ID: 1057171974

View in Genome Browser
Species Human (GRCh38)
Location 9:92968472-92968494
Sequence CTGTGGGAGTGGATGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 9, 3: 85, 4: 736}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057171974_1057171987 23 Left 1057171974 9:92968472-92968494 CCCTCCTCCATCCACTCCCACAG 0: 1
1: 0
2: 9
3: 85
4: 736
Right 1057171987 9:92968518-92968540 AGACCCCAAGGTAATTACTCTGG No data
1057171974_1057171983 -3 Left 1057171974 9:92968472-92968494 CCCTCCTCCATCCACTCCCACAG 0: 1
1: 0
2: 9
3: 85
4: 736
Right 1057171983 9:92968492-92968514 CAGCAGACAGGGCATTTCCCAGG No data
1057171974_1057171984 11 Left 1057171974 9:92968472-92968494 CCCTCCTCCATCCACTCCCACAG 0: 1
1: 0
2: 9
3: 85
4: 736
Right 1057171984 9:92968506-92968528 TTTCCCAGGCTGAGACCCCAAGG No data
1057171974_1057171988 24 Left 1057171974 9:92968472-92968494 CCCTCCTCCATCCACTCCCACAG 0: 1
1: 0
2: 9
3: 85
4: 736
Right 1057171988 9:92968519-92968541 GACCCCAAGGTAATTACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057171974 Original CRISPR CTGTGGGAGTGGATGGAGGA GGG (reversed) Intronic
900354476 1:2253676-2253698 CGGTGCGAGCAGATGGAGGATGG + Intronic
900404510 1:2486517-2486539 CAGTGGGAGGGGCTGGATGAGGG + Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900509496 1:3051813-3051835 GTGGGTGAGTGTATGGAGGATGG - Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900680851 1:3915397-3915419 CTGTGGGGGTGGCTAGGGGAGGG - Intergenic
900763049 1:4485784-4485806 ATGTGGAACTGGGTGGAGGATGG - Intergenic
901004067 1:6163271-6163293 CAGTGCAGGTGGATGGAGGAGGG - Intronic
901133655 1:6979078-6979100 TTGTTGGTGTGGCTGGAGGAGGG + Intronic
901917445 1:12510845-12510867 CTGTGGGGGTGCAAGGAGGGAGG - Exonic
902231768 1:15032095-15032117 GTGTGGGGGTGGATCGGGGAGGG - Intronic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
904163177 1:28536191-28536213 CTGTGGGAGGAGATTGAGAAGGG + Intronic
904379135 1:30099698-30099720 CTGGAGGCGTGCATGGAGGATGG - Intergenic
904408731 1:30312034-30312056 CTCTGGGAGAGGGAGGAGGAAGG + Intergenic
904602917 1:31683629-31683651 GTTTGGGAGTGGATGGAAGTAGG + Intronic
904830929 1:33306526-33306548 CCGTGGGAGTGGGAGTAGGAGGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905020130 1:34804799-34804821 CTGTGGGGTTGGGTGGAGCAAGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905175825 1:36134759-36134781 CTGTAGGGGTGGCTGGAGGAGGG + Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905357013 1:37391738-37391760 TTGGGGGGGTGGTTGGAGGAGGG - Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905904987 1:41612076-41612098 GGGTGGGAGTGGGAGGAGGAAGG - Intronic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906150580 1:43585207-43585229 CTGCAGCAGTGGGTGGAGGATGG + Intronic
906276645 1:44521566-44521588 CTGTGGGTGTGGGTGGGGGCAGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906700888 1:47857280-47857302 CTCTGGGAGTGGCTTCAGGAAGG - Intronic
906785350 1:48610851-48610873 GTGTGTGTGTGGAAGGAGGAGGG - Intronic
906789308 1:48644681-48644703 AGATGGGAGTGGATGCAGGAAGG + Intronic
906919012 1:50043500-50043522 ATGTGGGGGTGGGTGGAGGGTGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907220697 1:52905118-52905140 CTGGGGGACCGGATGGGGGAGGG - Intronic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907334697 1:53692616-53692638 CTGTGGGTGTAGCTGGGGGAGGG + Intronic
907457124 1:54582983-54583005 GTGTGGGAGTGGGTAGAGGGAGG - Intronic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909139274 1:71843216-71843238 TTGTGGCAGGGGATGGAGAAAGG + Intronic
909239580 1:73195335-73195357 CTGTGGCAGGGAATTGAGGATGG - Intergenic
909392131 1:75130971-75130993 CTGTAGGAGGCGGTGGAGGATGG - Intronic
