGCCCGGGGG - Intergenic
904360561 1:29968707-29968729 GTCCAACAAGCAGAGGCAGCAGG + Intergenic
907883547 1:58573146-58573168 GGCTACCCAGCAGGAACAGGAGG + Intergenic
908408614 1:63840780-63840802 GTTCACCCAGCAGAAAGTGGTGG - Intronic
911712920 1:101095878-101095900 GTGCACCCAGCAAAGCCAGGGGG - Intergenic
913531261 1:119735870-119735892 GTCCACCCAGCAAGAGAAGAAGG - Intronic
920075875 1:203336157-203336179 GTCCAGGGAGCAGAAGAAGGGGG - Intergenic
920855033 1:209655040-209655062 TTCCAGGCAGCAGAAGCAGCTGG - Intergenic
1063594445 10:7421125-7421147 GTGCATCCAGCAGAACCATGGGG - Intergenic
1064936107 10:20680640-20680662 GAACACCCAGTAGAAGAAGGTGG - Intergenic
1067113629 10:43418355-43418377 GGCCACTCAGCAGGAGCAGAAGG - Intergenic
1069213682 10:65793174-65793196 GTCCACCCAGCAAAAACCGCTGG + Intergenic
1070831425 10:79420231-79420253 GTCCCCCCAGCACAACCTGGGGG + Intronic
1071905553 10:90169787-90169809 CTCCACCCCTCAGAATCAGGGGG + Intergenic
1073034997 10:100557890-100557912 GTTTACCCAGCATAAACAGGAGG + Exonic
1073206177 10:101770654-101770676 GCCCCCCCAGCAGAGGCAGAGGG + Intronic
1073440733 10:103551145-103551167 GCCCACCCTGCAGAAGCCAGGGG - Intronic
1074441554 10:113481515-113481537 GCACACCCAGTAGAAGCTGGTGG - Intergenic
1075112216 10:119596632-119596654 CTCCAACCAGGAGGAGCAGGAGG + Intronic
1076634007 10:131870986-131871008 CTCCACCCAGCAGACGGAGTTGG + Intergenic
1076997624 11:306450-306472 CCCCAGCCAGCAGAAGGAGGAGG + Intergenic
1077196044 11:1280707-1280729 CACCACCAAGCAGAAGGAGGTGG + Intronic
1077442701 11:2576056-2576078 GTCCACCCAGGTGATCCAGGAGG + Intronic
1080264447 11:30386752-30386774 ATGCACCCAGCATAATCAGGAGG - Intronic
1080726855 11:34906635-34906657 GTCCTCACAGCTGAAGTAGGAGG + Intronic
1081871418 11:46384291-46384313 CTCCACCCTGCAGAAGCCAGGGG + Intergenic
1086051284 11:82594097-82594119 GTCTACCTGGAAGAAGCAGGTGG - Intergenic
1087092581 11:94288934-94288956 TTCGGCCCTGCAGAAGCAGGAGG + Intergenic
1087802529 11:102519569-102519591 CTGCAGCCTGCAGAAGCAGGTGG + Intergenic
1089682783 11:120128782-120128804 CTCCACCCAGCAAGAGCAGGAGG + Intronic
1089875616 11:121718770-121718792 GTCTACCCAGCAGGGCCAGGAGG + Intergenic
1090106010 11:123854338-123854360 GCCCACCCAGGAGAAGCTTGGGG + Intergenic
1091270922 11:134311308-134311330 GTCCACCCGGAAGGAGCTGGTGG - Intronic
1091546197 12:1502948-1502970 GTCCAGCCAGGAGAGGCAGAGGG + Intergenic
1091815957 12:3438123-3438145 GCTCACAGAGCAGAAGCAGGAGG - Intronic
1092152881 12:6263142-6263164 GTTCACCCACCAGAACCAGGTGG - Intergenic
