ID: 1057171161

View in Genome Browser
Species Human (GRCh38)
Location 9:92964021-92964043
Sequence ACCCAGCAGAAGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 748
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 668}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057171153_1057171161 23 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668
1057171157_1057171161 15 Left 1057171157 9:92963983-92964005 CCTGAAGATCTACACAGCAGATC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668
1057171152_1057171161 24 Left 1057171152 9:92963974-92963996 CCCCTCCTCCCTGAAGATCTACA 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668
1057171155_1057171161 19 Left 1057171155 9:92963979-92964001 CCTCCCTGAAGATCTACACAGCA 0: 1
1: 1
2: 1
3: 9
4: 118
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668
1057171156_1057171161 16 Left 1057171156 9:92963982-92964004 CCCTGAAGATCTACACAGCAGAT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668
1057171154_1057171161 22 Left 1057171154 9:92963976-92963998 CCTCCTCCCTGAAGATCTACACA 0: 1
1: 0
2: 2
3: 15
4: 213
Right 1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 75
4: 668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057171161 Original CRISPR ACCCAGCAGAAGCAGGAGGA TGG Intronic
900499844 1:2998646-2998668 ACACAGCTGGAGCAGGAGGAGGG + Intergenic
900844006 1:5081699-5081721 CCCCAGCTGAACCTGGAGGAGGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900904675 1:5546093-5546115 ACACAGCAAAAGCAGTATGAAGG + Intergenic
900919767 1:5662777-5662799 TCCCAGCAGGGGCAGGAGGCAGG + Intergenic
901176477 1:7303054-7303076 TCCCAGCAGCACCAAGAGGAAGG - Intronic
901220540 1:7581104-7581126 GCCCAGCAGATGTGGGAGGAGGG - Intronic
901380883 1:8873288-8873310 TCACAGCAGAAGCAGGCGGAAGG - Intronic
901457083 1:9369256-9369278 ACCCACCTGAAACAGGAGGGAGG - Exonic
901473472 1:9473409-9473431 ACCCAGCAGCGGCAGGAGCTGGG + Intergenic
901926292 1:12568241-12568263 ACCCAGCAGAAGCATGCCAATGG + Exonic
902490107 1:16775342-16775364 CCAAAGCAGAAGCAGCAGGAGGG + Intronic
902550235 1:17214938-17214960 ACCAGGAAGAGGCAGGAGGAGGG - Intronic
902562642 1:17287326-17287348 ACACAGCAGATGCTTGAGGAAGG - Intergenic
902840367 1:19070395-19070417 TCCCAGCAGCACCAAGAGGATGG - Intergenic
903068270 1:20713449-20713471 ACCAAGCAGAAGCTGGAGGTGGG - Exonic
903286902 1:22282988-22283010 TGCCATCAGAAGCAGGAGCATGG - Intergenic
904071556 1:27802490-27802512 ACTGAGCAGATGGAGGAGGAGGG + Intronic
904460126 1:30671674-30671696 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
905216530 1:36412238-36412260 GCCCAGCTGAGGCAGGAGGCAGG - Intergenic
905457504 1:38098311-38098333 AACCAGCAGAAGCTGGAGCCCGG - Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
907287383 1:53390530-53390552 AGACAGCAGAAGGAGGAGAAGGG + Intergenic
907786824 1:57620691-57620713 GGCCAGCAGCAGCAGGAGTAGGG + Intronic
907865757 1:58397665-58397687 ACCCAGCAGAAGGAGCAGGCTGG - Intronic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
910333136 1:86098466-86098488 GCTCAACAGAAGCAGGTGGAAGG + Intronic
910805856 1:91189344-91189366 GCCCAGCAGGAGCAGGGGGCAGG + Intergenic
911292652 1:96076582-96076604 AGGCAGCAAAAGCAGCAGGAAGG + Intergenic
911515424 1:98862561-98862583 ACCCAGCAAAAAAAAGAGGAAGG - Intergenic
911830222 1:102541279-102541301 ACAGGGCAGGAGCAGGAGGAAGG + Intergenic
912271344 1:108212314-108212336 CCCCAAAATAAGCAGGAGGAAGG - Intergenic
912543335 1:110433377-110433399 AACCTGTAGAAGCAGAAGGAAGG + Intergenic
912587888 1:110783450-110783472 ACCAAGCAGCAGCAGGAAAAGGG - Intergenic
912602237 1:110948152-110948174 ACCCATGAGAAGCAAGAGAAAGG - Exonic
912823822 1:112887714-112887736 AACCAGCCAAAGCAGCAGGAAGG - Intergenic
913452651 1:119002448-119002470 ACCCAGCAGAAACAGCAAGCAGG - Intergenic
913494817 1:119418754-119418776 ACAAACCTGAAGCAGGAGGAAGG - Intronic
914741497 1:150469514-150469536 GGGCAGCAGAGGCAGGAGGATGG - Intronic
915076653 1:153313170-153313192 CACCAGCAGGGGCAGGAGGAAGG + Intergenic
916498072 1:165362953-165362975 ATCCATCAGAAGAATGAGGATGG - Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916839349 1:168583997-168584019 ACCCAGAGGAAGAAGGAGGCTGG + Intergenic
917429276 1:174948769-174948791 TCCCAGCAGAAGCCTGAGGCAGG + Intronic
918256486 1:182753277-182753299 ACCCAGCAGAAGCCGGTAGAGGG + Intergenic
919738172 1:200966489-200966511 CTCCTGCAGAAGCAGGAGGTTGG - Intergenic
919823307 1:201486349-201486371 ACCCAGGAAAAGCAAGAGGCAGG + Intronic
920450953 1:206060774-206060796 ACCCACCAGGAGCAAGATGAGGG - Intronic
920458250 1:206117108-206117130 ACCCAGGAGAGGGAGAAGGAGGG + Exonic
920817558 1:209349177-209349199 GCCCAGCAGACTTAGGAGGAAGG - Intergenic
920924165 1:210326486-210326508 ACCCACTAGAAAAAGGAGGAGGG - Intergenic
920968704 1:210723652-210723674 AGCCAGCAGAAACAAGAGAATGG - Intronic
921394485 1:214654077-214654099 AAACAGCAGCAGGAGGAGGAGGG - Intronic
921945406 1:220882766-220882788 AAGCAGCAGGAGGAGGAGGAAGG - Intronic
922572541 1:226642596-226642618 AACCAGCAGAAGAAGGAAGACGG + Intronic
922604864 1:226883708-226883730 AGCCAGGAGAACGAGGAGGACGG + Exonic
922841555 1:228647023-228647045 ACCCAGAAGAGTGAGGAGGAGGG + Intergenic
922842980 1:228659473-228659495 ACCCAACACTAGCAGAAGGAAGG + Intergenic
923462590 1:234219992-234220014 GATCAGAAGAAGCAGGAGGAGGG + Intronic
923530330 1:234807188-234807210 CCAAAGCAGAAGCAGCAGGAGGG - Intergenic
924162265 1:241245351-241245373 ACACGGCAGGAGCAAGAGGAGGG - Intronic
924181770 1:241446101-241446123 GCCCAGCAGAGGCATGAGGTTGG + Intergenic
924643476 1:245855996-245856018 TCCCTGCAGACGCAGGAGGTGGG - Intronic
924722978 1:246639969-246639991 AGATAGCAGAAGCAGGAAGAGGG - Intronic
924729312 1:246697259-246697281 ACCCAGCAGGGGCAGAAAGAAGG - Intergenic
1063677039 10:8150012-8150034 ACCTAGCTGAAGCAGAATGAAGG - Intergenic
1064593558 10:16920093-16920115 ACCCAGCAGAATCAGCATCATGG + Exonic
1065133899 10:22649786-22649808 ACACAGCACAGGCAGGTGGAAGG + Intronic
1067561146 10:47305523-47305545 CACCAACAGAAGCTGGAGGAAGG - Intronic
1067840856 10:49678480-49678502 ACCCAGCAGACTATGGAGGAAGG - Intergenic
1069784997 10:70982082-70982104 ACCCAGCAGCAGCTGGGGAACGG - Intergenic
1071359999 10:84837217-84837239 ACCCAGGAGAAGCATGTGGCTGG + Intergenic
1072208395 10:93224513-93224535 ACCCAGAAGAATCAGGAGAAAGG + Intergenic
1072611103 10:97018255-97018277 ACCTGGCAGGAGCAGGAAGAAGG + Intronic
1072982927 10:100114917-100114939 GCCCTGCAGAAGCTAGAGGAGGG - Intergenic
1073007481 10:100335989-100336011 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
1073332289 10:102678225-102678247 ACCTGGCAGCAGCAGGGGGAAGG + Intronic
1073579888 10:104655785-104655807 ACACGGAAGAAGCAGGAGCAAGG - Intronic