909673105 1:78211244-78211266 CATTGAGAGTGGATGGAGGCAGG + Intergenic
910961807 1:92771312-92771334 CTCTGGGAGTGTGTGTAGGAAGG - Intronic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913266640 1:117051623-117051645 CTGTGAGAGTGAAAGCAGGAAGG + Intergenic
914343030 1:146776427-146776449 ATGTGGAAGTGCATGGATGAAGG + Intergenic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915440905 1:155944967-155944989 GTGGGGGAGTGGAACGAGGAGGG + Intergenic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
918038050 1:180894633-180894655 CTATGGGAGACAATGGAGGAAGG + Intergenic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
919758754 1:201083323-201083345 CTGAGGGAGGGGACAGAGGATGG + Intronic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920453333 1:206077526-206077548 CTTTGGGAGGGGAAGGAGGGAGG + Intronic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
920791922 1:209101260-209101282 CTGGGGAAGTGAATGGAGGCTGG - Intergenic
920977125 1:210796821-210796843 CTTGGGGAGTGGATTGAGTAGGG - Intronic
921642934 1:217577988-217578010 CTTTGGGAGTCCAAGGAGGACGG - Intronic
922228921 1:223668730-223668752 TTCTGTGATTGGATGGAGGAAGG - Intergenic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923049674 1:230381893-230381915 CTGTGAGAGTGGATGTAGGATGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923697749 1:236270850-236270872 CTGGGGTAGGGGATGGATGATGG + Intronic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1063342821 10:5284149-5284171 GTGTGGGGGTGTATGGAGGAAGG - Intergenic
1065645621 10:27831048-27831070 CTGGAGGAGTGGATGGGGGAGGG + Intronic
1066329444 10:34403813-34403835 CAATGGGAGTGGGTGCAGGAAGG + Intronic
1067051892 10:43026395-43026417 CTGTGTCACTGGAAGGAGGAAGG + Intergenic
1067216908 10:44310932-44310954 CTGGGGGACTGCATGGAGAAGGG + Intergenic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067249407 10:44574538-44574560 CTGTGGGAGTGAGAGGAGCAGGG + Intergenic
1067668867 10:48301804-48301826 CAGTGGGTGTGGATGGAGAGAGG + Intergenic
1068195291 10:53708224-53708246 ATGTGGGAGTTGATTGTGGATGG - Intergenic
1069598420 10:69687560-69687582 GTCTGGGACAGGATGGAGGAGGG - Intronic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1070522308 10:77264796-77264818 CTGATGGAGTGGATGAGGGATGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1072285281 10:93908534-93908556 CTCTAGGAGGGGAAGGAGGAAGG - Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073330760 10:102668724-102668746 CTGTGGGCGTGGGTTGGGGAGGG + Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073727231 10:106247629-106247651 CTGTGGCAGTGGATGGGGGTTGG - Intergenic
1073816699 10:107214855-107214877 CATTGAGAGTGGATGGAGGGAGG - Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073984478 10:109192857-109192879 CTGAGGAAGTGGAAGGAGTAAGG - Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074370555 10:112897759-112897781 GGGTGGGAGTGGATGGATGCTGG + Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075323508 10:121511422-121511444 GTGTAGGGGTGGGTGGAGGATGG - Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076581892 10:131517375-131517397 CTCTGGGGCTGGATGGATGAGGG + Intergenic
1076649101 10:131975354-131975376 CTCTGGTAGCGTATGGAGGATGG + Intronic
1076676071 10:132148472-132148494 CCTTGGGGGTGGATGGAGGACGG - Intronic
1077009606 11:374339-374361 CTGTGGGGATGGACGGGGGAAGG + Intronic
1077048965 11:558237-558259 CTGTGGGAGCTCCTGGAGGAGGG + Exonic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077556793 11:3229915-3229937 CCTTGGGAGGGGATGGAGGGAGG - Intronic
1077880577 11:6346492-6346514 CTGTGGGCGGGGTTGGGGGATGG - Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078334872 11:10455507-10455529 CTGTGTGTGTGGATGGGGGTGGG + Intronic
