ID: 1057171164

View in Genome Browser
Species Human (GRCh38)
Location 9:92964024-92964046
Sequence CAGCAGAAGCAGGAGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 978
Summary {0: 1, 1: 1, 2: 14, 3: 97, 4: 865}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057171152_1057171164 27 Left 1057171152 9:92963974-92963996 CCCCTCCTCCCTGAAGATCTACA 0: 1
1: 0
2: 2
3: 26
4: 254
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865
1057171157_1057171164 18 Left 1057171157 9:92963983-92964005 CCTGAAGATCTACACAGCAGATC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865
1057171153_1057171164 26 Left 1057171153 9:92963975-92963997 CCCTCCTCCCTGAAGATCTACAC 0: 1
1: 0
2: 0
3: 22
4: 175
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865
1057171154_1057171164 25 Left 1057171154 9:92963976-92963998 CCTCCTCCCTGAAGATCTACACA 0: 1
1: 0
2: 2
3: 15
4: 213
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865
1057171156_1057171164 19 Left 1057171156 9:92963982-92964004 CCCTGAAGATCTACACAGCAGAT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865
1057171155_1057171164 22 Left 1057171155 9:92963979-92964001 CCTCCCTGAAGATCTACACAGCA 0: 1
1: 1
2: 1
3: 9
4: 118
Right 1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG 0: 1
1: 1
2: 14
3: 97
4: 865

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057171164 Original CRISPR CAGCAGAAGCAGGAGGATGG TGG Intronic
900851047 1:5143344-5143366 TAAGAGAAGCAGGAGGAGGGAGG + Intergenic
900881120 1:5382040-5382062 CTCCAGAAGCAGGAAAATGGCGG + Intergenic
900950854 1:5857677-5857699 CAACAGGGGCAGGAGGAGGGAGG + Intergenic
900989363 1:6091000-6091022 CGCCTGTAGCAGGAGGATGGGGG - Intronic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901142131 1:7042137-7042159 CAGCAGAAGTCAGAGGCTGGAGG - Intronic
901176474 1:7303051-7303073 CAGCAGCACCAAGAGGAAGGCGG - Intronic
901182535 1:7351495-7351517 CAGCAGAAGCAGCAGGTCGGGGG + Intronic
901185287 1:7368952-7368974 AAGCAGAAGGAGGAAGGTGGAGG - Intronic
901185288 1:7368955-7368977 CAGAAGCAGAAGGAGGAAGGTGG - Intronic
901604728 1:10450234-10450256 CAGCAGCAGCAGGAGGCCGGGGG - Exonic
901756430 1:11444224-11444246 CTGCAGAGCCAGGAGGATGCTGG - Intergenic
901771950 1:11535080-11535102 CAGCAGGAGCAGGATGTGGGTGG - Exonic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
902407316 1:16191829-16191851 CCGCAGAAGGAGGAGGAAGCTGG - Intergenic
903098694 1:21007959-21007981 CAGGAGAAGCTGGAGGACAGAGG - Intronic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
903549919 1:24150688-24150710 CAGCAGTAGGAGGAGGAGGAGGG + Intergenic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903659558 1:24968783-24968805 CAGCAGAAGCAGGAACTTAGTGG + Intergenic
903705129 1:25280029-25280051 CAGGAGAAGTGGGAGGATGAGGG + Intronic
903842967 1:26257617-26257639 GACCAAAAGCAGCAGGATGGTGG - Exonic
903907403 1:26696488-26696510 CAGCAGCAGCGGGAGGAGGCGGG + Exonic
904087180 1:27917087-27917109 AAGCAGGAGGAGGAGGAGGGAGG - Intergenic
904239074 1:29132379-29132401 CAGCAGAAGAGTGAGGCTGGAGG + Intergenic
905064345 1:35167156-35167178 TGACAGAAGCTGGAGGATGGGGG + Intergenic
905109836 1:35587263-35587285 GAGGCTAAGCAGGAGGATGGAGG + Intronic
905289615 1:36912422-36912444 CAGCAGAGGGGGGAGGAGGGGGG - Intronic
905652428 1:39665496-39665518 GAGCATGAGCATGAGGATGGGGG - Intronic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906239242 1:44231669-44231691 GAGCAGAAGCAGGTGGCTGTTGG - Intronic
906254635 1:44338740-44338762 TGGCAGTAGCAGGAGAATGGAGG + Intronic
907052300 1:51337753-51337775 CAGAAGAACTGGGAGGATGGAGG - Intronic
907342069 1:53742296-53742318 TAGGAGAAGGATGAGGATGGAGG - Intergenic
907380215 1:54080968-54080990 CATCTGAATCAGGAGGATGTAGG + Intronic
907833419 1:58086738-58086760 CAGCAGAAGCAGAAGTACAGAGG - Intronic
908141566 1:61190302-61190324 CAGCAGCACCATGAGGTTGGCGG + Intronic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
909253658 1:73390568-73390590 TAGAAGAAGAAGGAGGAAGGAGG - Intergenic
909961319 1:81847173-81847195 CCGCAGAAGAAAGATGATGGAGG + Intronic
910228356 1:84960599-84960621 CAGCACAAGCTGGATGATGTGGG - Intronic
911117960 1:94265697-94265719 GAGCAGAAGCAGTAGAAAGGTGG - Intronic
911475657 1:98369026-98369048 CAGAAAAAGCAGGAAGATAGAGG - Intergenic
911509237 1:98791149-98791171 CAGCAGAAAGAGGAGGAGAGGGG + Intergenic
911702554 1:100971050-100971072 AAGCTGAAGCAGGAAGTTGGGGG - Intronic
911783194 1:101910042-101910064 AAGCAGGAGGAGGAGAATGGAGG - Intronic
912085216 1:105993450-105993472 AAGCAGAGGCTGGAGGCTGGAGG - Intergenic
912696722 1:111847747-111847769 CAGCTGGAGAGGGAGGATGGCGG + Intronic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
912844204 1:113064403-113064425 AGGCAGAAGCAGGAGGCAGGAGG + Intergenic
913110455 1:115652857-115652879 CGGCAGAAGCTGGAGAATGATGG + Intronic
913202512 1:116506689-116506711 CAGCAAGAGCAGGAGCATGTCGG - Intergenic
913447139 1:118961556-118961578 AAGCAGAAGCTTGATGATGGAGG + Intronic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915067776 1:153240810-153240832 GAGCAGAAACTGGTGGATGGGGG - Intergenic
915095437 1:153459241-153459263 GAGGAGATGCAGGTGGATGGCGG + Intronic
915409685 1:155690446-155690468 AGGCTGAAGCAGGAGGATTGAGG + Intronic
915440445 1:155942371-155942393 CAGCAGCAGCAGGTAGCTGGTGG - Exonic
915465947 1:156098001-156098023 TAGCAGAAGCTGGAGGATAGGGG - Intronic
915476212 1:156154295-156154317 CAACAGAAGAAGCAGGATAGGGG + Intronic
915520607 1:156440181-156440203 GAGCAGAGACAGCAGGATGGTGG - Intergenic
916468230 1:165093550-165093572 TAGCAGAGGCAGGATGAAGGGGG - Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
917442722 1:175081170-175081192 CAGAACAAGATGGAGGATGGTGG + Intronic
917450274 1:175142239-175142261 CAGAAAAAGCAGGAGGATTCTGG - Intronic
918000569 1:180490682-180490704 CGGCTGAGGCAGGAGAATGGCGG + Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918069512 1:181124595-181124617 AAGCAGAAGGAGGAGGAGGAGGG - Intergenic
918179499 1:182074127-182074149 AAGAAGAAGGAGGAGGAGGGTGG + Intergenic
918372069 1:183870513-183870535 TAGCAGAAGCAGGAAGACAGCGG - Intronic
918841073 1:189540392-189540414 AGGCTGAAGCAGGAGAATGGCGG - Intergenic
919134281 1:193488860-193488882 CATCAGTAGCAGGAGGCTGTAGG - Intergenic
919644038 1:200074633-200074655 AAGCTGAGGCAGGAGAATGGCGG + Intronic
919738168 1:200966486-200966508 CTGCAGAAGCAGGAGGTTGGGGG - Intergenic
920004695 1:202824397-202824419 CAGCAGTATGAGGAGGAAGGAGG + Intronic
920670756 1:208002285-208002307 CAGCAGATGCAGGGGTGTGGTGG - Intergenic
921060252 1:211578964-211578986 GAGCAGGAGCAGGAGGGCGGCGG + Intergenic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921801669 1:219409741-219409763 CAGCAGAAGGGAGAGGATTGTGG + Intergenic
921945405 1:220882763-220882785 CAGCAGGAGGAGGAGGAAGGAGG - Intronic
922076856 1:222253666-222253688 CAGCAGAAGCAGTTGGACGTTGG + Intergenic
922237652 1:223734004-223734026 CTGCAGACTCAGGAGGAGGGAGG + Intronic
922572543 1:226642599-226642621 CAGCAGAAGAAGGAAGACGGAGG + Intronic
922597802 1:226827295-226827317 CATCAGAAGTAGGAGGCTGAGGG + Intergenic
923180184 1:231510088-231510110 CAGCTGAGGCAGGAGAATGGCGG + Intergenic
923475303 1:234326089-234326111 AAGGAGCAGGAGGAGGATGGAGG + Intergenic
923724642 1:236495555-236495577 CAGCAGGTGGAGGAGGGTGGAGG - Intergenic
924162262 1:241245348-241245370 CGGCAGGAGCAAGAGGAGGGGGG - Intronic
924806444 1:247365456-247365478 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
1062936556 10:1394896-1394918 AAGAAGAAGGAGGAGGAGGGAGG - Intronic
1063034889 10:2276653-2276675 CTGGAGAAGCAGGAGTATGGTGG - Intergenic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063623059 10:7666875-7666897 CCCCAGCAGCAGGAGCATGGCGG + Exonic
1063819755 10:9820317-9820339 CAGCAGCAGCAGGAGCTTGGTGG - Intergenic
1063932139 10:11039404-11039426 CAGCATAAGAAGTAGGTTGGAGG - Intronic
1066454651 10:35562474-35562496 CACCAGGAGCTGGAGGAAGGAGG - Intronic
1067048262 10:42997940-42997962 CAGCAGAAGCTGGAGGATGTGGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067828569 10:49597022-49597044 CAGCAGGAGCAGGAGGGAGTGGG - Intergenic
1068264468 10:54628245-54628267 GAGAAGAAGCAGGAAGATGTAGG + Intronic