1073862290 10:107760821-107760843 ACCCAGCAGAAGCCTTGGGAAGG + Intergenic
1074814550 10:117134534-117134556 ACCAAGCAGAAGAAGGACCAGGG - Exonic
1074944890 10:118271758-118271780 CCTCAGCAGAAGCAGCAGGGAGG - Intergenic
1075322927 10:121506588-121506610 ACCCAGCAGAGGCAGAGGCATGG + Intronic
1075667328 10:124240529-124240551 CCCCAGCAGCAGCAGGAGATTGG - Intergenic
1076055216 10:127367343-127367365 ACCCTGGAGAAGCAGGATAAGGG - Intronic
1076065521 10:127444850-127444872 AGCCACCAGAAGCTGGAGGGAGG - Intronic
1076406115 10:130213550-130213572 ACATAGCAGGAGCAGGAGGAGGG - Intergenic
1076542743 10:131224342-131224364 AGGCAGCAGACCCAGGAGGATGG - Intronic
1077073226 11:687333-687355 AGCGAGAAGAAGCAGGAGGGAGG - Intronic
1077192454 11:1261090-1261112 AGCTAGAAGAGGCAGGAGGAAGG + Intronic
1077887318 11:6395496-6395518 GCCCAACACAAGCAGGTGGAGGG + Exonic
1077997850 11:7469241-7469263 AGCCAACAGAAGTAAGAGGAAGG - Intergenic
1078167515 11:8901153-8901175 ACCCAAAGGAAGCAGGAGGAAGG - Intronic
1078599616 11:12718494-12718516 GCCCCACAGAAGCTGGAGGAAGG - Intronic
1080346248 11:31329007-31329029 ACCCATCAGAATCAGGAGGAAGG - Intronic
1080612849 11:33919818-33919840 TCCCAGCAGTAGAAAGAGGAAGG - Intergenic
1081761963 11:45582882-45582904 GTCCAGCAGAAATAGGAGGAAGG - Intergenic
1081876234 11:46410208-46410230 GCCCATCAAAAGCAGGAGGAAGG + Intronic
1082028871 11:47590790-47590812 GCCCAGCAGAAGCGGCAGCATGG + Exonic
1082174531 11:49046158-49046180 ACCCAGCATGAGCTGAAGGAGGG - Intergenic
1082828524 11:57598296-57598318 AGCCAGCAGCAGCAGCAGGAGGG - Exonic
1083091633 11:60205924-60205946 GCCCAGCAGAAGGTGGGGGAAGG + Intronic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1083327498 11:61880209-61880231 AACCAGCAGAGACAGGCGGAAGG + Intronic
1084068787 11:66720560-66720582 AACCAGCAGCAGCGGGTGGAGGG + Intronic
1084185083 11:67467316-67467338 CCCCAGCAGCAGGAGCAGGAAGG + Exonic
1084367040 11:68708474-68708496 TCCCAGGAGATGCATGAGGAAGG + Exonic
1084680906 11:70665848-70665870 ACCCAGCTCAAGAAGGTGGACGG - Intronic
1084693824 11:70742228-70742250 TGCCAGCAGAAGGAGGAGGAAGG - Intronic
1085242638 11:75071436-75071458 CACCAGCAGAAGGGGGAGGAAGG + Intergenic
1085867516 11:80312053-80312075 AATGAGCAGAAGCAAGAGGATGG - Intergenic
1086194309 11:84118692-84118714 CAGCAGCAGAAGCAGGAAGATGG + Intronic
1086767994 11:90723302-90723324 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
1088372885 11:109110774-109110796 AACCAGCAGAAGCTGGGAGATGG + Intergenic
1088813184 11:113405135-113405157 ACACAGCATTAGCAGGAAGAAGG - Intergenic
1089247970 11:117136485-117136507 ACACAGCAGAAACAGGTGGAAGG - Intergenic
1089258744 11:117208076-117208098 ACACAGCAGAAACAGGTGGAAGG + Intronic
1089343839 11:117777732-117777754 AGCCAGCTGAGGCAGGAGGTGGG - Intronic
1089359160 11:117874933-117874955 ACCCTGCAGAGGAAGGTGGAGGG - Intronic
1089504865 11:118956382-118956404 AGCCAGCAGAATCAGGATCAAGG - Exonic
1090213658 11:124941438-124941460 ATTCAGCTGAAGCAGGAGTATGG + Intergenic
1090340864 11:126018992-126019014 ACCCAGCAGAAGCATGTTAACGG + Intronic
1090472198 11:126990334-126990356 ACCCTGCAGAATCAGGAGAGAGG + Intronic
1090481247 11:127070635-127070657 AGCAAGCAGAAGAAGGTGGAAGG - Intergenic
1091084304 11:132705640-132705662 ACACGGCAAAAGCAGGAGCAAGG - Intronic
1091088605 11:132747904-132747926 AGCCAGGTGAGGCAGGAGGATGG - Intronic
1091414712 12:271332-271354 AACCAAAAGAAGCAGCAGGAGGG - Intergenic
1092060327 12:5545639-5545661 GCCCAGGAGAAGTAGAAGGAAGG + Intronic
1092911974 12:13153508-13153530 GGCCTGCAGAAGCAGGAGGGAGG + Intergenic
1093434898 12:19125653-19125675 AACGAACAAAAGCAGGAGGAAGG + Intergenic
1094046825 12:26176810-26176832 AACCAGCAGAGGCACGATGATGG - Intronic
1094272244 12:28629867-28629889 CTCCAGCAGAAGCCTGAGGAGGG + Intergenic
1094448948 12:30563498-30563520 ACACAGCAAAAGCAGTAGTAAGG + Intergenic
1095624695 12:44301174-44301196 ACAGAGTAGAAGCATGAGGATGG - Intronic
1095830356 12:46579197-46579219 TCTCAGCTGAGGCAGGAGGAAGG - Intergenic
1095842533 12:46709874-46709896 TCCCAGCAGAAGAGGGAGGAGGG + Intergenic
1095962126 12:47842262-47842284 ACCCATCAGAAGGAGAAGGAAGG - Intronic
1096007174 12:48183124-48183146 ACGGTGCAGAGGCAGGAGGAGGG - Intergenic
1096189588 12:49607160-49607182 ACCCAAAATAAGCAGAAGGAAGG + Intronic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096414262 12:51400045-51400067 ACCCACCACACCCAGGAGGAGGG - Intronic
1096530096 12:52236928-52236950 ACCCTGTAGAATCAGGATGAGGG - Intronic
1096544671 12:52329422-52329444 ACCCAGGACAAGAAGGGGGAGGG - Intergenic
1096673650 12:53214856-53214878 ACCCTGCAGGAGCTGGGGGAGGG + Intronic
1097827005 12:64184492-64184514 GGGCAGCAGTAGCAGGAGGAAGG - Intergenic
1098414970 12:70223072-70223094 AAGAAGCAGAAGCAGGAGGAAGG - Intergenic
1098891232 12:76012272-76012294 ACCAAGGAGAAGGTGGAGGAAGG + Intergenic
1099803863 12:87492653-87492675 ACACAGCTGAAGCAGGAGGGAGG - Intergenic
1100408450 12:94291338-94291360 TCCCAGCTGAGGCAGGAGGATGG - Intronic
1100829415 12:98504046-98504068 AACCAGCGGAAGCGGGAGAACGG - Intergenic
1102032078 12:109745743-109745765 AGGAAGCAGAGGCAGGAGGATGG - Intronic
1103019858 12:117525270-117525292 ACCCAGCAGGACCATGAGGGAGG - Intronic
1103049114 12:117763895-117763917 ACCCACCAGAACCCAGAGGAAGG + Intronic
1103324654 12:120112334-120112356 CCCAGGCAGGAGCAGGAGGAAGG - Intronic
1103898992 12:124293785-124293807 GCCCTGCAGCAGCAGGAGTAAGG - Intronic
1104138120 12:125959762-125959784 GGCCAGCAGAAGCTGGAAGAGGG + Intergenic
1104472048 12:129037074-129037096 AGCCACCAGAAGCTGCAGGAGGG + Intergenic
1104726385 12:131078079-131078101 GCCCTGAAGCAGCAGGAGGAGGG - Intronic
1105855039 13:24365200-24365222 ACACAGGAGAAGCAGGCCGAGGG - Intergenic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106063327 13:26317781-26317803 ACACAGCAAAAGCAGTAGTAAGG + Intronic
1106077477 13:26473908-26473930 AGTCAGCAGAGGTAGGAGGAGGG - Intergenic
1107362612 13:39636671-39636693 ACAAAGGAGAAGGAGGAGGAGGG - Intergenic
1107804001 13:44137165-44137187 GCCCAGGAGAAGCTGGAGGAGGG + Intergenic
1108360415 13:49663818-49663840 TCCCAGCTGAGGCAGGAGAATGG + Intronic
1108408678 13:50127232-50127254 GCACAGCAGAAGCAGGAAGACGG - Intronic
1109781445 13:67115415-67115437 ACCCAGGAGCAGAAGGATGAAGG + Intronic
1109931921 13:69226934-69226956 AGCAAGCAGAAGAAGGTGGAAGG + Intergenic
1110391664 13:74981606-74981628 TCCAAGCAGAGGCAGGAAGAAGG - Intergenic
1110416442 13:75258775-75258797 ACCTAGAAGCACCAGGAGGAGGG - Intergenic
1112302100 13:98239894-98239916 TCCCAGCAGGTGAAGGAGGAGGG + Intronic
1112624444 13:101088010-101088032 ACCAAGCAGAAAGAGGAAGAAGG - Intronic
1113104544 13:106758518-106758540 AGCCACCAGAAGCTGGAAGAGGG - Intergenic
1113395385 13:109942699-109942721 ACTCAGGAGAATCAGGAGAAGGG - Intergenic