1078447686 11:11416885-11416907 CTGGGGGAGGGGATGGGGCAGGG - Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078612747 11:12835829-12835851 TTTTGGGGGTGGATGGAGAAAGG + Intronic
1078642352 11:13108532-13108554 CTGAAGGAGTGGGTGGAGGGAGG + Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1079190428 11:18272502-18272524 CTGTAGCAGTGGCTGGAGAAAGG + Intergenic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080376890 11:31723339-31723361 CTGGGGGAGTGGGTGGCGGGGGG - Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1083269528 11:61564816-61564838 CTGGGCCAGTGGATGGGGGAAGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083746830 11:64741645-64741667 CTCTGGGAGGGGTTGGAGGTGGG + Intronic
1084149112 11:67279915-67279937 GTGTGGGAGAGGAAGGGGGAGGG + Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084494005 11:69493647-69493669 AGGAGTGAGTGGATGGAGGACGG - Intergenic
1084705780 11:70815315-70815337 CTGTGGGGGAGGATGGGGGCAGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085184030 11:74560141-74560163 CCATGGGAGTGGATGGATGAAGG - Intronic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087727342 11:101736956-101736978 CAGTGGGGGTGGGTGAAGGAAGG + Intronic
1088740409 11:112762415-112762437 TGCTGGGAGAGGATGGAGGAAGG + Intergenic
1089052187 11:115555525-115555547 CAGTGGGAGTGGATGATGGATGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1089866178 11:121634173-121634195 CTGTGGAACTGGGTGGGGGAGGG + Intergenic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091648161 12:2289343-2289365 GGGAGGGGGTGGATGGAGGAGGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1091811583 12:3403310-3403332 CTATGGGAGGGGTTGGGGGAAGG + Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1092146412 12:6217780-6217802 CTTTGGGAGGGGTTGGAGGTGGG - Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092910235 12:13139845-13139867 ATGAGGGAATGGATGTAGGACGG - Intronic
1092910262 12:13139965-13139987 ATGAGGGATTGGATGTAGGACGG - Intronic
1092910366 12:13140401-13140423 ATGAGGGATTGGATGTAGGACGG - Intronic
1092910384 12:13140472-13140494 ATGAGGGATTGGATGTAGGACGG - Intronic
1092910510 12:13141072-13141094 ATGAGGGATTGGATGTAGGACGG - Intronic
1092910520 12:13141120-13141142 ATGAGGGATTGGATGTAGGACGG - Intronic
1092930370 12:13309853-13309875 CTATTGGAGGGGAAGGAGGAAGG - Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095747043 12:45671274-45671296 CTATGGAATTGGATGGAGGTGGG + Intergenic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096134058 12:49185119-49185141 GTTGGGGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097143924 12:56926509-56926531 CTGTGGGTGATGATTGAGGAGGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098493191 12:71106041-71106063 ATGTGAGAGTGGATGTAAGAGGG + Intronic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101700738 12:107171498-107171520 CAGAAGGAGTGGATGGGGGATGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102368612 12:112361773-112361795 CTGTGGGATTTAAAGGAGGATGG - Intronic
1102562007 12:113769121-113769143 CGGTGGGGGAGGATGAAGGAAGG - Intergenic
1102686578 12:114729432-114729454 CTCTGGGAGTGGCTGGAGGGAGG + Intergenic
1103297293 12:119898754-119898776 TTGTGGGGGTGGGTGGAGGGGGG - Intergenic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1103981635 12:124740738-124740760 CTGAGGGAGGGCATGTAGGAGGG - Intergenic
1104568074 12:129903185-129903207 GTGTGGGAGTGTGTGGAGGATGG - Intronic
1104638668 12:130453402-130453424 CTGAGAGAGAGGATGGTGGAAGG - Intronic
1104856455 12:131904569-131904591 CTGGGTGAGTGGCTGGGGGATGG + Intronic
1105640997 13:22264033-22264055 TTGTGGGTGGGGATGGCGGAAGG + Intergenic
1106320162 13:28630293-28630315 TTGTGGGAGTTGAATGAGGATGG - Intergenic