1068890555 10:62144388-62144410 CATCAGAAGGTGGAGGGTGGGGG + Intergenic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1069265594 10:66453489-66453511 CATCAGAAGTAGGAAGATGAGGG + Intronic
1069511834 10:69048330-69048352 CATCAGCAGCTGGAGGGTGGAGG - Intergenic
1069598963 10:69691005-69691027 CAGCAGAAGCAAGAGGGTAGAGG - Intronic
1070238672 10:74656139-74656161 GATCAGATGGAGGAGGATGGCGG + Intronic
1070530869 10:77336040-77336062 CAGCAGATGCAGGGGGAAGTTGG + Intronic
1070770387 10:79079090-79079112 CAGCAAAAGTGGGAGGCTGGAGG - Intronic
1070843649 10:79505200-79505222 CAGCGTGAGCAGGAGCATGGAGG - Intergenic
1070930017 10:80254400-80254422 CAGCGTGAGCAGGAGCATGGAGG + Intergenic
1071358023 10:84817959-84817981 CAGCAGCAGCAGCAGCATGAGGG + Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072687540 10:97547385-97547407 GGGCAGAAGAGGGAGGATGGTGG - Intronic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1073256014 10:102151861-102151883 CAGCAGAGGCAGGAGTCTGGAGG + Intergenic
1073266576 10:102231413-102231435 GAGCAGAGGCTGGAGGTTGGCGG + Intronic
1073473668 10:103739280-103739302 CAGCAGATCCAGGAGCCTGGTGG - Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073579887 10:104655782-104655804 CGGAAGAAGCAGGAGCAAGGCGG - Intronic
1074314342 10:112347895-112347917 AAACAGCAGCAGTAGGATGGGGG + Intergenic
1074388087 10:113033201-113033223 CAGCAGAAGGAGGAGGAGGAAGG - Intronic
1074639056 10:115358073-115358095 CAAGAGAAGCAGGATCATGGAGG - Intronic
1074960117 10:118437049-118437071 CAGAAGAAGCAGCAGTTTGGGGG - Intergenic
1075402887 10:122173571-122173593 CAGAAGAGGCAAGAGGCTGGAGG + Intronic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1076068095 10:127464703-127464725 TAGGAGCAGGAGGAGGATGGGGG + Intergenic
1076222472 10:128745633-128745655 CAGAAGATGCAAGAGGAGGGAGG + Intergenic
1076473212 10:130734625-130734647 TTGCAGAAGCAGGCGGACGGAGG + Intergenic
1076569056 10:131420420-131420442 CAGCAGGAGGAAGAGGAGGGCGG - Intergenic
1076605236 10:131685151-131685173 CAGCACAGGCAGGAGGTAGGGGG + Intergenic
1076623914 10:131810167-131810189 GAGGAAAAGCAGGATGATGGAGG + Intergenic
1076890123 10:133279241-133279263 CAGCAGCAGGAGGAGGGTCGTGG + Exonic
1076898023 10:133323917-133323939 AAGCTGAGGCAGGAGAATGGTGG + Intronic
1076931503 10:133534687-133534709 CAGCAGCTTCAGGAGGAGGGCGG - Intronic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1076997628 11:306457-306479 CAGCAGAAGGAGGAGGACTTAGG + Intergenic
1077089172 11:770681-770703 GAGAACATGCAGGAGGATGGGGG + Exonic
1077104756 11:837340-837362 CAGCTGCAGCAGGAGGTGGGTGG + Exonic
1077128334 11:955383-955405 CAGCAGGTACAGGAGGATGCTGG - Intronic
1077386774 11:2272983-2273005 CAGCAGACGCAGGTGGGTGCAGG - Intergenic
1077387096 11:2275194-2275216 GAGGAGCTGCAGGAGGATGGGGG - Intergenic
1077845187 11:6015473-6015495 TACCAGAATCTGGAGGATGGTGG - Intergenic
1077996525 11:7457152-7457174 AAGCAGAAGCAAGGGCATGGGGG - Intronic
1078353794 11:10618176-10618198 CAGCAGAAGCAAAAGCATGTAGG - Intronic
1078463861 11:11535791-11535813 GGGCAGATGCAGGAGGAAGGTGG - Intronic
1079107017 11:17578288-17578310 GGGCAGCAGCTGGAGGATGGAGG - Intronic
1079333176 11:19549974-19549996 CAGCAGAAGCCGGGGGAGGCTGG - Intronic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1080361210 11:31516007-31516029 AGGCAGAGGCAGGAGAATGGGGG + Intronic
1081563859 11:44244089-44244111 GAGCAGAATGAGAAGGATGGGGG - Intronic
1081567759 11:44270381-44270403 CAGGAGAAGAAGGAGGGAGGAGG - Intronic
1081620291 11:44615269-44615291 CAGCTGAAGCAGGAGATGGGCGG + Exonic
1081657429 11:44866716-44866738 CAGCAGAGGCAGCAGGCTTGAGG - Intronic
1081761961 11:45582879-45582901 CAGCAGAAATAGGAGGAAGGTGG - Intergenic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1082791347 11:57348435-57348457 CAGCAGGAGGAGGAGGCAGGTGG - Intronic
1083091652 11:60206093-60206115 AAGCAGAAGGAAAAGGATGGGGG + Intronic
1083336231 11:61923447-61923469 CACCACAGGCAGGCGGATGGTGG - Intergenic
1083859388 11:65411864-65411886 GAGCACCAGCAGGAGGAAGGTGG - Exonic
1084016017 11:66382123-66382145 CGGCTGAGGCAGGAGAATGGCGG + Intergenic
1084114152 11:67032014-67032036 CAACAGCGGCAGGAGGAAGGAGG + Intronic
1084185086 11:67467319-67467341 CAGCAGCAGGAGCAGGAAGGAGG + Exonic
1084405640 11:68971260-68971282 CAGCATGATCAGGAGGGTGGAGG + Intergenic
1084622308 11:70281359-70281381 CACCAGGAGCAGGAGGTTGGGGG - Intronic
1085372684 11:76024447-76024469 CAGCAAAAGGAGGAAGATAGAGG - Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1086487688 11:87326133-87326155 CTGCAGAGGCAGCAGGCTGGGGG - Intergenic
1086573022 11:88306631-88306653 CAGCCAGAGAAGGAGGATGGAGG - Intronic
1086851507 11:91814920-91814942 TAGAAGAAGCAGGAGGACGAAGG + Intergenic
1087092585 11:94288941-94288963 CTGCAGAAGCAGGAGGATAAGGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1089100702 11:115959754-115959776 CAGCACCAGCTGGAGGAGGGGGG - Intergenic
1089496058 11:118909239-118909261 AGGCAGAAGCAGGAGGAAAGGGG + Intronic
1090608536 11:128449821-128449843 CAGCAGAAGCAAGGGGAGAGTGG + Intergenic
1090650497 11:128801952-128801974 GAGCAGAGGAAGGAGGATGAGGG + Intronic
1090742919 11:129682347-129682369 CACCAGAAGCAGGAAGAGGCAGG - Intergenic
1090848156 11:130547277-130547299 CAGCAGGAACAGGAGGCTGAAGG - Intergenic
1091075538 11:132612517-132612539 CATCAGAACCAGGAAGATGTGGG + Intronic
1091131609 11:133151403-133151425 CTGGAGATGCAGGAAGATGGGGG + Intronic
1091636031 12:2197326-2197348 CACAAGATGCAGGGGGATGGGGG - Intronic
1091850399 12:3692644-3692666 CAGCAGTGGCAGCAGCATGGTGG + Intronic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092166463 12:6345770-6345792 CAAGAGAAGCAGGAGCCTGGGGG + Intergenic
1092342046 12:7685203-7685225 AGGCTGAGGCAGGAGGATGGAGG - Intergenic
1094056286 12:26272661-26272683 CACCAGAAGCAGCAGGATAATGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1094232414 12:28122327-28122349 AAGCAGAAGAATGAGGAGGGGGG + Intergenic
1094448949 12:30563501-30563523 CAGCAAAAGCAGTAGTAAGGAGG + Intergenic
1094474877 12:30833331-30833353 CAGCTGGAGGTGGAGGATGGAGG - Intergenic
1094628261 12:32146923-32146945 AAGAAGAAGGAGGAGGAAGGAGG - Intronic
1096070842 12:48774730-48774752 TAGCAGCAGCAGGAAGATGCTGG + Exonic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096216627 12:49801367-49801389 CAGGAGAAGCAGGAGGCTATTGG - Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1096549158 12:52360884-52360906 CAGCTGAAGCTGGAGGAACGAGG + Exonic
1096846537 12:54410231-54410253 GAGCAGGGGCAGGAGGATGGTGG + Intronic
1097189307 12:57211933-57211955 CAGCAGAGGGATTAGGATGGAGG - Exonic
1097818216 12:64098842-64098864 CAGCATAGGCAAGTGGATGGAGG - Intronic
1097961183 12:65533395-65533417 CAGCAGAGACAGGAGGAGGGAGG - Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1099316375 12:81087408-81087430 GAGCAGGAGGAGGAGGAAGGAGG + Intronic
1099413375 12:82358905-82358927 CAGCAGAACCAGGTGCGTGGCGG + Intronic
1099882519 12:88483909-88483931 CAGCAAAAGCAGTAGTAAGGGGG + Intergenic
1100106374 12:91178523-91178545 AAGCAGAAGGAGGATGATAGTGG + Exonic
1100330737 12:93579540-93579562 CAGCAGAAGCAAAGGAATGGAGG - Intronic
1100449927 12:94696066-94696088 GAGCAGCAGCAGGGGGAAGGAGG + Intergenic
1100535491 12:95505009-95505031 CAGATGAGGGAGGAGGATGGTGG - Intronic
1101021922 12:100561294-100561316 AAGCTGAGGCAGGAGAATGGCGG + Intronic
1101793371 12:107951178-107951200 AAGCAGGAGCAGGTGGGTGGAGG - Intergenic
1102346363 12:112163614-112163636 CAGCAGCTGCAGGGGGATGATGG + Exonic
1102413784 12:112742998-112743020 TGGCAGAAGCAAGAGGTTGGAGG - Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102916999 12:116761523-116761545 GAGGACATGCAGGAGGATGGTGG - Intronic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103793228 12:123486119-123486141 CAGCAGATGTACGAGGGTGGGGG - Intronic
1104013777 12:124949396-124949418 GAGCAGAAGCAGGAGGCAGAGGG + Intronic
1104334081 12:127876347-127876369 TACCAGAGGGAGGAGGATGGAGG - Intergenic
1104704614 12:130933899-130933921 CGGCAGAACCTGGAGGAAGGAGG - Intergenic
1104774162 12:131382438-131382460 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1104774298 12:131382887-131382909 CAGCAGCACCAGGAGGGAGGGGG - Intergenic