1113801571 13:113089273-113089295 GCCCCTCAGAAGCAGGAGGGTGG + Intronic
1113801585 13:113089343-113089365 GCCCCTCAGAAGCAGGAGGGTGG + Intronic
1113801600 13:113089413-113089435 GCCCCTCAGAAGCAGGAGGGTGG + Intronic
1114458492 14:22872317-22872339 ACCAAGGAGGAGGAGGAGGAGGG - Exonic
1114497689 14:23145035-23145057 TCCCAGCTGAGGCAGGAGAATGG - Intronic
1114636587 14:24190553-24190575 AACCGTCAGAAGCAGCAGGATGG + Exonic
1115089201 14:29553724-29553746 AGCCACCAGAAGACGGAGGAAGG + Intergenic
1117315727 14:54568465-54568487 GCCCAAAAGAAGGAGGAGGAAGG - Intronic
1117373353 14:55098830-55098852 AAGCAGCAGAAGCAGAAGAAAGG + Intergenic
1118317410 14:64733625-64733647 ACCGAGCAGAAGCAGGACCCGGG + Intronic
1118343905 14:64919932-64919954 ACCCAGAGCAAGCAGAAGGAAGG + Intronic
1118465343 14:66025483-66025505 ACCCAGCAGCAGCCAAAGGAAGG - Intergenic
1118973736 14:70659524-70659546 AAGCAGCCGCAGCAGGAGGAGGG + Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119724232 14:76912491-76912513 ACCCAAAAGAATCAGCAGGAAGG + Intergenic
1119895984 14:78220392-78220414 AAGCAGCAGATGCAGCAGGAAGG + Intergenic
1120765139 14:88322137-88322159 TCAGAGTAGAAGCAGGAGGAGGG - Intronic
1120848773 14:89149723-89149745 ACCCATCAGACCCAGTAGGAGGG - Intronic
1121244331 14:92451346-92451368 ACTCGACTGAAGCAGGAGGAAGG + Intronic
1121562612 14:94886213-94886235 ACCCTGTAGAAGGAGGAGGCGGG + Intergenic
1121991680 14:98563977-98563999 ACTCAGCAGCACCAGAAGGATGG + Intergenic
1122196398 14:100090070-100090092 ACCCAACAAAAGTAGAAGGAAGG + Intronic
1122250370 14:100434959-100434981 ACCCCTCAGGAGCAGAAGGAAGG - Intronic
1122337985 14:101006388-101006410 ACGCTGGAGAAGCAGGTGGAGGG - Intergenic
1122357385 14:101131892-101131914 CCTAAGCAGAAGTAGGAGGAGGG - Intergenic
1122550098 14:102544911-102544933 ACCCCGCAGGTTCAGGAGGAAGG + Intergenic
1122574606 14:102733622-102733644 CCCCTGCAGAAGGTGGAGGAAGG - Intergenic
1122650229 14:103221887-103221909 ACCCCGCAGTAGCAGCTGGAAGG + Intergenic
1123681265 15:22765822-22765844 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124333476 15:28840284-28840306 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124658546 15:31527176-31527198 ACGCAGCAGAATAAGGAGGTTGG - Exonic
1124955817 15:34359662-34359684 ACCCAGCAGCAGGTGCAGGATGG + Exonic
1125446171 15:39759734-39759756 AACCATCAGAAGCTGGAAGAGGG - Intronic
1125518209 15:40334643-40334665 ACTCAGGAGAGGCAGGAGGCTGG + Exonic
1125605912 15:40939824-40939846 ACCCTGCAACAGCAGGAGGAAGG - Intergenic
1125687305 15:41571061-41571083 GCCCAGCTGAAGCAAGAGGATGG + Exonic
1125722078 15:41850028-41850050 AGCCTCCAGAAGCTGGAGGAAGG - Intronic
1126340308 15:47634382-47634404 ACCTGGGAGAAGGAGGAGGAGGG + Intronic
1126436993 15:48646241-48646263 ACTCAGCAGACGCCGGAGGCCGG + Intergenic
1128693411 15:69742658-69742680 ACACAGCTGGAGCAGGAGGCTGG + Intergenic
1129255174 15:74330300-74330322 GCCCAGCAGGAGGAGGAAGAGGG + Exonic
1129359635 15:75016703-75016725 AACCAGCAGACGTAGGAGCAGGG - Exonic
1129530345 15:76260083-76260105 GCCCAGCTGAAGCAGGAGGATGG - Intronic
1129672635 15:77615811-77615833 GCCCAGCACCAGCAGGAGGATGG + Exonic
1129809183 15:78493205-78493227 ATAGAGCACAAGCAGGAGGAAGG + Intronic
1129904543 15:79177070-79177092 AGCCAGCAGAACCTGGAAGAGGG + Intergenic
1131390452 15:92043884-92043906 ACCAGGGAGAAACAGGAGGAGGG - Intronic
1131748789 15:95482460-95482482 GCCCGGGAGAGGCAGGAGGAGGG - Intergenic
1131764293 15:95658768-95658790 ACCCAACAGGAGCAGAAGGAGGG + Intergenic
1132055688 15:98649027-98649049 AGCCAGGAGGAGGAGGAGGAGGG + Exonic
1132602880 16:781777-781799 GCCCAGCAGCAGCAGGACGGGGG - Intronic
1132845685 16:1999879-1999901 ACACAGGAGGAGGAGGAGGACGG - Exonic
1132894916 16:2224114-2224136 GCCCATCAGGTGCAGGAGGAAGG - Intronic
1133516323 16:6512760-6512782 AGTCAGCAGGAGCAAGAGGATGG + Intronic
1133563570 16:6971773-6971795 ACCCAACAGAAGCAGGACTGTGG - Intronic
1133768361 16:8853356-8853378 ACCCAGCAGAAGGCAGAGGCGGG + Exonic
1134105585 16:11483969-11483991 ACAGAGGAGAAGCAGGAGGAAGG + Intronic
1134147348 16:11776643-11776665 ACCCAACTGAAGCAGGTTGATGG + Intronic
1134527902 16:14958366-14958388 ACATAGCTGGAGCAGGAGGAAGG - Intergenic
1135142795 16:19935988-19936010 GTCCAGCAAAAGCAGGAGGTGGG + Intergenic
1135200987 16:20437417-20437439 ACCCAGCAGAACAAGCAGGAAGG + Intronic
1135218129 16:20590450-20590472 ACCCAGCAGAACAAGCAGGAAGG - Intergenic
1135376761 16:21953766-21953788 ACCCAGGGGGAGCGGGAGGACGG + Intronic
1135782947 16:25322225-25322247 ATCCAGATGAAGAAGGAGGAGGG - Intergenic
1135998975 16:27275537-27275559 ACCCAGAGAAAGCAGAAGGAAGG + Intronic
1136368935 16:29823736-29823758 TCCCAGCTGAGGCAGGAGAATGG + Intronic
1136394824 16:29987172-29987194 AAGCAGCAGCAGCAGCAGGAGGG - Exonic
1136507197 16:30712272-30712294 GCCCCGCAGAAGCAGGGGAATGG - Exonic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137624772 16:49900680-49900702 ACACAGCAGAAGGAGCAGGGTGG - Intergenic
1137649933 16:50111052-50111074 AACCAACAGAAGCAGTAGGCAGG - Intergenic
1137836466 16:51597182-51597204 ACGCAGCAGGAGCAAGAGAAAGG - Intergenic
1138375979 16:56564481-56564503 ACAAAGCAGAAGCAGCAAGAGGG - Intergenic
1138587736 16:57982069-57982091 AATCAACTGAAGCAGGAGGAAGG - Intronic
1138874197 16:60928967-60928989 ACCCATCAGAGGCAGGAGTATGG + Intergenic
1140159848 16:72478087-72478109 ACCCAAAACAAGCAGAAGGAAGG + Intergenic
1141495776 16:84408415-84408437 GCCCAGCAGCAGCAGGATCAGGG - Exonic
1141660261 16:85437551-85437573 ACCAAGGAGAAGGACGAGGAGGG + Intergenic
1141766170 16:86061307-86061329 ACTGAGCAGATGCAGGAGAATGG + Intergenic
1142327581 16:89426330-89426352 ACACAGGAGAAGGTGGAGGAAGG + Intronic
1142707538 17:1705907-1705929 ACGCAGCAGAAGCAGCAGGGAGG + Exonic
1143023398 17:3928073-3928095 ACCTGGCAGAGGCAGGTGGATGG + Intronic
1143896706 17:10142109-10142131 TCCCAGCTGAGGCAGGAGAATGG + Intronic
1145103879 17:20098740-20098762 AGGCAGCAGGAGGAGGAGGATGG - Intronic
1145210443 17:21009147-21009169 ACCGTGCAGAGGCAGGAGGTAGG + Intronic
1145730306 17:27177024-27177046 AACCTGCAGAATCAGGAGAAAGG - Intergenic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1146013512 17:29214507-29214529 GCCATGCAGAAGCAGGAAGATGG + Intergenic
1146260371 17:31416668-31416690 CCCCTGCAGCAGCAGGAGAAGGG + Intronic
1146460479 17:33042247-33042269 GCCAGGCAGAGGCAGGAGGAGGG - Intronic
1146635487 17:34501310-34501332 CCCCTGCAGCAGCAGGAGGAAGG + Intergenic
1147034552 17:37670576-37670598 TCTCGGGAGAAGCAGGAGGAGGG + Intergenic
1147371158 17:39994060-39994082 ACAAAGCAGAAAAAGGAGGAGGG - Intronic
1147992481 17:44343645-44343667 AGGCAGCAGAAGTCGGAGGAGGG - Intergenic
1148326072 17:46784185-46784207 TCCCATGAGAAACAGGAGGAAGG + Intronic