1106356717 13:28990258-28990280 CTATGTGAGAGGATGGGGGATGG + Intronic
1106458581 13:29948727-29948749 CTGTGGCGGTGGAAGGAGGTGGG - Intergenic
1106615461 13:31323097-31323119 CTGTTGCAGGGGACGGAGGAGGG + Intronic
1107159670 13:37211290-37211312 CTTTGGGAGGCCATGGAGGATGG + Intergenic
1110277970 13:73660996-73661018 CTGTGGGAGAGCACTGAGGATGG + Intergenic
1110295245 13:73856527-73856549 CTGGGTGCGTGTATGGAGGAGGG - Intronic
1110551770 13:76818696-76818718 TAGTGGCAGTGGATGAAGGAAGG + Intergenic
1110668149 13:78142274-78142296 GTGTGGGAGTTGAAGGAAGAAGG + Intergenic
1111068792 13:83134953-83134975 GAGTGGGAGTGAAAGGAGGAGGG - Intergenic
1111374091 13:87355156-87355178 CTGGGGGAGTGGGTAGAGGAAGG + Intergenic
1112661175 13:101510154-101510176 CTAGAGGAGGGGATGGAGGAAGG - Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114487488 14:23071576-23071598 CTGTGTGTGCGGATGGGGGAGGG + Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114616973 14:24073476-24073498 CTGTGGTAGTGGTTGAAGGGAGG - Intronic
1115091159 14:29577548-29577570 CTGTTAGAGTGGAAGGAGAAGGG - Intronic
1115372839 14:32637914-32637936 GAATGGGAGTGGGTGGAGGAGGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1120546077 14:85813057-85813079 CTTTGGGACTGGAAGGAGTAAGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1122646007 14:103194666-103194688 CTTGTGGAGTAGATGGAGGAAGG + Intergenic
1122920020 14:104876165-104876187 CTGGGGCAGGGGATGGAGCAGGG + Intronic
1122960491 14:105091780-105091802 CAGTGGGCGGGGGTGGAGGACGG + Intergenic
1123122296 14:105922268-105922290 CATTGGGAAGGGATGGAGGATGG + Exonic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123802303 15:23834128-23834150 ATTTGGTGGTGGATGGAGGATGG - Intergenic
1124409904 15:29428456-29428478 CTTTGGGAGTGCAAGGAGGGTGG - Intronic
1124491872 15:30163160-30163182 CAGCTGGAGTGGATGGAGCATGG + Intergenic
1124751664 15:32375157-32375179 CAGCTGGAGTGGATGGAGCATGG - Intergenic
1124794749 15:32766729-32766751 GGGTGTGAGAGGATGGAGGAGGG + Exonic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1128674016 15:69595674-69595696 CTGTGGGAGGGCATGGGGCAGGG + Intergenic
1128807244 15:70540167-70540189 CAGTGGGAGGGGGTGCAGGATGG - Intergenic
1128981859 15:72194021-72194043 ATGTGGGAAAGGAAGGAGGAGGG - Intronic
1129227233 15:74177076-74177098 CTGTGGGATGGTTTGGAGGAAGG - Intergenic
1129525054 15:76208531-76208553 CTGTGGGATGGGCTGGAGGAAGG - Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129793464 15:78358202-78358224 TTGTGGCAGGGGATGGAGGTCGG + Intergenic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130147588 15:81286148-81286170 CTGTGGGAATGTCTGGAGGTAGG + Intronic
1131864739 15:96695618-96695640 CTGTGTGAGTGGGTGTGGGAGGG + Intergenic
1132013964 15:98299931-98299953 CTGTGGGATGGGCTGGAGGTGGG - Intergenic
1132074690 15:98810134-98810156 GTGTGGGGGTGGCTGGCGGAGGG + Intronic
1132186187 15:99803890-99803912 CTGTGAGAGTGGCTGGGGGTAGG + Intergenic
1132238916 15:100242544-100242566 GTGTGGGAGAGGATGGAGAGAGG - Intronic
1132483441 16:177642-177664 CGGGAGGAGGGGATGGAGGAGGG + Intergenic
1132607263 16:798801-798823 CTGCTGAAGTGGATCGAGGACGG - Exonic
1132644692 16:993550-993572 GTGAGTGGGTGGATGGAGGATGG - Intergenic
1132676357 16:1122930-1122952 CTGTGGGTGGGTATGGAGGTAGG - Intergenic
1132819943 16:1859997-1860019 TTGTGGGAGTGGTTGGTTGAGGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132983093 16:2749262-2749284 CTGTGGGAGGGGTTGGATGGGGG + Intergenic
1133013021 16:2925329-2925351 GTATGGGAATGGATGGACGATGG - Intronic
1133478426 16:6146178-6146200 CTGTGGGAGGGGGTGGAGGCAGG + Intronic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1134224857 16:12381822-12381844 ATGGGTGAGTGGATGGATGATGG - Intronic