1092603413 12:10092265-10092287 ATCCTCCCAACTGAAGCAGGAGG + Intronic
1093183891 12:15998228-15998250 GCCCACACAGCAGAAGCAACTGG - Intronic
1098076176 12:66734040-66734062 GCCCACACAGCAAAAGCAGCAGG + Intronic
1098856073 12:75654613-75654635 GACAGCCCAGCAGAAGCAGCAGG + Intergenic
1100192304 12:92205734-92205756 CTCCAGCCACCAGAAGCAAGAGG - Intergenic
1100817437 12:98399627-98399649 GTCCACCCCGCAGAAGCCAAAGG + Intergenic
1100819154 12:98414998-98415020 AACCACTCTGCAGAAGCAGGAGG + Intergenic
1100980555 12:100159104-100159126 GGCCACCTATCAGCAGCAGGTGG - Intergenic
1101086947 12:101245711-101245733 GACCACTCTTCAGAAGCAGGAGG - Intergenic
1101397420 12:104360462-104360484 TCCCACCCAGCAGATGGAGGTGG - Intergenic
1102067494 12:109989484-109989506 GGCCACCCAGCAGGAGTAAGTGG - Intronic
1102871912 12:116420374-116420396 GTCCTCCCAGGAGATGCAGGGGG - Intergenic
1103140748 12:118545952-118545974 ATCCACTCTGCAGAAGGAGGTGG + Intergenic
1103526036 12:121569213-121569235 GTCAGCCCAGCAGAACCACGTGG - Intronic
1104744812 12:131204100-131204122 GTCCACCCGGCCTCAGCAGGAGG - Intergenic
1104789601 12:131473319-131473341 GTCCACCCGGCCTCAGCAGGAGG + Intergenic
1105245325 13:18645175-18645197 GGCCACAGAGCAGCAGCAGGAGG - Intergenic
1108847247 13:54693246-54693268 GTCAACCAGGCAGGAGCAGGGGG - Intergenic
1108873392 13:55015082-55015104 GTATTCCCAGCTGAAGCAGGAGG - Intergenic
1111374113 13:87355318-87355340 ATCATCCCAACAGAAGCAGGAGG - Intergenic
1113609020 13:111630120-111630142 CTCCAGCCGGCAGAAGCAGGCGG - Intronic
1115351323 14:32398606-32398628 GTCTAGCCAGCAGAAGGAGAGGG + Intronic
1115954415 14:38762125-38762147 GTCCACCCTGCAGAGACATGAGG + Intergenic
1119318717 14:73716919-73716941 GTATACCCTGTAGAAGCAGGGGG - Exonic
1119703498 14:76770382-76770404 GTCCACCCAGCCCTAGCAGAGGG + Intronic
1119781479 14:77279087-77279109 GTGCACCAAGCACCAGCAGGAGG + Intronic
1121015039 14:90544002-90544024 GTCCACCCAGGAGGAGCACGTGG + Intronic
1121072454 14:91036868-91036890 GTCCACCCAGCAGAAGGTACAGG - Intronic
1121321120 14:92992183-92992205 GCCCAGCTAGCAGAAGAAGGTGG - Intronic
1121517654 14:94563500-94563522 GTCCAACCAGCAGGAGGAGCAGG - Exonic
1121621178 14:95349401-95349423 GGACTCCGAGCAGAAGCAGGGGG + Intergenic
1122650227 14:103221883-103221905 GACCACCCCGCAGTAGCAGCTGG + Intergenic
1122780363 14:104140898-104140920 GACCACAAAGCAGAAGAAGGGGG - Intronic
1122846578 14:104503355-104503377 GTCCAGCCTGCAGAACCATGAGG + Intronic
1123473334 15:20570528-20570550 GGCCACCTATCAGCAGCAGGTGG + Intergenic
1123644674 15:22429825-22429847 GGCCACCTATCAGCAGCAGGTGG - Intergenic