1104846840 12:131851201-131851223 CGGCAGCAGCAGCAGCATGGTGG - Exonic
1104918711 12:132279510-132279532 CAACAGAAGCCGGAGGGTGCAGG - Intronic
1104944583 12:132409930-132409952 CAGCAGAGGCAGGTGTGTGGCGG - Intergenic
1105458987 13:20566788-20566810 CAGTAGATGCAGGAGGGAGGAGG - Intergenic
1105614411 13:21999361-21999383 CAGGAGAGGCAGGAGAATGGTGG - Intergenic
1105831183 13:24164316-24164338 GAGCAGAGGCAGGAGCAAGGGGG - Intronic
1105966189 13:25386893-25386915 AGGCTGAAGCAGGAGAATGGCGG + Intronic
1106063330 13:26317784-26317806 CAGCAAAAGCAGTAGTAAGGGGG + Intronic
1106068247 13:26380045-26380067 CAGCAGGAGCAGTGGGATGCAGG + Intronic
1106856597 13:33860309-33860331 CAAGGGAAGGAGGAGGATGGAGG + Intronic
1107421785 13:40254240-40254262 TGGCAGAAGGAGGAGGAAGGAGG - Intergenic
1107579372 13:41765994-41766016 TCGCAGAAGCAGGAGTAGGGCGG + Intronic
1107588508 13:41879302-41879324 CAGCAGAAAGAGGAGGAGGGTGG - Intronic
1107890060 13:44906257-44906279 TAGCAGGAGGAGGAGGAGGGAGG + Intergenic
1108037802 13:46309891-46309913 AAGCTGAAGCAGGAGGACAGAGG - Intergenic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1108642256 13:52394101-52394123 CAGCAGCAGCAGGAAGACGCTGG - Intronic
1108692405 13:52871191-52871213 CAGCACTAGCAGGAGGACAGAGG - Intergenic
1109479342 13:62928545-62928567 AAGCAGAGGCAGGAGGCTGTAGG - Intergenic
1109705596 13:66087385-66087407 AAGTAGAAGCCGGAGGATGGAGG - Intergenic
1110328809 13:74248057-74248079 CATCAGAAGCAGGTTGATTGAGG - Intergenic
1111824047 13:93246087-93246109 CAGCTCAAGGAGGAGGTTGGGGG - Intronic
1112323743 13:98429665-98429687 CAGCTGAGGCAGGAGGAAGTGGG + Intronic
1112598073 13:100828048-100828070 CAACAAGAACAGGAGGATGGAGG - Intergenic
1112607534 13:100921712-100921734 CAGGAGGAGCAGGAGAATTGTGG - Intergenic
1112983051 13:105410376-105410398 AGGCTGAAGCAGGAGAATGGCGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113416366 13:110131588-110131610 CAGCAGCAGGAGGAGGACAGAGG - Intergenic
1113472535 13:110557166-110557188 TATCAGAAGCTGGAGGAGGGAGG + Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113900448 13:113793925-113793947 CAGCAGAAGGCGGGGGGTGGGGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1115642361 14:35342684-35342706 GAGGAGAAACAGGATGATGGTGG - Intergenic
1115818094 14:37184870-37184892 CAGCTGAGGCAGGAGAATTGCGG - Intergenic
1116021758 14:39469679-39469701 CAGCTGCTGCTGGAGGATGGGGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117384730 14:55200115-55200137 AAGCTGAAGCAGGAGGATCAAGG - Intergenic
1117426055 14:55598331-55598353 AGGCAGAGGCAGGAGAATGGCGG + Intronic
1117613433 14:57507552-57507574 TTGCAGAAGCAGGAAGATGATGG - Intergenic
1117737777 14:58785007-58785029 TAGGGGAAGCATGAGGATGGTGG - Intergenic
1119770195 14:77215820-77215842 TAGAAGAAGTAGGAGGAGGGGGG - Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120788834 14:88561219-88561241 CAGCAGAAGCAGGAGTTGTGGGG - Intergenic
1121233759 14:92377536-92377558 CAGCAGGAACAGGAGGCAGGAGG + Intronic
1121576651 14:94994378-94994400 CAGCAGGAGAAAGAGGAAGGAGG - Intergenic
1122016782 14:98803273-98803295 GAGGAGAAGGAGGAGGAAGGGGG - Intergenic
1122357384 14:101131889-101131911 AAGCAGAAGTAGGAGGAGGGAGG - Intergenic
1122572261 14:102713382-102713404 AGGCTGAAGCAGGAGAATGGCGG - Intronic
1122651332 14:103228745-103228767 CGGCTGAGGCAGGAGGATGCAGG + Intergenic
1122957409 14:105077161-105077183 CAGAAAATGCAGGAGGTTGGGGG + Intergenic
1202844535 14_GL000009v2_random:156042-156064 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202913926 14_GL000194v1_random:146283-146305 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1202878728 14_KI270722v1_random:36419-36441 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1123539257 15:21271709-21271731 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1123800313 15:23811953-23811975 ATGAAGAAGGAGGAGGATGGTGG + Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1124061319 15:26296198-26296220 CAGCAGAAGCAGAAGAATTTGGG - Intergenic
1124173314 15:27397657-27397679 CAGCAGAAGCGGGAGGCTGGAGG - Intronic
1124232456 15:27957006-27957028 CAGAAGAAGCAGGAGCCTGGTGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124585686 15:31004391-31004413 CCACAGAAGCAGCAGGGTGGGGG - Intronic
1125446169 15:39759731-39759753 CATCAGAAGCTGGAAGAGGGAGG - Intronic
1125863182 15:43017398-43017420 CAGCAGATTCAGTAGGCTGGGGG + Intronic
1127103249 15:55588247-55588269 CAGGGGAAGCAGGAGGCTCGCGG + Intronic
1127976706 15:64002871-64002893 CAGCAGAGGGAGGAGGAGAGAGG + Intronic
1128029611 15:64468302-64468324 AAGCAGAAGGAGGAGGAGAGAGG - Intronic
1128056411 15:64702981-64703003 GAGCAGATGAGGGAGGATGGGGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1129035421 15:72645971-72645993 GAGCAGAATTGGGAGGATGGGGG + Intergenic
1129214463 15:74091245-74091267 GAGCAGAATTGGGAGGATGGGGG - Intergenic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129458620 15:75688909-75688931 CTGCAGAAGCAGGGGGCAGGTGG - Exonic
1129919911 15:79311272-79311294 CAGCAGAAGCAGCACGGAGGCGG - Exonic
1130254483 15:82319580-82319602 CAGCTGGAGCGGGAGTATGGAGG - Intergenic
1130273230 15:82463169-82463191 CTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1130393394 15:83479539-83479561 CAGCAAAGGCAGGAAGCTGGGGG + Intronic
1130465582 15:84190540-84190562 CTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1130487110 15:84404280-84404302 CTGCAGAAGCAGGGGGCTGGTGG - Intergenic
1130498683 15:84482996-84483018 CTGCAGAAGCAGGGGGCTGGTGG - Intergenic
1130587871 15:85195135-85195157 CTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1130600482 15:85270390-85270412 CAGCTGGAGCGGGAGTATGGAGG + Intergenic
1130871212 15:87973739-87973761 CAGCAGAGACGGGAGGAAGGTGG - Intronic
1131320524 15:91385583-91385605 CAAAAGGAGCTGGAGGATGGGGG + Intergenic
1131569960 15:93524652-93524674 CATCAAGAGCAGGTGGATGGTGG - Intergenic
1132396992 15:101481472-101481494 AAGCAAAAGCATGAAGATGGGGG + Intronic
1132570716 16:642737-642759 AAGCAGAAGCAACCGGATGGGGG - Intronic
1132782399 16:1634771-1634793 CAACAGGAGCATGAGGCTGGAGG + Intronic
1132845684 16:1999876-1999898 CAGGAGGAGGAGGAGGACGGCGG - Exonic
1133042872 16:3069754-3069776 CAGCAGGAGAAGCAGGGTGGGGG + Intronic
1133091073 16:3404079-3404101 CAGCAGAAGTAGGTGGGGGGTGG + Intronic
1133228923 16:4357163-4357185 CAGCAAAAGAAGGAGGAGGTAGG - Exonic
1133247162 16:4456545-4456567 CAGCAGAGGCTGGGGAATGGGGG - Exonic
1133739400 16:8640219-8640241 CAGCAGAGCTGGGAGGATGGAGG + Intronic
1133929135 16:10217996-10218018 CAGTGGGAGCAGGAGGCTGGTGG + Intergenic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1135075097 16:19386424-19386446 CAGGAGAAGGAGGAGGAGAGAGG - Intergenic
1135125501 16:19806166-19806188 CTGCAGGAGCAGGAGGGTGCTGG + Intronic
1135223958 16:20639406-20639428 CTGCAGAGGCAGGAGGAAGCTGG - Intronic
1135620318 16:23950082-23950104 TGGCAGAAGCAGGAGGAAGTGGG - Intronic
1136019337 16:27430091-27430113 GAGCAGCAGCAGGAGCAAGGGGG - Exonic
1136066183 16:27760488-27760510 GAGCAGAGGCAAAAGGATGGCGG + Intronic
1137673936 16:50294569-50294591 CAGCAGCAGCAGGAGCACGCAGG - Intronic
1137836463 16:51597179-51597201 CAGCAGGAGCAAGAGAAAGGGGG - Intergenic
1137935281 16:52629168-52629190 TAGCTGAAGCAGGTGGATTGTGG - Intergenic
1138382048 16:56609256-56609278 CAGCAGGAGCAGCAGCCTGGGGG - Exonic
1138383335 16:56618582-56618604 CAGCAGGAGCAGCAGCCTGGGGG - Intergenic
1138572578 16:57885041-57885063 CAGCACAGGCTGGAGGCTGGAGG - Intronic
1138587735 16:57982066-57982088 CAACTGAAGCAGGAGGAAGGTGG - Intronic
1138596445 16:58031655-58031677 CAGCAGGAGAAGCAGGAAGGAGG - Intronic
1138604266 16:58077810-58077832 CACCAGAAGCTGGAAGATGCTGG + Intergenic
1138991054 16:62391933-62391955 CAGCAGAAACAAGAGTGTGGGGG + Intergenic
1139355645 16:66365786-66365808 CAGAAGAACCAAGAGGCTGGGGG - Intergenic
1139403856 16:66702963-66702985 AAGCTGAGGCAGGAGAATGGCGG + Intergenic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139519434 16:67472113-67472135 CAGCAGCAGCAGCAAGCTGGAGG + Intronic
1139664145 16:68444558-68444580 CAGCAGATTCAGGAAGATGTGGG - Intronic
1139946331 16:70644912-70644934 GAGGAGAAGGAGGAGGAAGGAGG + Intronic