1134690609 16:16188835-16188857 ACGAGGGAGTGGATGGAGAAGGG + Exonic
1134752608 16:16638107-16638129 CTCTGGGATTGAATGGTGGAGGG + Intergenic
1134782415 16:16910184-16910206 GTGGGTGAGTGGATGGAGGGAGG + Intergenic
1134993453 16:18720969-18720991 CTCTGGGATTGAATGGTGGAGGG - Intergenic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1137232031 16:46575190-46575212 CTGTGGAAGTGTATGGAGCAAGG + Intergenic
1137271531 16:46905573-46905595 CTGTGGAAGTGCATGGGGGCTGG - Intronic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138270508 16:55692516-55692538 CAGGGGGAGTGGTTGGATGAGGG - Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1138776346 16:59728807-59728829 CATTGAGAGTGGATGGAGGGAGG + Intronic
1139469544 16:67170748-67170770 CTCTGGGACTGGGTGGAGGGAGG + Intronic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1139990956 16:70938901-70938923 ATGTGGAAGTGCATGGATGAAGG - Intronic
1140264411 16:73408047-73408069 CTGCAGGAGTGGATGGGGGTGGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140566618 16:76049663-76049685 CACTGAGAGTGGATGGAGGGAGG - Intergenic
1140782318 16:78307982-78308004 ATGTGGCAGCTGATGGAGGAAGG + Intronic
1140906376 16:79412794-79412816 CTCTGGGTGTGAATGGGGGAGGG - Intergenic
1141819290 16:86434022-86434044 CAGGTGGAGAGGATGGAGGATGG - Intergenic
1142401282 16:89860053-89860075 CTCTGGGAGTTGGTGGAGGGAGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1143473428 17:7190370-7190392 GTGTGGGAGAGGATGGGGGAGGG + Exonic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143633805 17:8153019-8153041 GTGGGTGAGTGGGTGGAGGAAGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144150268 17:12436288-12436310 GTGTGCTAGTGGATGGAGGGTGG + Intergenic
1144203350 17:12961101-12961123 CTGGCAGAGAGGATGGAGGAGGG - Intronic
1144337041 17:14280853-14280875 ATGTGGGTGTGAGTGGAGGAGGG + Intergenic
1144402345 17:14918385-14918407 CTGTGGGAGCCGATGCATGATGG + Intergenic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144799313 17:17914141-17914163 CTCTGGGCGTGGACAGAGGAGGG + Intronic
1144955763 17:19018108-19018130 CTGAGGGAGAGGGTGGAGGAAGG - Intronic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146519656 17:33516418-33516440 GTGTGTGTGTGTATGGAGGAGGG + Intronic
1146635692 17:34502691-34502713 CTGCGGGGGTGGAAAGAGGAGGG + Intergenic
1146789454 17:35743196-35743218 CAGAGGGAGCGGATGAAGGATGG + Exonic
1146790410 17:35747703-35747725 GTGTGGGGGAGGCTGGAGGAAGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147378151 17:40035230-40035252 CTGCGGGAGGGGCTGGAGGCCGG - Exonic
1147600115 17:41740098-41740120 CTGTGGGAGAGGATGGAGACCGG + Intergenic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1147841486 17:43374972-43374994 CCCTGGAAGTGGATGGTGGATGG + Intergenic
1148457818 17:47820415-47820437 GTGTGGGAGGGGCTGGAGGTGGG - Intronic
1148738991 17:49881217-49881239 CCTTGGGAGGGAATGGAGGAGGG + Intergenic
1148849714 17:50548659-50548681 GAGTGGCAGTGGATGGGGGAGGG + Intronic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150017580 17:61573772-61573794 CTATTGGAAGGGATGGAGGAAGG - Intergenic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150439050 17:65176973-65176995 GTGTACGAATGGATGGAGGAAGG - Intronic
1150862517 17:68815932-68815954 TTGTGGGAGTGGGTGGTTGAAGG - Intergenic
1151720827 17:75855086-75855108 CTGGGGGCGGGGTTGGAGGAAGG - Intronic
1152330749 17:79671196-79671218 CTCTGAGCCTGGATGGAGGAGGG - Intergenic
1152424578 17:80212018-80212040 GTGTGGGAGTGGATCTGGGACGG - Intronic
1152524431 17:80879426-80879448 ATGTGGGAGTGGGAGGAGAAAGG - Intronic
1152611573 17:81317450-81317472 CTGGGGGTGTGGATAGAGTAGGG + Intronic
1152753462 17:82077296-82077318 GGGTGGGAGTGGCCGGAGGAGGG + Intergenic