1123665991 15:22609733-22609755 GGCCACCTATCAGCAGCAGGTGG - Intergenic
1123733634 15:23165539-23165561 GGCCACCTATCAGCAGCAGGTGG + Intergenic
1123751762 15:23362914-23362936 GGCCACCTATCAGCAGCAGGTGG + Intronic
1124284134 15:28386838-28386860 GGCCACCTATCAGCAGCAGGTGG + Intronic
1124298563 15:28524776-28524798 GGCCACCTATCAGCAGCAGGTGG - Intronic
1124319813 15:28704146-28704168 GGCCACCTATCAGCAGCAGGTGG - Intronic
1124482697 15:30091284-30091306 GGCCACCTATCAGCAGCAGGTGG + Intronic
1124520880 15:30405934-30405956 GGCCACCTATCAGCAGCAGGTGG - Intronic
1124537781 15:30560285-30560307 GGCCACCTATCAGCAGCAGGTGG + Intronic
1124544237 15:30612346-30612368 GGCCACCTATCAGCAGCAGGTGG + Intronic
1124564200 15:30799782-30799804 GGCCACCTATCAGCAGCAGGTGG + Intergenic
1124760874 15:32447301-32447323 GGCCACCTATCAGCAGCAGGTGG - Intronic
1124777760 15:32601762-32601784 GGCCACCTATCAGCAGCAGGTGG + Intronic
1126556306 15:49991829-49991851 GTCCATCCAGCACAAGGATGAGG - Intronic
1128335254 15:66781489-66781511 CTCCAGCCAGCAGGGGCAGGAGG - Exonic
1128976704 15:72159602-72159624 GTCCACCCAACAGAGGCAGAGGG + Intergenic
1129524293 15:76204171-76204193 GTTCAACCAGAAGAACCAGGAGG + Exonic
1129530346 15:76260087-76260109 GTAGGCCCAGCTGAAGCAGGAGG - Intronic
1130647404 15:85741189-85741211 GGCCAACCTGCAGAAGCAGCAGG + Exonic
1131038984 15:89244621-89244643 GTCCAGCCAGAAGGGGCAGGCGG - Intronic
1131282558 15:91033217-91033239 GGCCACTTAGCAGCAGCAGGTGG - Intergenic
1131510783 15:93048470-93048492 GTCCATGCAGCAGCACCAGGAGG + Intronic
1132748584 16:1447116-1447138 GCCCACACAGCAGAGGCAGGCGG + Intronic
1133341603 16:5040144-5040166 GTAATCCCAGCAGAGGCAGGAGG + Intronic
1134593594 16:15476870-15476892 TTCCACATGGCAGAAGCAGGTGG - Intronic
1137275858 16:46933085-46933107 GTTCACACAGCAGGAGGAGGTGG + Intergenic
1137624775 16:49900684-49900706 GGCCACACAGCAGAAGGAGCAGG - Intergenic
1141094515 16:81153572-81153594 GACCACCCATCAGTAGCTGGCGG - Intergenic
1141705716 16:85663373-85663395 GACCACCCAACAGCAGAAGGAGG + Exonic
1142031954 16:87842964-87842986 CTCCCCCCAGCAGAAGTAAGTGG - Intronic
1142058717 16:88016225-88016247 GTCCATGCAGGAGAAGCATGTGG + Intronic
1142304821 16:89279314-89279336 GTCCACGCAGCAGACGCGGGAGG - Exonic
1142365245 16:89646657-89646679 GACCACGCCGCAGGAGCAGGTGG - Exonic
1142733435 17:1878977-1878999 TTTCACCCTGCAGAAGCACGTGG - Exonic
1143012267 17:3872524-3872546 GTCCACCCAGGGGAACAAGGGGG - Intronic
1143023395 17:3928069-3928091 GCCCACCTGGCAGAGGCAGGTGG + Intronic
1144642276 17:16944124-16944146 GGCCACTCCACAGAAGCAGGAGG - Intronic