1140948947 16:79797523-79797545 CACCAGAAGCTGGAGGAGGCCGG + Intergenic
1141278044 16:82605885-82605907 AAGCAGCAGTAGGAAGATGGAGG - Intergenic
1141392458 16:83676229-83676251 ATGCACAAGCAGGAGGATAGTGG - Intronic
1141516637 16:84549229-84549251 GAGGAGAGGCAGGAGGATGGAGG + Intronic
1141775723 16:86121615-86121637 AAGAAGAAGGAGGAGGAGGGAGG - Intergenic
1141775760 16:86121753-86121775 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1141775785 16:86121837-86121859 CGGGACAAGCAGGAGGAGGGAGG - Intergenic
1142221409 16:88856767-88856789 GAGCAGGAGCAGGATGTTGGGGG + Exonic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142402157 16:89865106-89865128 AAGCTGAGGCAGGAGAATGGTGG - Intronic
1142967610 17:3591031-3591053 CTCCAGGAGCAGGGGGATGGTGG + Exonic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143498833 17:7327301-7327323 GAGCAGGAGCTAGAGGATGGGGG - Intronic
1143662865 17:8337816-8337838 CACCAGAAAGAGGAGGATGTAGG - Intergenic
1144718056 17:17447954-17447976 CACCAGAAGCTGGAGGAGGTAGG + Intergenic
1144765782 17:17731697-17731719 CAGCAGCTCCAGGAGGAGGGAGG - Intronic
1145103878 17:20098737-20098759 CAGCAGGAGGAGGAGGATGGAGG - Intronic
1145207090 17:20990338-20990360 CACCAGAAGCTGGAGGAGGCAGG - Intergenic
1145751942 17:27361509-27361531 AAGGAGAGGCAGCAGGATGGAGG - Intergenic
1146062014 17:29612645-29612667 CAGCCGCGGCAGGAGGCTGGGGG - Exonic
1146178124 17:30679636-30679658 CAGAGGAGGGAGGAGGATGGAGG + Intergenic
1146218093 17:30995024-30995046 AGGCTGAAGCAGGAGGATTGAGG - Intronic
1146679953 17:34799916-34799938 GAGAACAAGCAGGAGGAAGGGGG - Intergenic
1146791436 17:35752902-35752924 CAGCAGCAGCGGGAGGAAAGAGG - Intronic
1147022929 17:37553112-37553134 CACCTGCAGCAGGAGGATGCTGG + Exonic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147053979 17:37819716-37819738 CAACAGAAGAAGGAGGAAGAGGG - Intergenic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147566989 17:41543074-41543096 AAGCTGAGGCAGGAGAATGGCGG + Intergenic
1147773906 17:42887007-42887029 CAGCAGAGGCAGCAGGAAGAGGG + Intergenic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148546953 17:48526424-48526446 AAGCAGAACCATGAGTATGGTGG - Intergenic
1148550384 17:48546772-48546794 GAGTAGAAGCATGAGGGTGGGGG + Intergenic
1148554363 17:48569437-48569459 AAGCAGAAGCAGGAGGAGAAGGG - Intronic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148783918 17:50135953-50135975 CAGCAGAAGTACGTGGCTGGGGG - Exonic
1149055991 17:52366497-52366519 AAGCAGAAGGAAGAGAATGGAGG + Intergenic
1149633701 17:58148885-58148907 CAGGAGAAGGGGGAAGATGGAGG - Intergenic
1149657730 17:58319125-58319147 GAGCAGCAGCAGGGGGGTGGTGG + Exonic
1149928639 17:60727236-60727258 CTGCAGATCCAAGAGGATGGTGG - Intronic
1149980654 17:61308612-61308634 CTGCAGAGGCAGGGGGGTGGGGG + Intronic
1150423613 17:65058955-65058977 AAGAAGAAGAAGGAGGAAGGAGG + Intergenic
1150580912 17:66473101-66473123 CAGGAGAAGAAGGAGGAATGGGG - Intronic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150812346 17:68366624-68366646 CAGCAGCAGCAGGTGGCTAGAGG - Intronic
1150932905 17:69604337-69604359 CACCAGAAGCTGGAAGATGCAGG - Intergenic
1151045015 17:70909619-70909641 CAGGTGAAGCAGGAGGATTTAGG + Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151743103 17:75997216-75997238 TGGCAGAACCAGGAGGGTGGAGG - Intronic
1151756768 17:76079724-76079746 CAGCCTAAGCAGCAGCATGGAGG - Exonic
1151874805 17:76861557-76861579 TGGCAGGAGCAGGAGGAAGGCGG + Intergenic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152315952 17:79580276-79580298 GAGGAGGAGGAGGAGGATGGGGG - Intergenic
1152339406 17:79716019-79716041 CAGCAGAAGCCGGGAGAGGGTGG + Intergenic
1152415976 17:80162206-80162228 CAGCGGAAGCAGGAGTGGGGCGG + Intergenic
1152433730 17:80262925-80262947 CAGCAGAAGAAGGTGGTGGGTGG + Intronic
1152580446 17:81163411-81163433 CAGGAAAAGCAGGGTGATGGGGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152778468 17:82216091-82216113 CAGGAGAAGCCGCATGATGGTGG - Intergenic
1152863798 17:82710493-82710515 CAGAAGGAGCAGGACGCTGGAGG + Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153812300 18:8762786-8762808 CAGGAAAAGCAGGAGGACTGAGG + Intronic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1154045510 18:10901118-10901140 CAGCAAATGCCGAAGGATGGTGG + Intronic
1154184947 18:12174982-12175004 CAGCAGTAGCAGCAGCATAGTGG + Intergenic
1154359271 18:13645462-13645484 CAGCAGTAACGGGAGGATGGAGG + Exonic
1155076714 18:22363764-22363786 CAGCACAAGCACGAGCCTGGAGG - Intergenic
1156156560 18:34309588-34309610 CAGCAATAGCAGCAAGATGGTGG - Intergenic
1156466975 18:37353856-37353878 AGGCTGAGGCAGGAGGATGGCGG - Intronic
1156469378 18:37367947-37367969 CAGCAGAGTCAGGGGGAGGGTGG + Intronic
1156520647 18:37719934-37719956 CAACAAAAGGAGGAGGATGAAGG + Intergenic
1156592662 18:38509227-38509249 CTGACCAAGCAGGAGGATGGGGG + Intergenic
1157001999 18:43537970-43537992 CAACAGAAGCAGGAGGTTGGAGG + Intergenic
1157186970 18:45549049-45549071 CAGCATAGGAAGGAGGATGGAGG - Intronic
1157768664 18:50325135-50325157 AAGGAGAAGGAGGAGGAAGGAGG - Intergenic
1158637066 18:59168783-59168805 CAGCTCAAACAGGAAGATGGCGG + Intergenic
1158859555 18:61579015-61579037 CAGCATAAGCAGGAGGCTGCTGG + Intergenic
1159009285 18:63042965-63042987 AACCTGGAGCAGGAGGATGGGGG + Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159198703 18:65153782-65153804 AAGGAGGAGGAGGAGGATGGGGG - Intergenic
1159740949 18:72169443-72169465 CAGGAGCAGGAGGAAGATGGAGG - Intergenic
1159996262 18:74968377-74968399 CAAGAGAAGCAGAAGTATGGGGG - Intronic
1160033163 18:75279561-75279583 GAGCTGGAGCAGGAGGACGGTGG + Intronic
1160146224 18:76367314-76367336 CAGCAGAAGCAGGTCTTTGGAGG - Intronic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160411564 18:78678541-78678563 CAGCAGAAGATGGAGGAGGCAGG - Intergenic
1160845623 19:1164806-1164828 GAGGAGGAGCAGGAGGAGGGAGG + Intronic
1160980603 19:1815011-1815033 CACTAGAAGCTGCAGGATGGTGG + Intergenic
1161319911 19:3636387-3636409 CAGCAGAAGCGGAAGTGTGGGGG - Intronic
1161370600 19:3908840-3908862 GAGGAGAAGGAGGAGGAAGGGGG - Intronic
1161732872 19:5972794-5972816 GAGCAGAAGCAGCAGGAATGGGG - Intronic
1161746102 19:6061128-6061150 CAGCAGGAGCGGAAGGAAGGGGG - Intronic
1162826443 19:13255287-13255309 CGGCAGAGGCAGGAGGAAGGTGG + Intronic
1162890736 19:13731491-13731513 AGGCAGAAGCAGGAGGATCTCGG - Intergenic
1163368771 19:16890356-16890378 CAGCAGCAGCAGCAGGTTGCTGG - Exonic
1163387247 19:17007405-17007427 AAGAAGAAGCAGGAGGAGAGGGG + Intronic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164632419 19:29770234-29770256 CAGCAGAAGCTGGAGGCTGGAGG - Intergenic
1164718639 19:30415046-30415068 AAGCAGAAGCAGGAAGAAGAAGG - Intronic
1165094492 19:33402866-33402888 CTGCTGAGGCAGGAGGATGGTGG + Intronic
1165245753 19:34497616-34497638 CAGGAGAACCAGGAGGCTGCCGG + Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165468764 19:35990802-35990824 TAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1165781642 19:38438077-38438099 CAGGAGATGGAGCAGGATGGTGG - Intronic
1166044186 19:40219844-40219866 AAGCCGAAGGAGGAGGATCGAGG - Intergenic
1166528367 19:43527094-43527116 CACCTGCCGCAGGAGGATGGGGG + Exonic
1166606271 19:44145963-44145985 CAGCAGAATGAGGAGGTTTGTGG + Intronic
1166758796 19:45212026-45212048 CAGGAGAGGAAGGAGGTTGGGGG - Intronic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167380400 19:49134896-49134918 CACCTGGAGTAGGAGGATGGTGG - Exonic
1167435362 19:49475692-49475714 CAGCAGCAGCAGGAGGAGATAGG - Exonic
1167470253 19:49671822-49671844 CACCAGAAGGAGCAGGACGGAGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167666272 19:50824083-50824105 AAGCAGAAACAGGAAGACGGAGG + Intergenic
1167690577 19:50982173-50982195 CAGCAGAAGCAGGAAGAGCGGGG + Intronic
1167722309 19:51187024-51187046 CATCAGAAGGAGGAGGATTACGG - Intergenic
1168048385 19:53810394-53810416 CAGCAGCAGCTGGAGGGTGGGGG - Exonic
1168107020 19:54171972-54171994 GAGGAGGAGGAGGAGGATGGAGG - Exonic
1168147254 19:54426681-54426703 CAGGAGCAGCAGGAGGACGTAGG - Exonic
1168213670 19:54909661-54909683 CACCAGAAGCAGGAAGGAGGAGG + Intronic
1168413971 19:56157263-56157285 CAGCTGAGGCATGAGGATGGGGG - Intronic