1153550712 18:6258811-6258833 GGGTGGGAGAGGGTGGAGGAGGG + Intronic
1154133582 18:11757389-11757411 CTCTGGCTGTGGATGGAGAACGG + Intronic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1155609433 18:27648283-27648305 GGGTGGGAGTGGGTGGAGAAAGG + Intergenic
1156493700 18:37511939-37511961 CTGGGGGTGGGGATAGAGGAGGG + Intronic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1157616471 18:48990492-48990514 CTGTGGGGCTGGATGGAGCAGGG - Intergenic
1159507392 18:69354802-69354824 ATGTGGGAGTGGATGAAAGGAGG - Intergenic
1160226888 18:77018689-77018711 ATGTATGAGTGGATGGGGGATGG - Intronic
1160319244 18:77875055-77875077 CTGGGCGGGTGGATGGAGGAGGG - Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161051363 19:2165386-2165408 CGGTGCGAGTGGATGGGAGAGGG + Intronic
1161186178 19:2922454-2922476 CTGAGGAGGTGGCTGGAGGAGGG + Intergenic
1161368293 19:3893865-3893887 AGGAGGGAGTGGTTGGAGGATGG - Intronic
1161470739 19:4455739-4455761 CCGGGGGAGTGGGAGGAGGATGG + Intronic
1161916067 19:7229154-7229176 ATGGGTGAGTGGATGGATGATGG + Intronic
1161939436 19:7393713-7393735 GTGTGGAAGTGGATAGGGGAGGG + Intronic
1162124914 19:8494258-8494280 TTCTGGGAGTGGTTGGAGGCAGG + Intronic
1162777623 19:12989569-12989591 TTGTGTGTGTGGATGAAGGATGG + Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163633911 19:18429802-18429824 CTGGGGGAGGGGCTGGAGGCGGG - Intronic
1163672563 19:18637307-18637329 CTGAGGGGGTGGCTGGAGGGGGG + Intronic
1163685618 19:18710222-18710244 CTGGGTGGGTAGATGGAGGAAGG - Intronic
1164378610 19:27711737-27711759 CTGTGGGAGAGGAAGGCTGAGGG + Intergenic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1164852294 19:31494187-31494209 CTGTGGAGTTGGGTGGAGGATGG - Intergenic
1164938204 19:32231115-32231137 GTGTGGGAGGGACTGGAGGAAGG + Intergenic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
1165333663 19:35154902-35154924 ATGTGGGCGTGGATGGGGGGCGG - Exonic
1165922075 19:39305459-39305481 CTGGCGGAGGGCATGGAGGATGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166392894 19:42419698-42419720 GGGTGGGGGTGGATGGGGGATGG + Intronic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
1166742641 19:45123560-45123582 CTGTGGGAGCGGACAGAGGGAGG - Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1168411272 19:56141617-56141639 CTGAGGGAGAGGACGGGGGAGGG + Intronic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
925034835 2:677114-677136 CTGTGGGAGTGGCTCGGGGCCGG - Intronic
925313960 2:2907205-2907227 CTGGAAGAGGGGATGGAGGAAGG - Intergenic
925536539 2:4924297-4924319 CTGTGTGAGTGTATGTAGGTAGG + Intergenic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
926138833 2:10356498-10356520 CTCAGGGAGTGGCTGCAGGATGG - Intronic
926373495 2:12204096-12204118 GTGTGGGAGGGGCTGAAGGATGG + Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929598916 2:43192956-43192978 CTGTGGGAGCAGGTGGAGGCTGG - Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930606337 2:53497141-53497163 GTGTGGGAGTGGCTGGAGAGGGG - Intergenic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
931147514 2:59535247-59535269 CTGTGGGTGGGGTTGGAGGCTGG + Intergenic
931170621 2:59799877-59799899 CTGTGGAGATAGATGGAGGACGG + Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931262605 2:60633107-60633129 TTGGGGGAGTGGATGAAGGGTGG + Intergenic
931914027 2:66933462-66933484 CTGTGGCAGCTGATGGAAGAGGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932233366 2:70101191-70101213 CTTTGGGAGGTCATGGAGGAAGG + Intergenic
932322183 2:70830403-70830425 CTAAGGGAGTGGAAGGAGAAGGG + Exonic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932892805 2:75611299-75611321 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892833 2:75611394-75611416 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892856 2:75611475-75611497 TGGTGGGAGATGATGGAGGATGG - Intergenic