1148436943 17:47692733-47692755 ACCCAGCAGGAGGAGGAGGAAGG + Intergenic
1148624989 17:49062446-49062468 TCCCAGCTAGAGCAGGAGGATGG + Intergenic
1149550069 17:57533393-57533415 GAGCAGCAGAAGCTGGAGGAAGG - Intronic
1149575093 17:57706245-57706267 AGACATCAGAAGCAGGAGAAGGG + Intergenic
1149993491 17:61395592-61395614 ACAGAGCAGAAGCAGGCAGAGGG + Intergenic
1150979870 17:70129009-70129031 AGATAGCAGAAGCAGGAAGAGGG - Intronic
1151600628 17:75104068-75104090 GCCCTGCAGAAGAAGGAGCAAGG + Exonic
1151752256 17:76046275-76046297 ACCCAGAGGAAGCAGGGGGCGGG + Intronic
1151828100 17:76534888-76534910 ACACCGCAGAGCCAGGAGGAAGG - Intronic
1151874696 17:76860785-76860807 AGCCAGCAAAACCAGGAAGATGG - Intergenic
1151961964 17:77410235-77410257 ACCCAGTAGCAGCAGTGGGATGG - Intronic
1152068639 17:78124614-78124636 CACCAGCAGCAGCAGCAGGAGGG + Exonic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152433728 17:80262922-80262944 AGCCAGCAGAAGAAGGTGGTGGG + Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1152670084 17:81598282-81598304 ACCCAGCAGCACCAGAGGGAGGG - Intronic
1152861503 17:82698918-82698940 AGCCAGAACAAGCAGGAGGCGGG + Intergenic
1153014415 18:570697-570719 AACTAGCAGAAGGAGGAGGCTGG + Intergenic
1153414021 18:4825461-4825483 AAGCAGCAGCAGCAGGAAGAGGG - Intergenic
1153477467 18:5512659-5512681 ACCCAGCAGAAAGAAGATGAGGG + Intronic
1153523716 18:5976380-5976402 TCCCAGCAGAAGCAGAATGCTGG - Intronic
1153601813 18:6788245-6788267 ACCTGGCCGGAGCAGGAGGAAGG - Intronic
1153670730 18:7409733-7409755 ACCCAAACCAAGCAGGAGGAAGG - Intergenic
1154113773 18:11593133-11593155 TCCCAGCAGAAGCAGGGGCCTGG - Intergenic
1154133097 18:11752558-11752580 ACCCAGGAGCAGCAGGCGGTGGG - Intronic
1155034027 18:22009013-22009035 ATCCACTAGAATCAGGAGGATGG - Intergenic
1155277419 18:24201860-24201882 ACAGAGCAGATGCAGGAGGTGGG - Intronic
1155415388 18:25593250-25593272 AACCTGAAGAAGCAGGAGGTGGG - Intergenic
1156150241 18:34233486-34233508 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
1156897523 18:42263134-42263156 ACCAAACAGAAGCAATAGGAGGG - Intergenic
1156961092 18:43031944-43031966 ATGTAGCAGAAGCAGGTGGAAGG + Intronic
1157161121 18:45315378-45315400 ACCCAGCAGAAGGAGGGTGGGGG + Intronic
1157513610 18:48295813-48295835 GCCCAGCAGCAGCAGGAGGGGGG + Intronic
1157565537 18:48676771-48676793 GCCAAGCAGAAGAACGAGGAAGG - Intronic
1157740963 18:50092431-50092453 ACGCAGCAGCAGCAGCAGGATGG - Intronic
1158090644 18:53709002-53709024 ATCCAGGAGAGGCAGGGGGATGG - Intergenic
1159704170 18:71666066-71666088 TGCCAGCAGAAGGATGAGGAGGG + Intergenic
1159960895 18:74555232-74555254 ACCCTCCTGCAGCAGGAGGAAGG - Intronic
1159977083 18:74727390-74727412 AACCAGCAGAACCTGGATGAGGG - Intronic
1160097624 18:75889857-75889879 TCCCAGAAGAGGCAGGAGCATGG + Intergenic
1160476141 18:79190036-79190058 TCCCCGCAGCAGCAGCAGGAGGG + Intronic
1160623954 18:80190297-80190319 ACCCACCAGAGGCCAGAGGAGGG + Intronic
1160715740 19:575821-575843 ACCCATGAGCAGCAGGAGGAGGG - Intronic
1161053233 19:2176425-2176447 GCCCCGCAGAAGCAGTAGCAGGG - Intronic
1162548015 19:11342733-11342755 CCCCATGAGAAGCAGGGGGAGGG - Intronic
1163167509 19:15508247-15508269 GCCCAGCAGTGGCAGGAGGGCGG + Intergenic
1163373335 19:16914700-16914722 ATCCAGCAGCAGCAGGCCGATGG - Exonic
1164158049 19:22608271-22608293 CCCCAGAAGAAGGAGGAAGATGG - Intergenic
1164675876 19:30101117-30101139 ACACAGCAGAAGCAGAAGCTTGG - Intergenic
1165144971 19:33724949-33724971 ACCCAGCAGATGCTGGGGGTTGG + Intronic
1165250020 19:34523551-34523573 GCCCAGAAGAAGCAGGAGAGAGG - Intergenic
1165893284 19:39127335-39127357 TCCCAGCAGAAGGAACAGGAAGG - Intronic
1166374052 19:42317047-42317069 AGCCAGCAGGAGCAGGATGTGGG - Intronic
1167098536 19:47389667-47389689 ACACAGCAGAAGATGGAGGGAGG - Intergenic
1167149938 19:47702562-47702584 ACCCAGCTGAAGCAGGCGGCAGG - Exonic
1167250904 19:48398008-48398030 ACACAGCAGAGGGAGGTGGAAGG - Intronic
1167470256 19:49671825-49671847 GCCCACCAGAAGGAGCAGGACGG - Intronic
1167596442 19:50430803-50430825 TCCCAGGAGGAGGAGGAGGAAGG + Exonic
1167680648 19:50918118-50918140 ACTCTACAGAAGAAGGAGGATGG + Intergenic
1168162560 19:54521283-54521305 CCCCAGGAGAAGCAGCAGGCAGG + Intergenic
1168724785 19:58575220-58575242 ACCCAGGAAAGGAAGGAGGAAGG + Intergenic
924973760 2:154851-154873 ACTCAGCAGAAGAAATAGGATGG - Intergenic
924994371 2:343512-343534 AGGCAGCAGAAGCAAGAGGCAGG + Intergenic
925141713 2:1555075-1555097 TCCAGGCAGAAGCAGGAGGTCGG + Intergenic
925350322 2:3196813-3196835 ACCGAGCAGAACCGGGATGATGG - Intronic
925930930 2:8707276-8707298 TCCAGGCTGAAGCAGGAGGATGG - Intergenic
925965019 2:9056678-9056700 AACAGGCAGAAGTAGGAGGATGG + Intergenic
926367415 2:12145900-12145922 ACCCAGAACCAGCAGGAGAAAGG + Intergenic
926442016 2:12899499-12899521 CCCTATCTGAAGCAGGAGGATGG - Intergenic
926522841 2:13938157-13938179 ATCCACCAGCAGCTGGAGGAAGG - Intergenic
927200069 2:20572710-20572732 ACCCTGAAGAGACAGGAGGAAGG - Intronic
927262615 2:21108029-21108051 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
927804144 2:26130546-26130568 AGAAAGCTGAAGCAGGAGGATGG - Intronic
928311837 2:30217716-30217738 GCCCAGCAGGAGGTGGAGGAGGG + Intergenic
928317018 2:30254623-30254645 GCCCAGCAAAAGGAGGAGGGGGG - Intronic
928415963 2:31091952-31091974 ACCAGGCAGAAGAAGGTGGAAGG + Intronic
928680869 2:33700866-33700888 AACCAGCAGAAGCAGGACCGTGG - Intergenic
928705016 2:33940334-33940356 AGACAGCAGAAGCAGGGGGTGGG - Intergenic
929000694 2:37344766-37344788 CACCAGCAGCAGCAGGTGGAGGG - Exonic
929590563 2:43143064-43143086 AGGCAGCAGCAGCAGCAGGAGGG - Intergenic
929961545 2:46500224-46500246 ACCCAGCGGCGGCGGGAGGAGGG - Intronic
931464554 2:62475121-62475143 CTCCAGGAGAAGCAGCAGGAAGG + Intergenic
931485381 2:62685404-62685426 AACCAACAGAAGCTGGGGGAGGG - Intronic
932283284 2:70512923-70512945 AATCAGGAGGAGCAGGAGGAAGG + Intronic
932480610 2:72036875-72036897 AGCCAGCAGGGGCTGGAGGAAGG + Intergenic
932780801 2:74557188-74557210 AACCAGCAGAAGCCAGAGGGTGG + Exonic
933837420 2:86257007-86257029 ACCCACCAGAGGCAGAAGGCAGG - Intronic
933855226 2:86406871-86406893 ACCCCAAAAAAGCAGGAGGAAGG + Intergenic
933872378 2:86580018-86580040 ACCCAAAACAAGCAGAAGGAAGG + Intronic
934711976 2:96522360-96522382 ACCCAGCAGAAGCTGGAGGGTGG - Intergenic
934759583 2:96846441-96846463 ACAGAGCAGAAGCAGGAGGGTGG - Intronic
934926553 2:98385842-98385864 AAACGGCAGGAGCAGGAGGAAGG + Intronic
934931024 2:98423510-98423532 ACCCAAAACAAGCAGAAGGAAGG + Intergenic
935942740 2:108258321-108258343 ACTCAGCAGCAGCAGAAAGAGGG - Intronic
936133721 2:109870837-109870859 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
936210976 2:110500648-110500670 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