1202654351 1_KI270708v1_random:5453-5475 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
925125351 2:1451052-1451074 CAGCAGCGGCAGGAGGCTTGGGG - Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925286187 2:2717128-2717150 CAGGAGAAGAGGGAGGATGCCGG + Intergenic
925350320 2:3196810-3196832 GAGCAGAACCGGGATGATGGTGG - Intronic
925675909 2:6360749-6360771 CAGCAGAAGCAGATGCCTGGAGG + Intergenic
926394848 2:12430406-12430428 AAGGAGAAGAAGGAGGAAGGAGG + Intergenic
926623757 2:15071725-15071747 AAGCAGAAGCACGAGGATTCAGG + Intergenic
926756356 2:16239570-16239592 CAGCAGCAGCAGCAGAATGAAGG + Intergenic
926764812 2:16314916-16314938 CAGCTGGAGCAGGTGGACGGGGG + Intergenic
926766986 2:16330538-16330560 AAGCAGAAGGAGGTGGGTGGGGG - Intergenic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927173088 2:20386853-20386875 CACCATCAGCAGGAGGATGCTGG - Intergenic
927199887 2:20571645-20571667 CAGCAGGTCCAGGAGGCTGGAGG - Intronic
928436724 2:31259262-31259284 CAGCAGTCGCATGAAGATGGAGG - Intronic
928686232 2:33752742-33752764 CAGCAGAATCAAGAGGATAGAGG - Intergenic
928809918 2:35211287-35211309 AGGCTGAAGCAGGAGAATGGCGG - Intergenic
929071321 2:38033813-38033835 CAACAAGAGCAGGAGGTTGGGGG - Intronic
929504826 2:42520392-42520414 CAACTGAAGCAGGTGGATGGTGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929771273 2:44894206-44894228 CAGCAGACGCGGCAGGAGGGAGG - Intergenic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930096484 2:47570398-47570420 GAGCAGGAGCGTGAGGATGGTGG + Exonic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931709163 2:64972946-64972968 CATCTCAAGCAGGAGGAAGGAGG - Intergenic
932570048 2:72933826-72933848 CGGCAGAAGCTGGAGGAGGAAGG + Exonic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933773820 2:85759845-85759867 GCACAGAAGCAGGAGCATGGAGG + Intronic
933980888 2:87549846-87549868 CAGCCTCAGCAGGAGAATGGGGG + Intergenic
934926554 2:98385845-98385867 CGGCAGGAGCAGGAGGAAGGTGG + Intronic
934987874 2:98900401-98900423 GAGGGGAGGCAGGAGGATGGAGG + Intronic
935122398 2:100194224-100194246 GAGCTGAAGCAGAAGTATGGAGG + Intergenic
935403406 2:102683730-102683752 AAAGAGAAACAGGAGGATGGAGG - Intronic
935625318 2:105167877-105167899 CAGCAGAAGGGGGAGGTTAGGGG - Intergenic
935922161 2:108027877-108027899 AACCAGCAGCAGGAGGCTGGGGG - Intergenic
936269351 2:111036873-111036895 CAGCAGAAGTAGGAGCATGGAGG + Intronic
936312942 2:111400939-111400961 CAGCCTCAGCAGGAGAATGGGGG - Intergenic
936350230 2:111706909-111706931 CAGCACTTGCAGGTGGATGGAGG - Intergenic
936610706 2:113999496-113999518 CAGCACAGCCTGGAGGATGGAGG + Intergenic
937016757 2:118612602-118612624 CAGCAGAGGCAAGAGCATGTGGG - Intergenic
937866822 2:126758635-126758657 TAGCAGAGGCAGGAGTTTGGTGG - Intergenic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
940436897 2:153666370-153666392 CACCAGGAGCAGCAGGACGGTGG - Intergenic
941822780 2:169859171-169859193 AGGCTGAAGCAGGAGAATGGTGG - Intronic
941918543 2:170828045-170828067 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941918552 2:170828083-170828105 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
942323434 2:174755519-174755541 GAGCTGAGGCAGGAGAATGGTGG - Intronic
942496889 2:176549353-176549375 CAGCAGAAGCTGGTGGGAGGTGG - Intergenic
943463039 2:188193448-188193470 ATGCAGAAGCAGGAGGATAGAGG - Intergenic
943687063 2:190829758-190829780 GAGCAGGAGCAAGAGGGTGGGGG + Intergenic
943724738 2:191241647-191241669 AAGCTGAGGCAGGAGGATTGTGG + Intergenic
944118015 2:196209863-196209885 AGGCAGAGGCAGGAGAATGGCGG - Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945816500 2:214611178-214611200 CAGCATAACTATGAGGATGGGGG - Intergenic
946022752 2:216652667-216652689 GAGCAGGGGGAGGAGGATGGTGG + Intronic
946431980 2:219631014-219631036 CAGCAGTAGCAGCAGGATGGGGG + Intronic
946536748 2:220638375-220638397 GAGAAGAGGCAGGAGGATCGAGG + Intergenic
947722584 2:232378813-232378835 CAGCAGCAGCAGCAGCATGCAGG - Exonic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948247813 2:236501148-236501170 GAGCAGGAGCAAGAGGAAGGTGG + Intronic
948281033 2:236748205-236748227 GAGCAGAAACAGGAGAAAGGAGG - Intergenic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
1168879825 20:1196861-1196883 CATCAGCAGAAGGAGGATGTGGG + Intergenic
1168928620 20:1603402-1603424 CAGCAGATGCAGGAGTCTGCAGG + Intronic
1169235163 20:3924800-3924822 TGGTACAAGCAGGAGGATGGTGG - Intronic
1169548248 20:6673337-6673359 CAGAAGAAGAAGGAAGTTGGGGG - Intergenic
1170331710 20:15219365-15219387 CAGCAGGAGTAGGAGCAGGGTGG - Intronic
1170583062 20:17713148-17713170 AGGCTGAGGCAGGAGGATGGAGG + Intronic
1170621674 20:18001621-18001643 CAGCAGTAGCAGAAGGATTCCGG + Intronic
1170779058 20:19407251-19407273 CAGCAGCACTAAGAGGATGGCGG + Intronic
1170814087 20:19698089-19698111 CAGCAGGAGCAAGAGGGTGGGGG + Intronic
1170950199 20:20929926-20929948 CAGAAGAAGCAGGAAAATAGGGG - Intergenic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171180256 20:23086163-23086185 CAGCAGCAGCAGGCCCATGGAGG + Exonic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172136619 20:32690664-32690686 CAGCAGGAACAGGAGGCTGAAGG - Intergenic
1172525323 20:35597499-35597521 CAGGGGAAGGAGGATGATGGTGG - Intergenic
1173106974 20:40146100-40146122 CAGGAGGAGGAGGAGGAGGGAGG - Intergenic
1173382001 20:42553836-42553858 AAGCAGCAGTAGCAGGATGGAGG + Intronic
1173521436 20:43703133-43703155 CAGGAGGAGAAGGAGGATGCTGG + Intronic
1173613943 20:44390624-44390646 TAGCAGCAGGAGGAGGATGTCGG + Intronic
1173863668 20:46300380-46300402 AAGCAGAAGCAGGTGGATCCAGG - Intronic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1174553234 20:51376268-51376290 CAGCAGGAGCAAGAGAAGGGTGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174614517 20:51825477-51825499 AGGCTGAGGCAGGAGGATGGCGG + Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174960501 20:55151686-55151708 CAGCAGTAGGAGGAGGAAGAAGG - Intergenic
1175133570 20:56807071-56807093 CTGCAGAGGCAGGGGGATTGGGG + Intergenic
1176030894 20:63010856-63010878 CGGCTGAGGCAGGAGAATGGCGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176268590 20:64223633-64223655 CAGGAGAGGCTGGAGGGTGGGGG - Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176633281 21:9160958-9160980 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1178392683 21:32212307-32212329 CACGAGAAGTAGGAGGACGGAGG - Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1179044906 21:37835261-37835283 CAGCAGAACCCTGAGGTTGGAGG + Intronic
1179257589 21:39730133-39730155 TAGCAGAAGCAGGAAGAAGCAGG - Intergenic
1179566325 21:42251333-42251355 CAGCAGCACCAGGTGGAAGGAGG + Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1180389144 22:12208972-12208994 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1180416797 22:12725499-12725521 AAGAAGAAGCAGGAAGCTGGGGG + Intergenic
1181433519 22:22896960-22896982 CTGCAGGAGCAGGAGGATGTGGG + Intergenic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182460751 22:30481888-30481910 CAGCAGGAGCAGGAGGGCGGGGG + Intergenic
1182897940 22:33874044-33874066 GAGCAGAGGCAGGAGAATAGAGG - Intronic
1182910681 22:33981597-33981619 AAGCTGAGGCAGGAGAATGGTGG + Intergenic
1183163492 22:36130572-36130594 AAGCACATGCAGGAGGATGCTGG - Intergenic
1183628364 22:39018417-39018439 CAGCATGAGCAGGAGGCTAGAGG - Exonic
1183922602 22:41181430-41181452 GAGCTGAAGCAGGTGGATGCTGG - Intergenic
1184160359 22:42693919-42693941 CAGCCGCAGCAGGAGGTCGGGGG + Exonic
1184298090 22:43538798-43538820 CAGCAGCAGTAGGAGGCTGGAGG - Intronic
1184300037 22:43553275-43553297 GAGCAGAACCAGGAGGAAGGAGG + Intronic
1184379418 22:44135771-44135793 CACCAGAAGCTGGAGGAGGCAGG - Intronic
1184574959 22:45356273-45356295 CTGTAGAGGGAGGAGGATGGTGG - Intronic
1184653307 22:45929109-45929131 CTGCAGAGGCTCGAGGATGGTGG + Intronic
1184707787 22:46226769-46226791 AGGCCGAGGCAGGAGGATGGAGG + Intronic
1184730266 22:46367819-46367841 GAGCAGCAGCAGGAGGAATGCGG + Exonic
1184803191 22:46774842-46774864 CATGAGAAGGAAGAGGATGGCGG - Intronic
1185038723 22:48493201-48493223 CAGCACGAGCAGGTGGATGGTGG + Intronic
1185094868 22:48800701-48800723 CAGCAGACACAGGTGGCTGGAGG + Intronic