932892883 2:75611570-75611592 TGGTGGGAGATGATGGAGGATGG - Intergenic
933810980 2:86032512-86032534 GGGTGGCAGTGGATGGAGGGTGG - Intronic
934040680 2:88125508-88125530 CTGTGTGAGTGGTTGGCAGATGG - Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935206851 2:100903732-100903754 CTGTGGGAGTGGGAGGCTGAAGG - Intronic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
935831460 2:107004999-107005021 CTGAGGGAGGGGATGAGGGAGGG + Intergenic
935945619 2:108283722-108283744 CTGTGGGTGGGAATGGGGGAAGG - Intergenic
936719130 2:115228502-115228524 GTGTGGTAGTGGCTGGAGGGGGG - Intronic
936933576 2:117815333-117815355 GTGTGGAAGTGGGTAGAGGAAGG - Intronic
936997965 2:118435167-118435189 CTTGAGGAGTGGTTGGAGGAGGG + Intergenic
937124726 2:119466506-119466528 CTTTGGGAGTCTAAGGAGGAAGG + Intronic
937276109 2:120685244-120685266 CTGGGGGAGAGGCTGCAGGAGGG + Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
937977387 2:127589888-127589910 GTGTGTGAGTGGATGGGTGAAGG + Intronic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940437101 2:153668569-153668591 CATTGAGAGTGGATGGAGGGAGG + Intergenic
940769144 2:157821736-157821758 CTGTGCAGGTGGTTGGAGGATGG + Intronic
941229821 2:162897921-162897943 CTGTGGGCCTGGATGGGGGCTGG - Intergenic
941351464 2:164442315-164442337 CTGTGGAAGTGGATGGCGAGGGG + Intergenic
941407563 2:165110018-165110040 CTAAGGGAGTGCATGGGGGAGGG - Intronic
941805832 2:169711662-169711684 CTGAGGGAGTGGGTGGATGTGGG + Intronic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
944457530 2:199911191-199911213 CGGTGGGCGTGGCTTGAGGAAGG - Intergenic
944621669 2:201522450-201522472 CATTGAGAGTGGATGGAGGGAGG + Intronic
945317337 2:208383940-208383962 CGGGAGGAGTGAATGGAGGATGG + Intronic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946543721 2:220714118-220714140 TTGTGGGGGTGGTTGGAGCAAGG + Intergenic
946735608 2:222751529-222751551 GTGTGTGAGTGGTTGGAGCACGG + Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947354062 2:229273784-229273806 CTAGGGGAGGGGGTGGAGGAGGG + Intergenic
947449899 2:230198200-230198222 CTGTGGAAGTGTGTGGAAGAGGG - Intronic
947952184 2:234158014-234158036 CTTAGGGAGGGGATGGGGGAGGG - Intergenic
948274396 2:236697008-236697030 GTGGGGGACTGGATGGATGATGG + Intergenic
948458681 2:238118898-238118920 CGGAGGAGGTGGATGGAGGAGGG + Intronic
948487691 2:238291245-238291267 TGGTGGGAGTGGGTGGAGCAGGG - Intergenic
948982280 2:241500529-241500551 CTGTGGGAGTGGGCGGGGGCAGG - Intronic
948987141 2:241532656-241532678 CTTGGGGAGGGGCTGGAGGAGGG + Intergenic
949027593 2:241773787-241773809 CTCTGGGGGTGGGTGCAGGAGGG - Intergenic
949050627 2:241895659-241895681 CTGTGTGGGTGGATGGAGGGGGG + Intronic
1168923603 20:1561095-1561117 CTCTGGTAGTGGACAGAGGAAGG + Intronic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169342248 20:4805354-4805376 CTGTGGACGAAGATGGAGGAAGG + Intronic
1169356696 20:4912827-4912849 TTGTGGGAGGGGATGGCGGTGGG + Intronic
1169794552 20:9447615-9447637 AAGTGGGAGTGGATGCAGAAAGG + Intronic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170987687 20:21273614-21273636 CTGGGGGAGAGCATGGAGGAGGG - Intergenic
1171107142 20:22445379-22445401 TTCTGGGACTGCATGGAGGAAGG + Intergenic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1172057536 20:32164951-32164973 CAGTCGGAGTGGGTGGGGGAGGG - Intronic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1173162707 20:40664280-40664302 AGGAGGGAGGGGATGGAGGAAGG - Intergenic
1173551372 20:43935091-43935113 CCTTGGGGGTGAATGGAGGAAGG + Intronic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1174196558 20:48776430-48776452 CTGTGGGAGGGGATGGCAGCTGG + Intronic