1145000620 17:19302106-19302128 GGCCACCCAGCTGGGGCAGGTGG - Intronic
1145211008 17:21013003-21013025 GTTCACCCTGCAGAAGCCTGGGG + Intronic
1146938230 17:36825817-36825839 GTCTAGCCAGCAGAGGGAGGTGG + Intergenic
1147015689 17:37489882-37489904 GCCCAGCCCGCAGAAGCCGGTGG + Exonic
1149596134 17:57865743-57865765 GCCCACCCAACCCAAGCAGGGGG + Intronic
1151961965 17:77410239-77410261 GTACACCCAGTAGCAGCAGTGGG - Intronic
1153646179 18:7198098-7198120 GGCCACTCCGCAGCAGCAGGAGG + Intergenic
1154443621 18:14414772-14414794 GGCCACAGAGCAGCAGCAGGAGG + Intergenic
1155277422 18:24201864-24201886 ATCCACAGAGCAGATGCAGGAGG - Intronic
1156503064 18:37571886-37571908 CTCCATCCAGCACAAGCATGTGG + Intergenic
1156705746 18:39879659-39879681 CTACAAACAGCAGAAGCAGGAGG - Intergenic
1156884771 18:42122304-42122326 TCCCACCCAGTAGAAGAAGGTGG - Intergenic
1157177399 18:45464135-45464157 GTCTACCCAACAGAAGTAGTGGG + Intronic
1157513606 18:48295809-48295831 CTCAGCCCAGCAGCAGCAGGAGG + Intronic
1158146839 18:54323609-54323631 TTCCACTCAGCAGAAGCAGGAGG - Intergenic
1160476140 18:79190035-79190057 CTCCCCGCAGCAGCAGCAGGAGG + Intronic
1160490615 18:79334566-79334588 GTCCACACAGCAGAGGGGGGTGG + Intronic
1160715743 19:575825-575847 CTCCACCCATGAGCAGCAGGAGG - Intronic
1161312119 19:3600521-3600543 GCCCACCACGCAGAAGGAGGCGG + Exonic
1161482649 19:4518535-4518557 GCCCAGCCAGCAGCGGCAGGCGG + Intergenic
1161903622 19:7138252-7138274 CTGCACCCAGCAGATACAGGGGG + Intronic
1162923875 19:13919852-13919874 GCCCACCCAGCAGAGTCTGGTGG + Exonic
1163378641 19:16949728-16949750 GTACAAGCAACAGAAGCAGGAGG - Intronic
1164576520 19:29408404-29408426 ATCCCGCAAGCAGAAGCAGGAGG + Intergenic
1164617222 19:29674472-29674494 GGCCGCCCAGCAGCGGCAGGAGG + Exonic
1165144970 19:33724945-33724967 ATCGACCCAGCAGATGCTGGGGG + Intronic
1165295851 19:34925457-34925479 GGCCACCCACCAGAAGGACGCGG - Intergenic
1166042611 19:40212938-40212960 CTCCACCCTGCAGAAGGAGCGGG + Exonic
1167149939 19:47702566-47702588 AGCAACCCAGCTGAAGCAGGCGG - Exonic
1168689562 19:58368606-58368628 CCCCAACCAGCAGCAGCAGGCGG - Exonic
926165962 2:10522327-10522349 GACCAGCCAGGAGAAGCTGGTGG - Intergenic
929964036 2:46520394-46520416 TTCTACCCTGCTGAAGCAGGTGG + Intronic
933354302 2:81195092-81195114 GTCCACGCAGCAGACGCGGGAGG - Intergenic
934711978 2:96522364-96522386 GCACACCCAGCAGAAGCTGGAGG - Intergenic
934759585 2:96846445-96846467 ATGCACAGAGCAGAAGCAGGAGG - Intronic
938080482 2:128367440-128367462 GCACACCCAGAAGATGCAGGGGG - Intergenic