1185181380 22:49365459-49365481 CTGGAGGAGCAGGAGGATGGTGG - Intergenic
1185301235 22:50082148-50082170 CAGCTGAAGCAGGAGGGGCGTGG + Intronic
1185383471 22:50521103-50521125 CAGCAGGAGCAAGAGCATGATGG - Intronic
949311625 3:2705264-2705286 AAGCTGAGGCAGGAGAATGGCGG + Intronic
949339103 3:3009533-3009555 AAGCTGAGGCAGGAGAATGGCGG - Intronic
949349483 3:3110998-3111020 GAGCAGATGCAGAAAGATGGTGG + Intronic
949353052 3:3145399-3145421 AGGCTGAGGCAGGAGGATGGCGG + Intronic
949461304 3:4297643-4297665 AAGCTGAGGTAGGAGGATGGAGG - Intronic
949598639 3:5574856-5574878 CCCCAGCAGCTGGAGGATGGGGG + Intergenic
949635244 3:5975111-5975133 AAGCAGAAGGAAGAGGTTGGGGG - Intergenic
950059087 3:10054583-10054605 AGGCTGAAGCAGGAGAATGGCGG - Intronic
950192509 3:10987414-10987436 CAGGAGAAGAGGGAGGATGAGGG + Intergenic
950528224 3:13536976-13536998 CAGCACAAGCAGGAGCTGGGAGG + Intergenic
950808854 3:15632373-15632395 CAGCAGAACCAGGAAGGTGCTGG - Intronic
950981080 3:17305061-17305083 GAGCAGAAGCTGGATTATGGTGG - Intronic
952107584 3:30087733-30087755 GAGGAGAAGGAGGAGGAGGGAGG - Intergenic
952182341 3:30931006-30931028 CAGCTGAAGCAGGTGAATGCCGG + Intergenic
952254486 3:31683729-31683751 CAGTAGAAGCAGGAGATGGGTGG + Exonic
952257771 3:31710380-31710402 CAGCACAAGTAGGAAGATGCAGG - Intronic
952942490 3:38454762-38454784 CAGCAGCAGCAGCAGCATGCGGG + Intronic
953119220 3:40023577-40023599 CAGCAGAGGCAGGAGACTGTGGG - Intronic
953347048 3:42184976-42184998 CAGCAGGAGCTGCAGGAAGGTGG - Intronic
953485323 3:43289153-43289175 CTGCAGAAGCACAAGGATGGCGG + Intronic
953563446 3:44012387-44012409 GAGCAGCAGCAGTAGGCTGGGGG - Intergenic
954111670 3:48437009-48437031 CAGTAGAAGGAAGAGGATGAGGG - Intronic
954121845 3:48504232-48504254 GAGCAGGAGGAGGAGGAGGGAGG + Exonic
954152031 3:48662566-48662588 GAGAAGGAGCAGGAGTATGGGGG + Exonic
954441646 3:50525445-50525467 CAGCAGAGGCGGGGGGAGGGAGG + Intergenic
955153091 3:56388358-56388380 TAGCAAGAGCAGGAGGAAGGGGG - Intronic
956818576 3:72931329-72931351 AAGCTGAGGCAGGAGAATGGGGG - Intronic
956846548 3:73188870-73188892 CAGGAGAAGGAGGAGGAAAGAGG - Intergenic
956980141 3:74626971-74626993 CAACAGATGCAGGAGGTTGGAGG - Intergenic
957309813 3:78505688-78505710 AAGCTGAGGCAGGAGAATGGCGG - Intergenic
958957853 3:100480506-100480528 CAGGAAAAGCAAGAGGTTGGGGG - Intergenic
959598083 3:108149328-108149350 CAGCAAAAGCAGGAGCAAGGAGG - Intergenic
960224026 3:115148139-115148161 CAGCTGAGGCAGCGGGATGGAGG + Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
961060232 3:123822489-123822511 CTGCAGATGAAGAAGGATGGAGG - Intronic
961101450 3:124202598-124202620 CAGGAGGAGGAGGAGGAGGGAGG - Intronic
961452161 3:127007127-127007149 CAGGAGAAGCAGGGTGGTGGGGG + Intronic
962212740 3:133492310-133492332 CAGCAGCTGCAGCAGCATGGCGG - Intergenic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962856910 3:139355256-139355278 CCACATAAGCAGGAGGGTGGTGG - Intronic
963043137 3:141083603-141083625 CAGCACAAGCAGAAGCATGGAGG - Intronic
963123348 3:141794310-141794332 CACCAGCAGCTGGAGGGTGGGGG + Intronic
963600952 3:147378434-147378456 GAGGAGGAGGAGGAGGATGGGGG + Intergenic
963923688 3:150929328-150929350 GAGCAGAAGCAGGTGGCAGGAGG + Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964698355 3:159535466-159535488 GAGCAGAACCAGGAGGAAGCAGG - Intronic
965734545 3:171807068-171807090 AAGCCGAAGTAGGAGGATTGCGG + Intronic
967090657 3:186132361-186132383 CAGCAGATCCAGGTGGAAGGAGG + Intronic
967987684 3:195107510-195107532 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
968869946 4:3236687-3236709 GAGCAGCGGCAGGAGGATGAAGG + Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969211804 4:5693504-5693526 CACCAGAAGCTGGAAGAGGGAGG + Intronic
969308708 4:6339909-6339931 AAGCAGAAGAAGGACGATGGGGG + Intronic
969320820 4:6411396-6411418 CAGCAGGAGCAGCAGGAAGGAGG + Intronic
969448770 4:7260830-7260852 GAGCAGCAGCAGGAGGAAGAGGG - Intronic
969560771 4:7946397-7946419 AAGCAGGAGCAGAAGGATGAGGG + Intergenic
969996980 4:11323415-11323437 CAGAAGAAGTAGGAAGATGAAGG + Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
971009619 4:22418862-22418884 CAGAAGAAGCAGGAGGGCTGAGG + Intronic
971082591 4:23231519-23231541 CAGAAGAAACACGAGGTTGGTGG + Intergenic
971255357 4:25009100-25009122 GTGCAGAGGCAGGAGGATGCAGG - Intronic
972271998 4:37520717-37520739 AGGCTGAAGCAGGAGAATGGCGG - Intronic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
973982161 4:56315776-56315798 CACCAGCAGGAGGAGGCTGGGGG - Exonic
975112304 4:70641705-70641727 CAGAAAAATTAGGAGGATGGAGG + Intronic
976405711 4:84658869-84658891 CAGAAGAAGCAGGAGAATGTGGG - Intergenic
976563556 4:86529017-86529039 CAGAAGAAGGAAGAGGTTGGTGG - Intronic
976789248 4:88859291-88859313 CAGGAGAGGGAGGAGGAAGGAGG + Intronic
977314285 4:95425421-95425443 ACGCTGAAGCAGGAGAATGGCGG - Intronic
977842265 4:101722631-101722653 CAGCAGGTGCAGGAGTATGTTGG - Intronic
977963815 4:103118897-103118919 CAGAATAAGCAAGAGGATAGAGG - Intronic
978415833 4:108474915-108474937 GAGCAGAAGCAAGAGGAAGAGGG - Intergenic
978442009 4:108743399-108743421 CAGCAGAAGCATTAGTAGGGAGG - Intronic
978827997 4:113047775-113047797 CTGCTGAAACAGGAGGAGGGTGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979253670 4:118590415-118590437 AAGTAGGAGCAAGAGGATGGGGG - Intergenic
980191189 4:129527446-129527468 ATGCAGAGGAAGGAGGATGGAGG + Intergenic
980404986 4:132344514-132344536 AAGCTGAGGCAGGAGAATGGCGG + Intergenic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
982201102 4:152961359-152961381 CAGCAGAAATTGGAGTATGGAGG - Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
984057541 4:174948652-174948674 CAGCAGCTGCAGCAGCATGGTGG + Intronic
984581133 4:181511383-181511405 CAGCAGAAGCTGGAGTACTGGGG + Intergenic
985229330 4:187798519-187798541 CAGCTGCTGCTGGAGGATGGGGG - Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
985573987 5:665300-665322 CAAGAGGAGCAGGAGGAAGGGGG + Intronic
985814021 5:2112900-2112922 CAGCAGAAAAATGAGGTTGGTGG + Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
987092926 5:14523438-14523460 GAGCACCAGCAGGAGGAAGGAGG - Intronic
987353218 5:17039917-17039939 GAGGAGAAGGAGGAGGATGGGGG - Intergenic
988218419 5:28308069-28308091 GAGCAGACGAAGTAGGATGGAGG + Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988645791 5:33093514-33093536 GAGCTGAAGCAGGAGGAAGCTGG - Intergenic
988862896 5:35303326-35303348 CAGAAGAAGCAGGAGGGGTGGGG + Intergenic
989582416 5:43045277-43045299 TAGCAGAAGAAGTAGTATGGTGG - Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990529277 5:56657696-56657718 AGGCAGAAGCAGGAGCAAGGAGG + Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
991185098 5:63797080-63797102 GAGGAGGAGGAGGAGGATGGTGG + Intergenic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
992240147 5:74760449-74760471 CATCAGAAGCTGGAAGGTGGAGG - Intronic
992380220 5:76229163-76229185 CAGCAGAGTGGGGAGGATGGAGG - Intronic
992663666 5:78985165-78985187 CAGCAGCAGCGGGAGGACGACGG + Exonic
992769716 5:80035557-80035579 CAGGTGCAGCAGGAGGACGGCGG - Exonic
992770637 5:80044009-80044031 CAGCAGGAACAAAAGGATGGAGG - Intronic
993175812 5:84483643-84483665 CAGCAGAAGCAAGAAGATAAAGG + Intergenic
993466279 5:88250609-88250631 CAGGAGAAGGAAGAGGATGTTGG + Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994497794 5:100535577-100535599 CAGCAACAGCAGGAGGAGGACGG - Exonic
994665255 5:102697132-102697154 CAGCAAAAGCAAAAGCATGGAGG - Intergenic
994751164 5:103738439-103738461 AAGCTGAGGCAGGAGAATGGCGG + Intergenic
995165405 5:109034146-109034168 CAGCAGAAACAGGAGGTGTGAGG - Intronic
995272886 5:110242430-110242452 AAGCAGGAGCAGGAGGAGTGGGG + Intergenic
995608036 5:113879376-113879398 CAGAAGAAGCAGGAAAATGTGGG + Intergenic
995695384 5:114873309-114873331 CAGCTGAAGCAGAAGGAATGGGG - Intergenic
995757421 5:115523390-115523412 CAGCACAAGCAGGACAATGCTGG + Exonic
996085745 5:119303372-119303394 CAGCAGAGGGAGAAGGAAGGAGG - Intronic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996699590 5:126437007-126437029 AGGCAGAAGCAGTAGGATGGAGG + Intronic
997182166 5:131841342-131841364 CAGCAGTAGCAGCAGTGTGGTGG + Intronic
997392577 5:133529010-133529032 CAGCCGGAGCAAGAGCATGGAGG - Intronic