936269349 2:111036870-111036892 GACCAGCAGAAGTAGGAGCATGG + Intronic
936420106 2:112355234-112355256 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
937236054 2:120432512-120432534 ACACAGCAGAGGCCTGAGGAGGG - Intergenic
937937722 2:127259499-127259521 ACCCAGGAGAAGGCAGAGGAGGG - Intronic
938031696 2:128000021-128000043 CCCCAGTAGAAGGAAGAGGAGGG + Intronic
938163626 2:129008193-129008215 AGTCAGCAGGAGCAGGAGCATGG - Intergenic
938407290 2:131039674-131039696 AGCGGGCAGAAGCAGGGGGATGG - Intronic
938803816 2:134787859-134787881 AGCCAGCAGAACTAGGGGGAAGG - Intergenic
939636402 2:144587942-144587964 ACTCAGGAGAAGAAGAAGGAAGG + Intergenic
940436898 2:153666373-153666395 ACACACCAGGAGCAGCAGGACGG - Intergenic
940671797 2:156679006-156679028 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
940748564 2:157597612-157597634 TGGCAGCAGAAGCAGGAGGCAGG + Intronic
942496891 2:176549356-176549378 AACCAGCAGAAGCTGGTGGGAGG - Intergenic
943032946 2:182707268-182707290 ACCCAACATAAGCAGGAAAAAGG + Intergenic
943806218 2:192130281-192130303 ACAGAGGAGAAGGAGGAGGAAGG - Intronic
943945535 2:194057518-194057540 ACCCAACACAATCAGAAGGAAGG + Intergenic
944043687 2:195384383-195384405 ACACAGCGAAAGCAGGAGCAAGG + Intergenic
944158714 2:196636802-196636824 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
944677847 2:202049105-202049127 ACTCAGCTGAGGCTGGAGGATGG + Intergenic
944847571 2:203684118-203684140 ACCCAGCAGAGGCATCAGCAAGG + Intergenic
946185828 2:217979871-217979893 ATCCAGGAGAAGGAGGTGGATGG - Intronic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
946509953 2:220345162-220345184 ACCCTGGAGAAGAAGGAGCAAGG + Intergenic
947830819 2:233140286-233140308 TCCCAGGAGGAGCAGGATGAAGG + Intronic
948051445 2:234982327-234982349 GCCCAGCACCAGCAGGCGGAGGG - Intronic
948185296 2:236016598-236016620 ACCCAGTAGAACCAGGAGTGAGG + Intronic
948223405 2:236290848-236290870 GCCCGGCAGAAGCAGGGGAAGGG + Intergenic
948281035 2:236748208-236748230 TCCGAGCAGAAACAGGAGAAAGG - Intergenic
948740133 2:240041096-240041118 ACCCAGGAGACCCAGGAGGGAGG + Intergenic
948939946 2:241190631-241190653 GCCCAGGAGAACCAGGAAGAGGG - Intronic
948949086 2:241237203-241237225 ACCCAGGAGAGGCAGTGGGAAGG + Intronic
1169402838 20:5297850-5297872 CCCCAGGAAAAGCAGGTGGAGGG - Intergenic
1169961786 20:11168248-11168270 AACCAATAGAAGCAGGGGGATGG + Intergenic
1170001889 20:11623961-11623983 ACCCTACAGAGGGAGGAGGAGGG + Intergenic
1170485622 20:16813039-16813061 ACCCAGCTGCAGAAGGAGGTAGG - Intergenic
1170814084 20:19698086-19698108 ACACAGCAGGAGCAAGAGGGTGG + Intronic
1170938818 20:20831874-20831896 ACCAAGAAGAGGCAGGAGAAGGG + Intergenic
1171075797 20:22121646-22121668 AGCCAGCAAAAGCAAAAGGAAGG - Intergenic
1172167037 20:32905874-32905896 CAACAGCAGAAGCAGCAGGAGGG - Intronic
1173381999 20:42553833-42553855 ACCAAGCAGCAGTAGCAGGATGG + Intronic
1173866337 20:46314785-46314807 ACCCATGAGGGGCAGGAGGAGGG - Intergenic
1174343567 20:49913570-49913592 GTCCAGCAGATGCAGCAGGATGG - Exonic
1174415488 20:50363594-50363616 ACCAAGCAGGGGCAGGTGGAGGG + Intergenic
1174606824 20:51767711-51767733 AACCAGCAGTCGCAGGAGGGTGG - Intronic
1175461521 20:59155249-59155271 ACCTCTCAGAAGTAGGAGGAAGG + Intergenic
1175489367 20:59369041-59369063 ATCAAGCACAAGCAGGAGCAGGG - Intergenic
1176131926 20:63499828-63499850 TCCCAGCAGCAGCCGGAGGTCGG - Intergenic
1176371213 21:6062225-6062247 AGCCACCAGGAGCAGGAGGAAGG - Intergenic
1176516689 21:7789548-7789570 ACCCAGCAGGAGCCCCAGGAGGG + Intergenic
1178061434 21:28857054-28857076 AGCCAGCAGCAGCAGCAGGCTGG + Intergenic
1178308167 21:31508106-31508128 AGCCACCAGAAGCTGGAAGAGGG + Intronic
1178392685 21:32212310-32212332 AACCACGAGAAGTAGGAGGACGG - Intergenic
1178398134 21:32260583-32260605 GCCCGGGAGAAGCAGGAGGAAGG + Intergenic
1178650717 21:34419560-34419582 ACCCAGCAGGAGCCCCAGGAGGG + Exonic
1179158486 21:38872814-38872836 AACCAGCAGCAGTTGGAGGAGGG - Intergenic
1179169674 21:38963092-38963114 ACCCAGCAGAAGCTGGGAAAAGG + Intergenic
1179566322 21:42251330-42251352 CCCCAGCAGCACCAGGTGGAAGG + Intronic
1179752306 21:43476316-43476338 AGCCACCAGGAGCAGGAGGAAGG + Intergenic
1179930493 21:44568209-44568231 ATCCCCCAGGAGCAGGAGGAGGG - Intronic
1180000651 21:44993892-44993914 AACCAGCACAGGTAGGAGGACGG - Intergenic
1180013091 21:45064271-45064293 ACACAACAGAAGGAGGGGGAGGG - Intergenic
1180108984 21:45638922-45638944 ACCCAGCAGAGGTTGGAGGGAGG + Intergenic
1181522654 22:23458554-23458576 AGGCAGCAGAAACAGGGGGAGGG + Intergenic
1181582885 22:23837657-23837679 ACCCAGCAGGTCCACGAGGATGG + Exonic
1181663750 22:24374810-24374832 ACCCAAAATAAGCAGAAGGAAGG + Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181947645 22:26530645-26530667 AATCAGCAGGAGCAGGTGGAAGG + Intronic
1182051830 22:27318154-27318176 AGCGAGGAGAAGCAGGAGGCGGG + Intergenic
1182442406 22:30372083-30372105 GCCCAGCAGCTGCAGGAGGAAGG + Exonic
1182898937 22:33882145-33882167 TCCCAGCTGAGGCAGGAGAATGG - Intronic
1183101616 22:35587688-35587710 ACAGAGCAGAAGGAAGAGGATGG + Intergenic
1183277368 22:36907607-36907629 AGCCACCAGAAGCTGGAAGAAGG - Intergenic
1183816665 22:40307564-40307586 ACACAGCAGAATCTGGATGACGG - Intronic
1183834034 22:40437233-40437255 ACACAGTAGAAGCAGGTGCAGGG - Intronic
1183903196 22:41021696-41021718 AACCGGGAGAAGCAGGAGGCCGG - Intergenic
1184300036 22:43553272-43553294 ACTGAGCAGAACCAGGAGGAAGG + Intronic
1184463555 22:44655327-44655349 ACCCAATATAAGCAGAAGGATGG + Intergenic
1184699643 22:46162042-46162064 ACCCAGCCCTAGCAGGAGGCTGG - Intronic
1184849155 22:47109902-47109924 AACCAGGAGAACCAGGAGGCAGG - Intronic
1184993329 22:48185022-48185044 GGCCACCAGAAGCTGGAGGAGGG + Intergenic
1185074149 22:48674135-48674157 GCCCGGCCCAAGCAGGAGGAAGG - Intronic
1185088702 22:48754218-48754240 ACCCAGCAGCAGCAGGGAGCAGG + Intronic
1185181383 22:49365462-49365484 TCCCTGGAGGAGCAGGAGGATGG - Intergenic
1185314183 22:50171633-50171655 ACCCAGGCGAGGCAGGAAGATGG + Intronic
949934890 3:9108922-9108944 AAACAGCAGAAAGAGGAGGAAGG + Intronic
950023774 3:9806986-9807008 AGCCAGAACAGGCAGGAGGAGGG - Intronic
950096979 3:10336129-10336151 GCCCGGCTGCAGCAGGAGGAAGG + Intronic
950190404 3:10972567-10972589 ACCCAGCAGGAGTCGGAGGGAGG + Intergenic
950190878 3:10975265-10975287 ACCCAGGAGATGCAGGAGTGGGG - Intergenic
950239331 3:11353932-11353954 ACCCAGAAGAAGCAGGGTAAAGG - Intronic
950257460 3:11517577-11517599 ATCCAGAAGAAGCCAGAGGAGGG + Intronic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
951711122 3:25585654-25585676 ACTCAGCAGAAGCAGCGAGAGGG + Intronic
951752587 3:26054156-26054178 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
952170649 3:30803123-30803145 ACCCATCAGAACCAGGCTGAAGG - Intronic