938092763 2:128444178-128444200 GTCCTAACTGCAGAAGCAGGGGG - Intergenic
938940333 2:136164162-136164184 GTCCACCCTGCAGGAGCACCTGG + Intergenic
940905105 2:159162033-159162055 GTCCAGGCTGCAGCAGCAGGAGG + Intronic
941112172 2:161427467-161427489 GTCCACGCAGCAGATGGTGGCGG - Intronic
941261350 2:163301753-163301775 ATCCAACCAGCAGATGCTGGAGG + Intergenic
941701973 2:168613331-168613353 GTTCACCTAGCAGGAGCACGTGG + Intronic
942496893 2:176549360-176549382 GTAAAACCAGCAGAAGCTGGTGG - Intergenic
942944338 2:181656883-181656905 GTCCCCGCAGCAGACGGAGGCGG - Exonic
943060527 2:183038057-183038079 GCCCAGTCAGCAGAAGCTGGCGG - Exonic
944151056 2:196559322-196559344 GTCCACCCTTCAGAAACACGTGG + Intronic
945032328 2:205677495-205677517 GACCACCGCGGAGAAGCAGGTGG - Intergenic
947268770 2:228309275-228309297 GTCCACCCAGCATAGCCGGGTGG - Intergenic
947592535 2:231393864-231393886 GTCCACCCCTCAGCAGGAGGAGG + Intergenic
948650948 2:239443402-239443424 GTTCACACAGGAGATGCAGGAGG - Intergenic
948902537 2:240963781-240963803 GGCCACCCAGGAGCAGCTGGGGG + Intronic
1172151385 20:32792796-32792818 GTCCCACCAGCAGAGGCAGCGGG - Intronic
1172207493 20:33174265-33174287 GTTCACCCAGCAGCGGGAGGAGG - Intronic
1172551673 20:35805306-35805328 GTGGTCCCAGCTGAAGCAGGAGG - Intronic
1172956782 20:38765726-38765748 GTCCACCCGGCAGAAACATTTGG + Intronic
1174066308 20:47868150-47868172 GTGCACAAAGCAGAAGCTGGTGG - Intergenic
1174157729 20:48527671-48527693 GTCAGCCCAGAAGCAGCAGGAGG + Intergenic
1174157772 20:48527953-48527975 GTGCACAAAGCAGAAGCTGGTGG + Intergenic
1174550795 20:51360155-51360177 CTCCACCCAGGACCAGCAGGTGG + Intergenic
1174564778 20:51456828-51456850 GTGGCCCCAGCAGATGCAGGGGG - Intronic
1174994511 20:55550883-55550905 CTCCACGCAGCAGCAGCAGTGGG + Intergenic
1175723835 20:61303516-61303538 GGGAACCCAGGAGAAGCAGGAGG - Intronic
1176049585 20:63110818-63110840 CCCCACCCTGCAGAGGCAGGTGG - Intergenic
1176230995 20:64032831-64032853 GTCCCCCCAGGAGCAGCAGGAGG + Exonic
1176452467 21:6876466-6876488 GGCCACAGAGCAGCAGCAGGAGG - Intergenic
1176830640 21:13741515-13741537 GGCCACAGAGCAGCAGCAGGAGG - Intergenic
1179150100 21:38802455-38802477 GTCCACCCTGATGGAGCAGGAGG + Intergenic
1179480100 21:41671550-41671572 GCCCTCCCAGCAGAAGGAAGGGG - Intergenic
1179566320 21:42251326-42251348 GTCTCCCCAGCAGCACCAGGTGG + Intronic
1179642236 21:42755407-42755429 GTTCACCCAAGAGCAGCAGGCGG + Intronic
1180782355 22:18528415-18528437 ATCCACCCAGCGGACCCAGGTGG + Intronic
1181125908 22:20702442-20702464 ATCCACCCAGCGGACCCAGGTGG + Intergenic