997468696 5:134104610-134104632 AAGCTGAAGCAGGAGGTAGGTGG - Intergenic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997668335 5:135649991-135650013 CAGGAGAAGCGGGTGGATGTAGG - Intergenic
998497807 5:142605870-142605892 CAGCAGCTGCAAGAGGATGTAGG - Intronic
998563285 5:143192334-143192356 CAGCACCAGCAGGAACATGGAGG + Intronic
998811020 5:145966009-145966031 GTGCAGAAGCGGGAGGAGGGAGG + Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999640468 5:153667300-153667322 CAGCACAGGCAGGATGATGAGGG + Intronic
999850241 5:155529700-155529722 CATCAGAAGGAGGAGGATGCTGG + Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1001171842 5:169426888-169426910 AAGAAGAAGCAAGAGGGTGGGGG + Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1001678893 5:173541601-173541623 CAGCAGAAGTAGGAAGACTGAGG + Intergenic
1001699076 5:173693813-173693835 CACCAGAAGCTGGAGGAGGAAGG + Intergenic
1001752947 5:174145416-174145438 AAGCAGAAGGAGCTGGATGGGGG + Intronic
1002078833 5:176725928-176725950 CACCAGGAGCAGGCGGCTGGGGG + Intergenic
1002401053 5:178991782-178991804 GGGCAGAAGCAGAAAGATGGGGG - Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1002477832 5:179478976-179478998 CAGCAGAATGGAGAGGATGGAGG - Intergenic
1002844887 6:937361-937383 AAGGAGGAGGAGGAGGATGGAGG - Intergenic
1003115852 6:3283622-3283644 AGGCAGCAGCAGGAGGAAGGGGG - Intronic
1003618914 6:7680175-7680197 CAACAGACGGAGGGGGATGGGGG + Intergenic
1003773302 6:9331919-9331941 GTGCAGAAACAGAAGGATGGAGG + Intergenic
1004092049 6:12513693-12513715 TGGAAGAAGCAGGAGGATAGAGG + Intergenic
1005495449 6:26383859-26383881 GAGCAGGAGGAGGAGGAGGGAGG - Exonic
1005762029 6:28976315-28976337 AGGCTGAAGCAGGAGAATGGTGG - Intergenic
1005816087 6:29553908-29553930 CAGCGGAGGCCGGAGGAGGGCGG + Intergenic
1006358758 6:33575847-33575869 CAGCAGGAACAGGAGGCTGAAGG - Exonic
1006384417 6:33721847-33721869 CAGAAGAACCTGGAGGACGGAGG - Exonic
1007239780 6:40416722-40416744 TAGCAGGAGAAGGAGGAAGGGGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007367717 6:41406638-41406660 CAGAAGCAGAAGGAGGTTGGGGG + Intergenic
1007696423 6:43736892-43736914 CAGCTGAAGCTGGAGGCTGTGGG + Intergenic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1010753101 6:79636467-79636489 CAGAAGAAGCAGGAGTAAGTTGG + Intronic
1010910337 6:81547341-81547363 CAACAGAAGCCAGAGGATGGGGG - Intronic
1012172446 6:96034905-96034927 AAGCAGAAGCATGAGAATAGTGG + Intronic
1013373467 6:109490907-109490929 GGGCAGCAGCTGGAGGATGGGGG + Intergenic
1013637655 6:112044472-112044494 AAGCAAAAGCAAGAGGCTGGGGG + Intergenic
1013848656 6:114486205-114486227 CAGCAGAAGCTGGTGGATAAGGG + Intergenic
1014060857 6:117070189-117070211 AGGCTGAAGCAGGAGAATGGCGG - Intergenic
1014207567 6:118672782-118672804 AAGAAGAAGGAGGAGGAAGGAGG + Intronic
1014640458 6:123903242-123903264 CAGCAGAAATTGGAGCATGGGGG + Intronic
1014994525 6:128125373-128125395 CAGGAGCAGGAGCAGGATGGGGG - Intronic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1015950678 6:138549490-138549512 CAGCAGAAGCTGGAAGAGGCAGG + Intronic
1016209430 6:141510388-141510410 AAGCTGAAGCAGGAGGGTTGAGG - Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016794726 6:148105756-148105778 GAGGAGAAGGAGGAAGATGGGGG + Intergenic
1017133437 6:151127883-151127905 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1017190831 6:151650993-151651015 GAGGAGAAGGAGGAGGTTGGAGG - Intergenic
1017750504 6:157486882-157486904 GAGGAGACGCAGGAGGATGCAGG + Intronic
1017848707 6:158283747-158283769 CTGCTGAAGCAGAAGGCTGGAGG - Intronic
1017898561 6:158701853-158701875 CACTAGAAGCAGGAAGAGGGAGG - Intronic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1018379345 6:163243567-163243589 CAGCAGGAGCCGCGGGATGGTGG + Intronic
1019524382 7:1474165-1474187 CACCAGCAGCAGGCGGATGAAGG + Exonic
1019898245 7:3999679-3999701 CAGGAGAAGCTGGAGGCTGGAGG + Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020309932 7:6859735-6859757 CAGCAGAACCAGGAGTGAGGCGG + Intergenic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020748671 7:12111798-12111820 GATCAGAAGCAGGAGGCAGGAGG - Intergenic
1021608770 7:22435874-22435896 TGGCAGAAGCAGGAGTAGGGTGG - Intronic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1022597039 7:31722655-31722677 CAGGTGAAGAAGCAGGATGGTGG + Intergenic
1022852044 7:34273800-34273822 AGGCTGAAGCAGGAGGATTGAGG - Intergenic
1022873494 7:34504001-34504023 GAGCAGGAGCAAGAGGAGGGAGG + Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023149128 7:37183193-37183215 CAGAAGGAGAAGGAGGAAGGAGG + Intronic
1023412171 7:39899040-39899062 GAGGAGAAGTAGGAGGAGGGTGG - Intergenic
1023641936 7:42268122-42268144 CAGAAGAAGCACTGGGATGGTGG - Intergenic
1023866300 7:44239992-44240014 CAGCAAAAGTAACAGGATGGCGG + Intronic
1024226637 7:47330584-47330606 CAGCAGAAACAAAAGGACGGAGG + Intronic
1024299531 7:47876569-47876591 CAGCAGGAGGAGCAGGAGGGAGG + Intronic
1024721003 7:52137363-52137385 AAGAAGAAGGAGGAGGAGGGGGG + Intergenic
1025284352 7:57650147-57650169 GAGCAGAAGAAGCAGGAGGGAGG + Intergenic
1026173993 7:67979726-67979748 CAGCAGCAGGAGAAGCATGGAGG - Intergenic
1026191906 7:68136493-68136515 GAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1026529522 7:71185046-71185068 AAGCAGAAGGAGGAGGAGGAGGG - Intronic
1026536654 7:71244123-71244145 CAGTAGCAGCAGGCGGATGCTGG - Intronic
1026899314 7:74028219-74028241 CAGCAGGAGCAGGAGGACTCCGG - Exonic
1027572762 7:79891461-79891483 GAGGAGAAGGAGGAGGAAGGGGG + Intergenic
1027788924 7:82614791-82614813 GAGTTGAAGCAGGAAGATGGAGG + Intergenic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1028888132 7:95957441-95957463 CAGCAGCAGGAGGAGGAGGAGGG - Intronic
1029015622 7:97312879-97312901 CAGCTGAGGCAGGAGAATGGCGG - Intergenic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029110946 7:98212772-98212794 CAGCAGCAGCAGGTGGCTGGGGG + Exonic
1029524894 7:101088429-101088451 CAGCAGCCCCAGAAGGATGGTGG + Exonic
1029688786 7:102166590-102166612 CAGCTGAGGCAGGAAGAAGGGGG - Intronic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1031798793 7:126214811-126214833 CAGCAGGAGCAAGAGGATGGAGG - Intergenic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031975287 7:128089783-128089805 CAGCAGGAACAGCAGGATGGTGG - Intronic
1032312759 7:130803575-130803597 CAGCAGGAGGAGGAGGATGCTGG + Intergenic
1032665502 7:134032408-134032430 CATTAGCAGCAGGAAGATGGTGG - Intronic
1032872956 7:136006011-136006033 AGGCTGAAGCAGGAGAATGGCGG + Intergenic
1033127285 7:138717225-138717247 CTGCATCTGCAGGAGGATGGAGG + Intronic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033771534 7:144557986-144558008 AAGCAGAAGCAAGAGAGTGGGGG - Intronic
1033962109 7:146928033-146928055 AGGTAGAAACAGGAGGATGGAGG - Intronic
1034100792 7:148448726-148448748 CAGCAGGAGCAAGAGGCTGAGGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034348659 7:150402766-150402788 CAGGAGGAGCTGGAGGATGCGGG + Intronic
1034449844 7:151131498-151131520 CAGCAGAACGGGGAGCATGGTGG - Intronic
1034875282 7:154719979-154720001 AAGCAGATGCAGGAGCATGGGGG - Intronic
1034978910 7:155463435-155463457 AAGGAGGAGCAGGAGGAAGGAGG - Exonic
1034997020 7:155584062-155584084 CAGAAGAGGGAGGAGGATGGGGG - Intergenic
1035014953 7:155757856-155757878 TGGCAAAAGCAGGAGCATGGTGG + Intronic
1035700929 8:1638895-1638917 CTGCTGAAGCAACAGGATGGAGG + Intronic
1036223354 8:6939245-6939267 CACTACAAGGAGGAGGATGGTGG - Intergenic
1036229884 8:6990682-6990704 TAGGAGAAGGAGGAGGACGGTGG - Intergenic
1036232335 8:7009785-7009807 TAGGAGAAGGAGGAGGACGGTGG - Intronic
1036332017 8:7836928-7836950 GTTCAGAAGGAGGAGGATGGGGG - Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1036686293 8:10913865-10913887 CAGCAGCAGCACGAGGCAGGAGG + Intronic
1036698495 8:10994885-10994907 CAGCAAAAACATGTGGATGGGGG + Intronic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037342746 8:17863879-17863901 CAGAAGAAGCTATAGGATGGTGG + Intergenic
1037791440 8:21946031-21946053 TAGCAGAAACAGGAAAATGGAGG + Intronic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1040039660 8:42903444-42903466 AGGCTGAAGCAGGAGAATGGTGG - Intronic