953247956 3:41213371-41213393 ACACAGCAGAAGTGGAAGGAAGG - Intronic
953485321 3:43289150-43289172 AACCTGCAGAAGCACAAGGATGG + Intronic
953606788 3:44417698-44417720 ACCCAGCAGCTGGGGGAGGAAGG + Intergenic
953865257 3:46577803-46577825 TCGTAGCAGAAGCAGGAGCAAGG - Exonic
954114750 3:48460250-48460272 ACCCAGCAGAGGGAGGCAGAAGG + Exonic
954147973 3:48643641-48643663 GACCAGCAGAAGCAGCAGGAAGG + Exonic
955153094 3:56388361-56388383 ACATAGCAAGAGCAGGAGGAAGG - Intronic
955707772 3:61746321-61746343 CCCCAGCTGAGGCAGGAGAATGG - Intronic
956722336 3:72129140-72129162 ATCCAGGAAGAGCAGGAGGATGG + Intergenic
957320116 3:78619598-78619620 ACCTGGCAGAGGCAGGTGGAGGG + Intronic
957720790 3:83995712-83995734 ACATGGCAGTAGCAGGAGGAAGG + Intergenic
958957858 3:100480509-100480531 ACCCAGGAAAAGCAAGAGGTTGG - Intergenic
958972088 3:100622864-100622886 TCCCAGCTGAGGCAGGAGGATGG - Intronic
959598084 3:108149331-108149353 CCACAGCAAAAGCAGGAGCAAGG - Intergenic
960845557 3:122001399-122001421 AATCAGCAGCAGGAGGAGGAGGG + Exonic
961168437 3:124779459-124779481 ACCCAGGAGAAGGAGCAGGTGGG + Intronic
961453990 3:127015356-127015378 AACCATCTGAAACAGGAGGAGGG - Intronic
961531780 3:127544481-127544503 CCCCAGCTAAGGCAGGAGGAGGG + Intergenic
962058648 3:131901700-131901722 ATCCAGCAGAAGCTGGATCATGG - Intronic
962180405 3:133200234-133200256 ACCGAGCATAAGCAGAAGCAGGG - Intronic
962269402 3:133967048-133967070 GCCCACCTGTAGCAGGAGGATGG - Intronic
962644539 3:137423382-137423404 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
963006242 3:140728497-140728519 AGCCCACAGAGGCAGGAGGATGG + Intergenic
963141408 3:141948971-141948993 TCCCAGCTGAGGCAGGAGAATGG + Intergenic
963931136 3:151005464-151005486 ACCCAGCTGAGGCTGGAGGTTGG - Intergenic
964695015 3:159497633-159497655 AACAAGCAGAAGCAGAAAGAAGG + Intronic
965151398 3:164981293-164981315 AAACAGCAGTAGCAGTAGGATGG + Intronic
965951030 3:174308479-174308501 AGCAAGCAGAAGAAGGTGGAAGG - Intergenic
967090656 3:186132358-186132380 ACTCAGCAGATCCAGGTGGAAGG + Intronic
967522304 3:190447027-190447049 ATCCACCAGAAGCAGGTGAATGG + Intronic
967687641 3:192436366-192436388 ACACAGCAGAATCAAGTGGAGGG + Intronic
967809943 3:193749709-193749731 ACCCAGAACATGCAGAAGGAAGG - Intergenic
967828953 3:193902471-193902493 TCCCAGCAGGAGCAGGAGGGAGG - Intergenic
967865139 3:194183902-194183924 ACCAAGCAGGAGAAGGAGGTGGG + Intergenic
967867975 3:194205821-194205843 TCCCAGCAGGAGCGGGAGGGAGG + Intergenic
969108878 4:4828957-4828979 AGCCAGGAGAGGCTGGAGGAGGG - Intergenic
969211802 4:5693501-5693523 AGCCACCAGAAGCTGGAAGAGGG + Intronic
969258317 4:6017965-6017987 ACAGAGCAGAAGAAGGAGGGCGG + Intergenic
969320819 4:6411393-6411415 ACACAGCAGGAGCAGCAGGAAGG + Intronic
969374192 4:6752432-6752454 TCTCAGCTGAGGCAGGAGGATGG + Intergenic
969861503 4:10039517-10039539 ACCTAGCATAAGCAGGAGGGAGG - Intronic
970151960 4:13099281-13099303 ACACGGCTGAAGCAGGAGGAAGG + Intergenic
970188736 4:13489763-13489785 AGCCAGGAGAAGCAAGAGGAGGG + Intergenic
970195578 4:13547600-13547622 GCGGAGGAGAAGCAGGAGGAGGG - Intergenic
971009616 4:22418856-22418878 TCCCAACAGAAGAAGCAGGAGGG + Intronic
971444463 4:26728492-26728514 AAACAGCAGAGGCAGTAGGAAGG + Intronic
972860730 4:43166761-43166783 GCCCAGCAGAAGCAGAATTAGGG + Intergenic
973046495 4:45540467-45540489 ACATGGCAGAAGCAGGAGAAAGG - Intergenic
973699635 4:53523854-53523876 TGCCAGGGGAAGCAGGAGGATGG - Intronic
973837023 4:54819866-54819888 AGCCAGGAGAAGCAGGGAGAGGG - Intergenic
974207605 4:58726502-58726524 AAAAATCAGAAGCAGGAGGAAGG + Intergenic
975909989 4:79256090-79256112 ACCCAACTGAAGTAGGAGGCAGG - Intronic
975957347 4:79857205-79857227 ACCCTAGAGAACCAGGAGGAAGG - Intergenic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
976563559 4:86529020-86529042 ACCCAGAAGAAGGAAGAGGTTGG - Intronic
976789245 4:88859288-88859310 ACCCAGGAGAGGGAGGAGGAAGG + Intronic
978916712 4:114134279-114134301 ACCCCTCAAAAGCAGAAGGAAGG + Intergenic
979542032 4:121895152-121895174 ACACAGCAAAAGCAGGATTAAGG + Intronic
981615248 4:146638481-146638503 ACCCGGCAGAAGAAGCGGGAGGG + Intergenic
982321839 4:154084968-154084990 ATTCAGCAGGAGCAGGATGAAGG + Intergenic
982790465 4:159586067-159586089 GCCCAGCCAGAGCAGGAGGAAGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983820690 4:172190521-172190543 ACCCAGCAGAGAGAAGAGGAAGG + Intronic
984241582 4:177226145-177226167 AGGAAGCAGAGGCAGGAGGATGG + Intergenic
984942018 4:184941191-184941213 AGGAAGCTGAAGCAGGAGGATGG - Intergenic
985084163 4:186296012-186296034 AACAGGCTGAAGCAGGAGGATGG + Intergenic
985129700 4:186726904-186726926 ACGCAGCCGAAGGAGGAGGGCGG - Intergenic
985472484 5:54333-54355 ACCCAGGAGGAGGAAGAGGAAGG + Intergenic
985540703 5:486190-486212 ACCCTGCAGACGCAGCCGGAGGG - Intronic
986182372 5:5405211-5405233 TCCCAGCTGATGCAAGAGGAAGG - Intergenic
986280095 5:6315703-6315725 GCTCAGCAGGAGCAGGAGGAAGG - Intergenic
986299999 5:6470921-6470943 TCCCATCAGCAGCAGGAGGCTGG + Intronic
986341128 5:6790419-6790441 TCCCAGGGGAAGCAGGAGCATGG + Intergenic
986392254 5:7297816-7297838 GCACAGCTGAAGCATGAGGAAGG + Intergenic
986530393 5:8731016-8731038 ACCCAGCATAAGCCGAAGCAGGG + Intergenic
987429634 5:17816720-17816742 CCCCAGCGGAATGAGGAGGAAGG - Intergenic
987852034 5:23367928-23367950 ACCCAACAGAAGTAAGAGAAAGG + Intergenic
988095046 5:26596044-26596066 TGCCAGAAGAAGCAAGAGGAAGG - Intergenic
988163459 5:27551678-27551700 ACATAGCAGAGGCAGCAGGATGG + Intergenic
989233913 5:39122077-39122099 AAGAAGCAGAACCAGGAGGATGG + Intronic
990007257 5:50958110-50958132 ACTCAGCAGCAGCAGCGGGAAGG - Intergenic
990082249 5:51931178-51931200 AGCCAGCTGAGGCAGGAGAATGG + Intergenic
990737094 5:58876413-58876435 CCCCAACAGAAGTAGGAGGGAGG + Intergenic
990897677 5:60716226-60716248 GGCGAGCAGAAGCAGCAGGAGGG - Intergenic
991145778 5:63301953-63301975 ACCAAACAGAGGCAGGTGGAGGG - Intergenic
991210238 5:64096125-64096147 AGACAGTAGAAGAAGGAGGAGGG - Intergenic
992079630 5:73222906-73222928 ACCCACCACAAGCAGCAGAAGGG - Intergenic
994667211 5:102719983-102720005 ACATAGCAGAAGGAGCAGGAGGG + Intergenic
994934760 5:106240039-106240061 ACCCATCAGAAGAAGTAAGATGG + Intergenic
994992893 5:107019923-107019945 ACACAGCCAAAGCAGGAGGAAGG + Intergenic
995004897 5:107180682-107180704 ACACAGCAGGAGCAGAAGGAAGG + Intergenic
995158250 5:108942048-108942070 TCATAGCATAAGCAGGAGGAAGG - Intronic
995753793 5:115480301-115480323 TAGTAGCAGAAGCAGGAGGAAGG - Intergenic
997804598 5:136904851-136904873 GCTTAGCTGAAGCAGGAGGATGG - Intergenic
998023021 5:138787311-138787333 ACCCAGCTGAGGCAGGAGAATGG + Intronic
998038480 5:138936121-138936143 ACACAGCAGTAACAGCAGGATGG - Intergenic