1181239244 22:21467750-21467772 ATCCACCCAGCGGACCCAGGTGG + Intergenic
1182294710 22:29306300-29306322 GCCCAGCCGGCAGCAGCAGGGGG + Intergenic
1183338047 22:37262208-37262230 ATCCACCCAGCAGCAGCAGATGG + Intergenic
1183687401 22:39369032-39369054 GGCTACCCAGCATAAGCAGCAGG + Intronic
1185258345 22:49848789-49848811 GTCCACCCGACAGGAGCGGGGGG + Intergenic
1185287315 22:50008339-50008361 GGCCGCCCAGAAGCAGCAGGTGG - Intronic
950539275 3:13600303-13600325 GGCCACCCAGTTGCAGCAGGAGG - Intronic
952577340 3:34791068-34791090 GTCTTCCCAGAAGAAGCAAGAGG - Intergenic
954038905 3:47869426-47869448 GGCCACCAGGCAAAAGCAGGTGG + Intronic
954408030 3:50356239-50356261 GTCCACCCTGTGGAAGCAGTAGG - Intronic
955154016 3:56397905-56397927 TTCCAGGCAGCAGAAGAAGGGGG + Intronic
955233500 3:57120284-57120306 GGCCAGCCAGCAGAAACAGTGGG - Exonic
956840314 3:73134148-73134170 TTCCACCCAGCTGCAGAAGGTGG - Intergenic
956872682 3:73433671-73433693 GTGCAGCCTGCAGAAGCAAGAGG - Intronic
964901325 3:161662318-161662340 TTATACACAGCAGAAGCAGGAGG - Intergenic
966235887 3:177701045-177701067 GCCCAGCCAGCAGGAGCAGTTGG - Intergenic
966254252 3:177899452-177899474 GGCCACCCAGCACCAGCAGAGGG - Intergenic
967147253 3:186616724-186616746 ATCCACCCACCCGAGGCAGGTGG + Intronic
968041256 3:195591166-195591188 GTCTTCCCAGCAGAACAAGGGGG + Intergenic
968960737 4:3742158-3742180 TTCCAACCAGCAGTGGCAGGTGG + Intergenic
968969530 4:3786363-3786385 GTCCAGGCAGCACCAGCAGGTGG - Intergenic
969443970 4:7233672-7233694 GTCCACCCTGCAGCATCAGACGG - Intronic
969560810 4:7946675-7946697 CTCCCCTCAGCACAAGCAGGTGG + Intergenic
969569223 4:7998748-7998770 CCCCACCCAGCAGCAGGAGGTGG - Intronic
970079414 4:12263857-12263879 GTCCACCAAGAAGAGTCAGGAGG - Intergenic
970484709 4:16513371-16513393 GTCCATACAGCAGAAGGAGCTGG - Intronic
971009615 4:22418855-22418877 GTCCCAACAGAAGAAGCAGGAGG + Intronic
975892495 4:79046356-79046378 GACCACACAGCAGAAGCAGCAGG - Intergenic
979056639 4:116003282-116003304 GTACACCCTGCAGAACCATGAGG - Intergenic
981747309 4:148064017-148064039 GGCCAGCCGGCAGAAGGAGGCGG - Intronic
985213853 4:187628159-187628181 CTCCACCCAACAAGAGCAGGAGG + Intergenic
985693935 5:1329412-1329434 GTCCACCAAGCAGAGGCCTGAGG - Intronic
985710800 5:1428580-1428602 GCCCACCCACCAGAGGGAGGTGG - Intronic
985756908 5:1724731-1724753 GGCCACCCGCTAGAAGCAGGAGG + Intergenic
988692026 5:33581945-33581967 GTCAAACCACCAGAAGCTGGGGG + Intronic
988727911 5:33942236-33942258 GCCCAAGCAGCAGCAGCAGGAGG + Intergenic
988862890 5:35303319-35303341 ATCCAGTCAGAAGAAGCAGGAGG + Intergenic