1040586714 8:48750278-48750300 CAGCAAAGCCATGAGGATGGAGG + Intergenic
1040589251 8:48774236-48774258 CAGCTGAAGCAGGAGGAAGCAGG - Intergenic
1042291436 8:67172902-67172924 GAGGAGAAGCAGGAGAATGTAGG + Intronic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043310080 8:78847938-78847960 CAGCAGAAGCAGGTGGGGGGGGG + Intergenic
1043551378 8:81376843-81376865 GAGAAGAAGGTGGAGGATGGAGG + Intergenic
1044108143 8:88237545-88237567 AGGCTGAAGCAGGAGAATGGCGG + Intronic
1044313882 8:90727060-90727082 CAGCGGCAGCAGCAGCATGGTGG - Intronic
1045147647 8:99365427-99365449 CAGCAAAAGCAGGACTAAGGGGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1046685943 8:117226977-117226999 CAGCAGAAGCCACAGGTTGGCGG - Intergenic
1047599023 8:126408043-126408065 CAGGAGAGGCAGTAGGATGAGGG - Intergenic
1047782582 8:128122334-128122356 CAGCAGTAGCAGGAGGCAGGTGG - Intergenic
1048223199 8:132562158-132562180 CAGCAGAGACTGGAGGCTGGAGG + Intergenic
1048317295 8:133371609-133371631 AAGCAGGAGGAGGAGGAAGGAGG + Intergenic
1048417598 8:134243795-134243817 GAGGAGAAGGAGGAGGAAGGAGG + Intergenic
1048876126 8:138838059-138838081 CAGCAGAAGCAGTGGCGTGGAGG + Intronic
1048993367 8:139774311-139774333 CAGGAGAAACCGGAGGATGGAGG + Intronic
1049287227 8:141782377-141782399 CGGCAGAAGCAGGAGGCCTGGGG + Intergenic
1049378243 8:142299189-142299211 CAGCAGAGGCAGGGAGGTGGGGG + Intronic
1049536559 8:143185360-143185382 CAGCAGACGCAGGAGGCGGGAGG - Intergenic
1050112536 9:2231699-2231721 GAACAGAAGGAGGAGGAAGGAGG + Intergenic
1050423381 9:5490082-5490104 CAGCAGAAGCTGGTGGGTTGTGG + Intergenic
1050499418 9:6279678-6279700 CAGCAGATGCAAGATTATGGGGG + Intergenic
1051297401 9:15611117-15611139 GATCAGGAGCAGGAGGAAGGAGG - Intronic
1052203523 9:25810716-25810738 AGGCTGAAGCAGGAGAATGGCGG - Intergenic
1052709963 9:32042151-32042173 GAGCAGCAGCTGGAGGATGGGGG - Intergenic
1052799281 9:32952667-32952689 CAGCTGGAGCAGGAGCAGGGTGG + Intergenic
1052968766 9:34363622-34363644 GAGCAGCAGCAGGGGGAAGGGGG - Intergenic
1054447666 9:65385470-65385492 CAGCGGCAGCAGGAGCATCGCGG + Intergenic
1054728422 9:68676289-68676311 GAGAGGAAGCAGGTGGATGGAGG - Intergenic
1054832870 9:69645665-69645687 CAGCAGTGGCAGGAGAAGGGTGG + Intronic
1056031850 9:82561307-82561329 AAGCTGAGGCAGGAGAATGGCGG + Intergenic
1056475057 9:86945757-86945779 AAGCAGCAGCAGCAAGATGGAGG + Exonic
1056547266 9:87623165-87623187 CAGCAGGCCCAGGAGGATGTGGG - Intronic
1056791645 9:89629253-89629275 CAGCAAAGGCAAGAGAATGGCGG + Intergenic
1056845878 9:90037688-90037710 CAGCAGCAGCAGGAAGAATGAGG - Intergenic
1057008836 9:91583905-91583927 CTGCAGACCCATGAGGATGGAGG - Intronic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057171164 9:92964024-92964046 CAGCAGAAGCAGGAGGATGGTGG + Intronic
1057396045 9:94681446-94681468 GAGAAGGAGGAGGAGGATGGTGG - Intergenic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1058138532 9:101334286-101334308 CAGAAGCAGCGGGAGGATGCTGG - Intergenic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1058293139 9:103269727-103269749 CAGCAGAAGAAGCATGATGCTGG + Intergenic
1058563025 9:106249755-106249777 CAGCAGAAGAAGGAAGAAGACGG - Intergenic
1059072459 9:111152946-111152968 AAGCAGGAGGAGGAGGAAGGAGG + Intergenic
1059361118 9:113742722-113742744 CAACAGAAGCAGGAAGAGGCTGG - Intergenic
1059826712 9:118038025-118038047 AAGAGGATGCAGGAGGATGGGGG + Intergenic
1059850143 9:118329182-118329204 GAGCTGAAGCAGAAGAATGGAGG - Intergenic
1060430190 9:123544547-123544569 CACCAGAACCAGGCAGATGGAGG + Intronic
1060500606 9:124151037-124151059 GAGAAGATGCAGGAGGATGCTGG - Intergenic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1060745444 9:126127904-126127926 CAGCAGGAGAAGGAGGAGTGAGG + Intergenic
1061263309 9:129491654-129491676 GAGCACAGGCAGGAGGAAGGCGG - Intergenic
1061920895 9:133781770-133781792 CAGCAGAGGGATGAGGAGGGGGG + Intronic
1062114921 9:134803222-134803244 GAGCAGAGGGTGGAGGATGGTGG - Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1062437884 9:136554691-136554713 CAACAGAAGCTGGAGGAGGTGGG + Intergenic
1062558232 9:137126826-137126848 CAGCTGAGGCAGGAGGATTGTGG - Intergenic
1062731429 9:138112378-138112400 CAGCTGCACCAGGATGATGGTGG - Exonic
1203756122 Un_GL000218v1:128586-128608 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1203649738 Un_KI270751v1:104834-104856 AAGAAGAAGCAGGAAGCTGGGGG - Intergenic
1185969119 X:4642136-4642158 AAGATGAGGCAGGAGGATGGAGG + Intergenic
1186093553 X:6075703-6075725 GAGAAGAAGCAAGAGAATGGGGG - Intronic
1186233656 X:7483876-7483898 CGGCTAAAGCAGGAGGAAGGAGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186495094 X:10006752-10006774 AAGCAGCAGCAGGAGCCTGGGGG + Intergenic
1187069261 X:15871950-15871972 AGGCTGAAGCAGGAGGATCGTGG - Intergenic
1187200592 X:17130310-17130332 CAGGAGAAGCAGGAGTGAGGGGG - Intronic
1187603666 X:20860699-20860721 CAGAAGAAGAAGGAAGATGTGGG + Intergenic
1189222702 X:39385901-39385923 CACCAGAATCATGAGGATGAAGG - Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189375455 X:40463027-40463049 CAGCAGGAGCTGGAGCATGCAGG + Intergenic
1189921440 X:45906674-45906696 CAGCAGAAGCATGAGGATTCAGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190058121 X:47193941-47193963 GAGGAGAAGGAGGAGGGTGGCGG + Exonic
1190470553 X:50775086-50775108 CAGCAGCATCAGGAGGGTGTTGG - Intronic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1192007468 X:67232658-67232680 GAGGAGAAGGAGGAGGATGGAGG - Intergenic
1192209782 X:69120501-69120523 CCTCTGAGGCAGGAGGATGGAGG - Intergenic
1192550718 X:72051570-72051592 TAGGAGAAGCAAGAGGAAGGAGG - Intergenic
1193236484 X:79113624-79113646 AAGCAGAAGCAGGCTGAAGGTGG + Intergenic
1194267367 X:91771462-91771484 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1194504483 X:94715402-94715424 CGGCTGAGGCAGGAGAATGGCGG + Intergenic
1194504493 X:94715449-94715471 CGGCTGAGGCAGGAGAATGGCGG + Intergenic
1194838235 X:98708498-98708520 CAGCAGAAGCCGTTGGGTGGTGG + Intergenic
1194954530 X:100163166-100163188 CAGCAAAAGCAGTAGGAAGAAGG - Intergenic
1195252253 X:103060524-103060546 CAGCAAAAGTGGGAGGAAGGAGG + Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1197033671 X:121849247-121849269 GAGCAGGAGGAGGAGGAAGGGGG - Intergenic
1197037880 X:121899064-121899086 TACCAGAAGGTGGAGGATGGAGG - Intergenic
1197079280 X:122393239-122393261 GAGTAGAATCAGGGGGATGGGGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197239614 X:124109693-124109715 CAGCAGAGGCTGCAGAATGGCGG + Intronic
1197433304 X:126393525-126393547 CCACAGAAGAAGGAGGAAGGAGG + Intergenic
1197546394 X:127830289-127830311 CTACAGAAGAAGGAAGATGGGGG - Intergenic
1197551111 X:127893907-127893929 CAGCAGAAGCAAGGGGTGGGGGG - Intergenic
1197711593 X:129675121-129675143 AGGCTGAAGCAGGAGAATGGCGG + Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1197774867 X:130112036-130112058 CAGGAGAAGCAGGCCGATGCTGG - Intergenic
1197947074 X:131851155-131851177 TAGCAGAAGCAGGAAGAGAGCGG - Intergenic
1198058996 X:133024886-133024908 TAGCAGCACCAGGAGCATGGGGG - Intronic
1198512479 X:137366474-137366496 CAGCAGGAGCAGGCGGCTGCTGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199575825 X:149312782-149312804 CAGCAGAAGCAGATGTATGCAGG - Intergenic
1199616683 X:149661342-149661364 CATACGAAGCAGGGGGATGGGGG + Intergenic
1199625958 X:149741906-149741928 CATACGAAGCAGGGGGATGGGGG - Intergenic
1199781208 X:151061690-151061712 CAGCAGGAGCAGAAACATGGTGG - Intergenic
1200076269 X:153552792-153552814 CACCAGAAGCTGGAGGATGCAGG - Intronic
1200125711 X:153813431-153813453 CAGGAGGACCAGGAGGATGTGGG + Intronic
1200160352 X:154004630-154004652 CAGCCAGAGCAGGAGGGTGGCGG + Intergenic
1200584572 Y:4992399-4992421 GAGGAGAAGGAGGAGGAGGGTGG - Intergenic
1201236924 Y:11920907-11920929 CAGCAGGAGCCAGAGGATGCGGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic
1201504636 Y:14684512-14684534 GAGAAGAAGCAAGAGAATGGGGG + Intronic
1201739734 Y:17311109-17311131 CAGCAGCAGGAGGAGGAGGAGGG - Intergenic
1202369652 Y:24188184-24188206 GTGCAGAAGCAGGGGGCTGGTGG - Intergenic
1202501133 Y:25481933-25481955 GTGCAGAAGCAGGGGGCTGGTGG + Intergenic
1202594133 Y:26519504-26519526 CAGGAGAAGGAGAAAGATGGGGG - Intergenic