999142139 5:149369481-149369503 TCCCAGCAGAAGAAAGAAGAAGG + Exonic
999388078 5:151169557-151169579 TCCCTGCAGGAGCAGAAGGAAGG + Intergenic
999696367 5:154191091-154191113 AGACAGCAGAAGGTGGAGGAAGG - Intronic
1000040509 5:157481364-157481386 ACACAGAAGAAGTACGAGGAGGG + Intronic
1000731360 5:164838011-164838033 AACCAGCAGAAAAATGAGGAAGG - Intergenic
1000857949 5:166422802-166422824 ACCTAGCAGATGGTGGAGGATGG + Intergenic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1001828261 5:174764232-174764254 ACCTAGGAGAAGGGGGAGGAAGG + Intergenic
1001993135 5:176133785-176133807 ACCGGGCAGAGGCAGGAGGACGG + Intergenic
1002382075 5:178838383-178838405 ATCAAGTAGAAGCTGGAGGATGG + Intergenic
1002648652 5:180674882-180674904 ATCAAGTAGAAGCTGGAGGATGG - Intergenic
1002701198 5:181126203-181126225 ACCCATCAGAAAAAGGAGGGTGG - Intergenic
1003082856 6:3036284-3036306 ACCCAACACGAGCAGAAGGAAGG + Intergenic
1003115856 6:3283625-3283647 TCCAGGCAGCAGCAGGAGGAAGG - Intronic
1003868884 6:10386047-10386069 AACCAGGAGGAGGAGGAGGAGGG + Intergenic
1003957309 6:11175609-11175631 TCCAAGCAGAAGTAGGAGTAAGG - Intergenic
1003990708 6:11483587-11483609 AGGGAGCAGAAACAGGAGGAGGG - Intergenic
1004505328 6:16242523-16242545 AACCAGCAGAAGCTGGGAGAAGG - Intronic
1005673109 6:28126882-28126904 ACCCAGCTGGAGCAGGAAGCTGG + Exonic
1005864227 6:29926480-29926502 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1005905532 6:30259647-30259669 CCCCAAGAGCAGCAGGAGGAGGG - Intergenic
1006410929 6:33872816-33872838 ACCTGGAAGAAGCAGGTGGAGGG + Intergenic
1006449149 6:34096020-34096042 TCCCAACAGCAGCAGCAGGAGGG + Intronic
1006748642 6:36362920-36362942 TCCAAGATGAAGCAGGAGGATGG - Intronic
1007037780 6:38693489-38693511 ACCCAAAGGAAGCAGAAGGAAGG - Intronic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1007787722 6:44290830-44290852 CCCCAGGAGAAGAAGGAGAAGGG - Intronic
1008962227 6:57277569-57277591 ACACAGCAGAAGCCGGGGGGTGG + Intergenic
1010572898 6:77499465-77499487 ACATGGCAGAAGGAGGAGGAAGG + Intergenic
1011299946 6:85863429-85863451 CCCCAACAGAATCAGGGGGATGG - Intergenic
1011492852 6:87910492-87910514 ACACAGAATCAGCAGGAGGATGG + Intergenic
1011854962 6:91678608-91678630 CCACACCAGAAACAGGAGGAAGG + Intergenic
1012535833 6:100295652-100295674 ACAGAACAGAAGCAGGAGTAGGG + Intergenic
1012606450 6:101163762-101163784 GCCAAGCAAAAGCAGGAGAAAGG + Intergenic
1012722164 6:102758723-102758745 CGCCAGCCGAAGCAGGGGGAGGG - Intergenic
1013523222 6:110951681-110951703 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
1014205446 6:118651317-118651339 CCGCCGAAGAAGCAGGAGGACGG - Intronic
1014452520 6:121597227-121597249 AACAAACAGAAGCATGAGGAAGG - Intergenic
1015511593 6:134043245-134043267 ACCCAGAAAAAGCAGGAAGTTGG + Intronic
1017200908 6:151754064-151754086 AACCTTCAGAAGCAGCAGGAAGG + Intronic
1017258122 6:152357499-152357521 AAACAGCAGAAGATGGAGGAAGG - Intronic
1017650833 6:156581024-156581046 ACCCAACATAAGCAGAAGAAAGG + Intergenic
1017898564 6:158701856-158701878 ACCCACTAGAAGCAGGAAGAGGG - Intronic
1018422327 6:163650242-163650264 AGCCAGCAGAGGAGGGAGGATGG - Intergenic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018899953 6:168045997-168046019 ACCCAGCAGATCCAAGAGCAGGG + Intergenic
1018952871 6:168390649-168390671 TGCTGGCAGAAGCAGGAGGAGGG - Intergenic
1019399002 7:840443-840465 ACCCGGCAGAGGGAGGACGACGG - Intronic
1019409808 7:901543-901565 GCCCAGCACCAGCTGGAGGATGG + Intronic
1019588672 7:1817990-1818012 AGGCAGCAGAAACAGGGGGAGGG - Intronic
1019729996 7:2624289-2624311 CCCCAGCTGTAACAGGAGGAGGG - Intergenic
1020309929 7:6859732-6859754 GCCCAGCAGAACCAGGAGTGAGG + Intergenic
1021184734 7:17550928-17550950 ACCCAAAACAAGCAGAAGGAAGG + Intergenic
1021270900 7:18584243-18584265 TCCCAGCTGAGGCAGGAGAATGG - Intronic
1022525307 7:31033387-31033409 GCCCAGCTGAGGCAAGAGGAAGG + Intergenic
1023873935 7:44276779-44276801 ACCCAGCTGAGGCAGGCCGAGGG - Intronic
1024299530 7:47876566-47876588 ACACAGCAGGAGGAGCAGGAGGG + Intronic
1024609014 7:51046815-51046837 ACCCAGGGGCAGCAGGAGGAGGG + Intronic
1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG + Intergenic
1025994705 7:66520584-66520606 ATCCAGCAGATGGTGGAGGACGG - Intergenic
1026107549 7:67433129-67433151 ACAGAGCAGAAACAGGAGCAGGG + Intergenic
1026479164 7:70763634-70763656 ACCCAGCAGCAGTGGGAGGCAGG + Intronic
1026678977 7:72451074-72451096 ACCAGGCAGAAGAAGGAGGAGGG + Intergenic
1026986320 7:74557230-74557252 ATCTAGCAGATGGAGGAGGATGG - Intronic
1027201352 7:76065673-76065695 AGCCAGGGGAAGCAGTAGGAGGG + Intronic
1027345520 7:77255603-77255625 ACCCAGCAGTGGTGGGAGGAGGG + Intronic
1028684612 7:93577239-93577261 ACACAGCAGAAGCAAGATCAGGG + Intergenic
1028958785 7:96725159-96725181 ACTCAGCTGAGGCAGGAGGATGG - Intergenic
1029474233 7:100773556-100773578 GCTCAGGAGAGGCAGGAGGAAGG + Intronic
1029532391 7:101134061-101134083 CTCCAGCAGAAACAGGGGGAGGG - Intronic
1031368608 7:120935825-120935847 ATGTAGCAGAAGCAGGAGGTAGG + Intergenic
1031480145 7:122268521-122268543 ACCAAGTAGAAGCAGGCAGATGG + Intergenic
1031869292 7:127074810-127074832 ATCCAGCTGTGGCAGGAGGAAGG - Intronic
1032375346 7:131410220-131410242 ATACAGCAGAATCAGGAGTAAGG + Intronic
1033823333 7:145160140-145160162 TCCCAGCAGAAGCAGCGGCATGG - Intergenic
1033921958 7:146404757-146404779 CTCCAGCAGAAGGACGAGGAGGG - Intronic
1034470678 7:151252757-151252779 AGCCAGGAGGAGGAGGAGGAAGG - Intronic
1034709796 7:153181164-153181186 ACCCAGGAGAAGAAGGAGGCAGG - Intergenic
1034903906 7:154927336-154927358 AACCAGTGGGAGCAGGAGGAGGG + Intergenic
1034997024 7:155584065-155584087 ATCCAGAAGAGGGAGGAGGATGG - Intergenic
1035317526 7:158006114-158006136 CCCCAGGAGAGGCAGGAGGAAGG - Intronic
1035321248 7:158030634-158030656 ACCCAGCAGAGGTGGGAGGGAGG + Intronic
1035680286 8:1482909-1482931 ACCCAGGAGAAGAGGGCGGATGG + Intergenic
1035742967 8:1943152-1943174 GCCTAGCACAGGCAGGAGGAGGG + Intronic
1035760308 8:2064136-2064158 ACGGAGCAGATGCAGGAGGAAGG - Intronic
1036686290 8:10913862-10913884 TCCCAGCAGCAGCACGAGGCAGG + Intronic
1036704229 8:11034735-11034757 CCCCATCAGAGGCAGGAGGGAGG - Intronic
1037256213 8:16957953-16957975 ATCCAGTCAAAGCAGGAGGAAGG - Intergenic
1037342743 8:17863876-17863898 ACCCAGAAGAAGCTATAGGATGG + Intergenic
1037478671 8:19283330-19283352 ACCCAAAAGTAGCAGGAGGAAGG - Intergenic
1038080175 8:24125920-24125942 CCTCAGCAGAGTCAGGAGGAGGG + Intergenic
1038662077 8:29506098-29506120 GCCCAGAAGAAGCAGGGAGAAGG - Intergenic
1038749310 8:30281315-30281337 ACTCCCCAGAAGCAGCAGGAGGG + Intergenic
1041441015 8:57896998-57897020 AAGCAGGAGAAGGAGGAGGATGG - Intergenic
1041628341 8:60056585-60056607 TCCCAGCAGCAGCTGTAGGAAGG - Intergenic