990057352 5:51599856-51599878 TTCCAGCCAGAAGAAGCAGAAGG - Intergenic
990592447 5:57280209-57280231 GACCACCCAGCAAAATCAGGTGG + Intergenic
992733681 5:79697451-79697473 GTTCACTCATCAGAAGCATGAGG - Intronic
993854589 5:93057508-93057530 GTCCACACAGAGGAAGCAAGGGG + Intergenic
997944317 5:138185637-138185659 CTCCACCCAGCAGCTTCAGGAGG + Exonic
998063399 5:139136931-139136953 GTCACTCCAGCAGAAGGAGGGGG + Intronic
998092989 5:139381821-139381843 ATCCACACAGCAGGAGCAGGTGG - Intronic
998782616 5:145674824-145674846 GTAGTCCCAGCTGAAGCAGGAGG + Intronic
1000337408 5:160252085-160252107 GTTCACCCAGCAGAACTGGGAGG - Exonic
1003001388 6:2337952-2337974 GTAGAAGCAGCAGAAGCAGGAGG + Intergenic
1004274340 6:14222357-14222379 GCCCACCCAGGAGAGACAGGGGG - Intergenic
1006646652 6:35519620-35519642 GGCCACCCAGCAGAAACCTGGGG - Intergenic
1007413867 6:41680681-41680703 GGCCGCCCAGCAGATGCAGTTGG + Intergenic
1007606116 6:43119406-43119428 GTCCTTCCCGCAGAAGCAGGGGG - Intronic
1012979009 6:105810608-105810630 GGCCACAGAGCAGAAGGAGGTGG + Intergenic
1013838323 6:114359418-114359440 GCCCACCCTGCTGAAGCAGGTGG + Intergenic
1015452645 6:133388936-133388958 GCACACCGAGCAGAAGCAGAAGG - Intronic
1016200117 6:141395788-141395810 GCCCACCCCGCAGCAGCAGCTGG + Intergenic
1016848555 6:148593473-148593495 CTCCATGCAGCAGAAGCAGACGG - Intergenic
1017566848 6:155696114-155696136 GTCTACCCAGCACAAGATGGAGG - Intergenic
1018422329 6:163650246-163650268 GTCCAGCCAGCAGAGGAGGGAGG - Intergenic
1019308183 7:346340-346362 CTCCAGCCTGCAGACGCAGGTGG + Intergenic
1024312674 7:47983758-47983780 GTCCAGTCAGCAGGAGCATGTGG - Intergenic
1024700326 7:51899507-51899529 GTCCAGCCTGCAGAAGGAGCTGG + Intergenic
1024995181 7:55268754-55268776 GTCCCTCCAGGAGAGGCAGGAGG + Intergenic
1025045603 7:55689590-55689612 GTCCTCCAAACACAAGCAGGAGG + Intergenic
1027136907 7:75631060-75631082 ATCCTCCCAGCTGAGGCAGGTGG - Intronic
1029125436 7:98292070-98292092 GTCCTCCCAGGAGAAGCAGATGG + Exonic
1029346993 7:99985921-99985943 GAACACCAAGCAGAAGTAGGAGG + Intergenic
1029466393 7:100727883-100727905 GTAGGCCCAGCAGAAGCAGGAGG + Intergenic
1029616985 7:101665254-101665276 GGCCACACAGCAGAGCCAGGAGG + Intergenic
1032407830 7:131669845-131669867 TTCTACCCACCAGAAGGAGGAGG - Intergenic
1034718014 7:153261748-153261770 GCCCACACAGCAGAACCATGTGG - Intergenic
1035464356 7:159064970-159064992 GCCCACCTTCCAGAAGCAGGCGG + Intronic
1037934780 8:22908253-22908275 GACCACCCAGCAGAAGAAGCTGG + Intronic
1040568220 8:48585753-48585775 GTCCACACAGCAGCACCAGGGGG - Intergenic
1040841802 8:51792636-51792658 GTCTCCCCAGCACCAGCAGGGGG - Intronic
1041027819 8:53704594-53704616 TTCCACCCATGAGAAGCAAGTGG + Intergenic
1041927279 8:63250007-63250029 GTGCAGCCAGCAGAAACAAGAGG - Intergenic
1045324398 8:101107217-101107239 GTGGTCCCAGCTGAAGCAGGAGG + Intergenic
1049058332 8:140256543-140256565 GGCAACCAAGCGGAAGCAGGTGG - Intronic
1049182794 8:141231542-141231564 GAGCACCCAGCAACAGCAGGTGG + Intronic
1049287223 8:141782370-141782392 GGGCAGCCGGCAGAAGCAGGAGG + Intergenic
1052021566 9:23531314-23531336 GCCCACCCAGCAGTAATAGGAGG + Intergenic
1052347593 9:27425973-27425995 ATTCACCCAGCAGAAGGAGGAGG + Intronic
1052778314 9:32755294-32755316 GCACACCCAGCAGCAGCAGCGGG - Intergenic
1053303282 9:36966623-36966645 GTTCACACAGCAGCAGCTGGAGG - Exonic
1055600388 9:77911209-77911231 GGCCACCAAGCATAAGCTGGGGG + Intronic
1056031221 9:82555601-82555623 GGCTTCCCAGCTGAAGCAGGAGG - Intergenic
1056708792 9:88973269-88973291 TGGCACCTAGCAGAAGCAGGCGG - Intergenic
1057171159 9:92964017-92964039 GTCCACCCAGCAGAAGCAGGAGG + Intronic
1057281637 9:93716862-93716884 CTCTGCCCAGCAGAAGCAGGCGG - Intergenic
1057695042 9:97317130-97317152 GTCCACCCTGCAGCAGGAGCTGG + Exonic
1059452331 9:114378156-114378178 GTGCACATAGCAGGAGCAGGGGG - Intronic
1060101371 9:120843481-120843503 GTCCACCAAGGAGAAGCAGCTGG + Intergenic
1060599627 9:124869310-124869332 GTCCACCCGGCGGAAGCGCGAGG - Exonic
1060827022 9:126693390-126693412 CTACCCCCAGCAGGAGCAGGGGG - Intronic
1060828491 9:126699773-126699795 GGCCACCCAGCAGAAGCCTGTGG + Exonic
1061267453 9:129515063-129515085 GTCCACCCTGCTGCAGCAGCTGG + Intergenic
1061489460 9:130937266-130937288 GACCACCCCGGAGAAGCAGTGGG + Intronic
1061801634 9:133116171-133116193 GTCCACCCACCTGGAGCTGGAGG - Intronic
1062407029 9:136401521-136401543 CACCAACCAGCAGGAGCAGGAGG + Intergenic
1062543036 9:137049908-137049930 GGCCACCCTGCAGCAGCTGGAGG - Exonic
1062669092 9:137695798-137695820 GTCCACCCAGGCAAAGGAGGGGG + Intronic
1203516714 Un_GL000213v1:8049-8071 GGCCACAGAGCAGCAGCAGGAGG + Intergenic
1186417028 X:9392822-9392844 TTCTACCCAGCAGAACAAGGAGG - Intergenic
1189267229 X:39726105-39726127 GTTTGCCCAGCAGCAGCAGGGGG - Intergenic
1190566019 X:51731521-51731543 CTCCAACCAGCAGCAGCAGATGG - Intergenic
1199084912 X:143617308-143617330 GTCCAGCCTCCAGAAGCAGAAGG + Intergenic
1199336095 X:146620351-146620373 GTCCACGCAGCAGACGAGGGAGG - Intergenic
1200155424 X:153972391-153972413 GCACACCCAGCAGCCGCAGGAGG + Exonic
1201579795 Y:15499545-15499567 GGCCACACAGAAGAAGCATGTGG - Intergenic