1042186823 8:66144441-66144463 TCCTAGCAGACCCAGGAGGAAGG + Intronic
1042501782 8:69516335-69516357 ACATTGCTGAAGCAGGAGGAAGG + Intronic
1042739534 8:72027779-72027801 ACTCAGGAGAAGTAGGAGAATGG + Intronic
1042851854 8:73224846-73224868 AACCACCAGAAGCTGGAAGAGGG - Intergenic
1044577123 8:93782021-93782043 TCCCAGCTGAAGCAGGAGAATGG - Intronic
1044932014 8:97260127-97260149 TCCCAGCAGGAGAAGGAGGAGGG + Intergenic
1045280764 8:100747719-100747741 ATCCTGGAGGAGCAGGAGGAGGG + Intergenic
1046776002 8:118164080-118164102 AACCAGGAGGAGCAGGAGGGAGG + Intergenic
1046817565 8:118601610-118601632 CCCCAAAAGAAGCAGGAAGAGGG - Intronic
1047077908 8:121424763-121424785 ACCCAAAAGAAACAGAAGGAAGG + Intergenic
1047209533 8:122830309-122830331 AAATAGCAGAAGCAGGAAGAAGG - Intronic
1047782583 8:128122337-128122359 TCACAGCAGTAGCAGGAGGCAGG - Intergenic
1047787959 8:128172536-128172558 TCCCAGGAGAAGCTGGAGGATGG + Intergenic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049124813 8:140777327-140777349 ACACAGCAAAAGCAAGAGCAAGG + Intronic
1049182796 8:141231546-141231568 ACCCAGCAACAGCAGGTGGGCGG + Intronic
1049536562 8:143185363-143185385 GCCCAGCAGACGCAGGAGGCGGG - Intergenic
1049579563 8:143405123-143405145 CCCCAGCAGGAGCAGCAGGCAGG - Intergenic
1049786806 8:144454805-144454827 AGGCAGCTGAAGCAGTAGGATGG - Intronic
1049920761 9:361990-362012 ACCCAGGAAAAGCAGCAGCAAGG + Intronic
1050114445 9:2249234-2249256 ACCAAGCAGAATCAGAAGGTGGG + Intergenic
1050303453 9:4282894-4282916 AATCAGCAGAAGCCAGAGGAAGG - Intronic
1050874314 9:10615055-10615077 ACCCACCAGAAGCAGTAGAAAGG - Intergenic
1051664287 9:19454031-19454053 ACCCAGCAGAAACTGGAGTTAGG + Intergenic
1052032922 9:23648886-23648908 AGCCACCAGAAGCTGGAAGAGGG + Intergenic
1052743249 9:32414656-32414678 ACCCTCCAGCACCAGGAGGATGG - Intronic
1052799280 9:32952664-32952686 ACACAGCTGGAGCAGGAGCAGGG + Intergenic
1053107577 9:35425004-35425026 AACCAGGAAAAGAAGGAGGAGGG - Intergenic
1053291658 9:36883344-36883366 ACCCAGGGAAAGAAGGAGGAAGG + Intronic
1053505389 9:38638715-38638737 ACTCAGCTGAGGCAGGAGAATGG - Intergenic
1055924813 9:81499125-81499147 ACACAGCAGAAGTTGGAGGCTGG + Intergenic
1056579543 9:87880830-87880852 CCCCTGCAGCAGCAGGAGCAAGG + Intergenic
1056708790 9:88973265-88973287 ACCTAGCAGAAGCAGGCGGGAGG - Intergenic
1057138909 9:92715081-92715103 ACCCAGCAGCAGCGGGACGGCGG - Exonic
1057146450 9:92762582-92762604 CCCTAGCAGAATCAGGAAGAGGG - Intronic
1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG + Intronic
1057325563 9:94060671-94060693 ACATGACAGAAGCAGGAGGAAGG + Intronic
1057481579 9:95449039-95449061 ACTCTGCAGAACCAGGGGGAGGG - Intronic
1058554510 9:106152667-106152689 ACCTATCAGAAGGTGGAGGATGG + Intergenic
1058743257 9:107965564-107965586 ACCCAGGAGAAGCAGGGACATGG + Intergenic
1059418848 9:114178694-114178716 GCCCTGCAGAAACAGGAAGAGGG - Intronic
1059463854 9:114452951-114452973 TCCCAGCAGAAGCATCAGGATGG - Intronic
1060046031 9:120341819-120341841 GCTCAGAAGAAGGAGGAGGAGGG + Intergenic
1060107479 9:120882297-120882319 GCACAGCAGAAGGAAGAGGATGG - Intronic
1060985520 9:127817003-127817025 GCCCAGAAGGGGCAGGAGGAGGG - Intronic
1061486256 9:130922002-130922024 CCCCAGCAGAGGCAGGACGCGGG - Intronic
1061550821 9:131333842-131333864 GCCCTGCAGAGGCAGGTGGAGGG - Intergenic
1061613781 9:131765922-131765944 GCCCAGCAGGAGCTGAAGGAGGG - Intergenic
1061920890 9:133781767-133781789 CCCCAGCAGAGGGATGAGGAGGG + Intronic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062710985 9:137975087-137975109 ACCCAGCCCAAGCAGAAAGAGGG - Intronic
1062720894 9:138043420-138043442 TCCCAGCAGAGGCAGTGGGAAGG + Intronic
1185463157 X:341527-341549 TCCCCGGAGAGGCAGGAGGAGGG - Intronic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186233657 X:7483879-7483901 ACACGGCTAAAGCAGGAGGAAGG - Intergenic
1186318757 X:8400877-8400899 AAACAGCAGAAGCAGGAAGCAGG + Intergenic
1186332242 X:8547032-8547054 AGACAGCAGTAGGAGGAGGAAGG - Intronic
1186389306 X:9142835-9142857 ACTCAGGAGAAGCAGGATGGAGG + Intronic
1186442556 X:9598782-9598804 AGCCACCAGAAGCTGGAAGATGG - Intronic
1186572257 X:10727614-10727636 AACCAGCAGTAGCAGCAGGAAGG + Intronic
1186965963 X:14786260-14786282 ACCCAGCAGATGGGGGAGGAGGG + Intergenic
1187200595 X:17130313-17130335 ACACAGGAGAAGCAGGAGTGAGG - Intronic
1187379996 X:18793053-18793075 ACCCAAAACAAGCAGAAGGAAGG - Intronic
1188861367 X:35260411-35260433 ACCCATCAGAAGCAACAAGAGGG + Intergenic
1189655430 X:43239913-43239935 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
1189824032 X:44898830-44898852 ACCCAGCAAAAGCAGGCTGTGGG - Intronic
1189860492 X:45266161-45266183 AGCCTGCAGAAGCTGGAAGATGG - Intergenic
1190107040 X:47568466-47568488 TCCCAACAAAAGCAGGAGGGAGG - Intronic
1190283088 X:48944213-48944235 ATCAAGCAGATGAAGGAGGATGG - Exonic
1191755304 X:64586278-64586300 TCCCAGCTGAGGCAGGAGAATGG - Intergenic
1192346428 X:70311847-70311869 TCCTAGCTGAGGCAGGAGGATGG + Intronic
1192436014 X:71144405-71144427 CCCCAGCAGAAGCAGCAGAAGGG + Intergenic
1193100211 X:77602453-77602475 ACCCAAAACAAGCAGAAGGAAGG - Intronic
1195245156 X:102988651-102988673 CCCCATCAGAAGCAAGAGCATGG - Intergenic
1195252251 X:103060521-103060543 AGCCAGCAAAAGTGGGAGGAAGG + Intergenic
1195975386 X:110520963-110520985 TCGTAGCAGAAGCAGGAGCAAGG - Intergenic
1196023189 X:111011667-111011689 ACACTGCAGAAGCAGAAGAACGG - Intronic
1196344754 X:114641176-114641198 AACAAGGAGAAGCAGGAGGATGG - Intronic
1197446680 X:126558848-126558870 ATCCAAGACAAGCAGGAGGAGGG + Intergenic
1197551115 X:127893910-127893932 AACCAGCAGAAGCAAGGGGTGGG - Intergenic
1197564074 X:128059773-128059795 ACCCCACAGAAGCAAGAGCATGG + Intergenic
1198082915 X:133255828-133255850 ACAGAGCAAAAGCAGGAGGAGGG - Intergenic
1199045568 X:143167316-143167338 ACACTGAAGAAGCAGAAGGAGGG + Intergenic
1199319417 X:146420680-146420702 AACCAGCAGAAGCACAAAGAAGG - Intergenic
1199378253 X:147137726-147137748 AACCACCAGAAGCTGGGGGAAGG + Intergenic
1199440721 X:147865042-147865064 AACCAGCATGATCAGGAGGATGG - Intergenic
1199515951 X:148675673-148675695 ATCCAGCAGATGCACAAGGAAGG - Intronic
1199754033 X:150847930-150847952 ACCTGGAAGGAGCAGGAGGATGG - Intronic
1200119103 X:153782029-153782051 GCCCAGCTGGAGCAGGAGAAGGG + Intronic
1200130322 X:153839477-153839499 ACCCTGAAGATGCACGAGGAGGG - Intergenic
1200494971 Y:3871608-3871630 AGTGAGCAGAAGCAGGAAGATGG + Intergenic
1200780652 Y:7212484-7212506 TTCCAGCCGAGGCAGGAGGATGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201477394 Y:14397377-14397399 ACACAGCAGGAGCAGGACCAAGG - Intergenic
1201519826 Y:14861254-14861276 ACCATGCAGAAGCAGAAGCAGGG + Intergenic
1201923582 Y:19260861-19260883 AACCAGCAGCAGCAGGACTATGG + Intergenic