1174286932 20:49480580-49480602 CCCTGAGAGTGGATGGAGAAGGG - Intronic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174577330 20:51545751-51545773 ATGGAGGAGTGGATGGAGGGTGG + Intronic
1174888993 20:54369290-54369312 CTGTGGGATTGGATGGATCTCGG + Intergenic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175229626 20:57465531-57465553 CTTGGGGTGTGGATGTAGGAAGG + Intergenic
1175320519 20:58084669-58084691 GGGTGGGAGGGGAAGGAGGAAGG - Intergenic
1175598120 20:60251825-60251847 CTGATTGAGTGGTTGGAGGATGG + Intergenic
1175640003 20:60620978-60621000 CTGTGAGGGGGAATGGAGGAAGG + Intergenic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175828464 20:61949805-61949827 CTGTGGTACTGGGTGGGGGAAGG + Intergenic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176940286 21:14915634-14915656 CTGTGTGTGTGGATGGGGGTGGG + Intergenic
1177867912 21:26535097-26535119 CTGTGGGGGTGTTTGGGGGAAGG + Intronic
1178208390 21:30497609-30497631 CTTTGGGGGTCGAGGGAGGAGGG - Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178981244 21:37267204-37267226 CTGGGGGTGGGGATGGAGGTGGG - Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179948792 21:44698127-44698149 CCGGGGGAGTGGGTGGAGGCAGG - Intronic
1180024907 21:45155583-45155605 ATGGGTGAGTGGATGGATGATGG - Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181277682 22:21696862-21696884 CTGTGGCAGTGGATGGGGTGAGG - Exonic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181537045 22:23551782-23551804 ATGGGAGAATGGATGGAGGATGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182443461 22:30377130-30377152 AGGTGGGAGTGGACAGAGGAAGG + Intronic
1183038961 22:35161866-35161888 CTGTGGGAGTAGAAGGTGTAGGG - Intergenic
1183078404 22:35441181-35441203 CTCTGGGAGAGGCTGGAGAAGGG + Intergenic
1183094981 22:35546598-35546620 GTGAGTGAGTGGATGAAGGAAGG + Intronic
1183578650 22:38708896-38708918 ATGTGGGAGAGGATGGACGAGGG + Exonic
1183739401 22:39661780-39661802 CTGTGGATGTGGATGGAGTGAGG + Intronic
1184289991 22:43493486-43493508 CTGTGAGAGTTGGTGGAGGCTGG - Intronic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185056358 22:48580657-48580679 CGGTGTGTGTGGAAGGAGGAGGG + Intronic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950699317 3:14729237-14729259 CTGTGGTAGAGGATGAGGGAAGG + Intronic
950941667 3:16898908-16898930 CTGTGGCAGGGGTTGGAGGGTGG + Intronic
953057423 3:39399232-39399254 GTGTGGGAGAGGATGAAGCAGGG + Intergenic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
953890681 3:46749959-46749981 CTATGAGAGAGGATGGTGGAGGG + Intronic
954334768 3:49909772-49909794 CTGGGGGAGGGGGTGGAGGAGGG + Intronic
954434737 3:50490014-50490036 GTGTGGGAGTGGATTCAGGTGGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954701488 3:52453087-52453109 CTGTGGGAGTCCATGGAGCCGGG - Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955406759 3:58630610-58630632 CTGTGGGAAGGAGTGGAGGAAGG - Intergenic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958147605 3:89646664-89646686 TTGGGGCAGGGGATGGAGGATGG - Intergenic
959116947 3:102189767-102189789 CTGTGGGTGTGGCATGAGGAAGG + Intronic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960015826 3:112886201-112886223 CTTTGAGAGTGGATGGAGGGAGG - Intergenic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961503235 3:127352117-127352139 TTGTGGGAGTGGCAAGAGGAGGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961816410 3:129552965-129552987 CTGATGGATTGGATGTAGGAAGG + Intergenic
961818471 3:129563321-129563343 CTGTTGGAGGGGTTGGGGGACGG - Intronic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962217657 3:133536611-133536633 CTGGGGGAGTGGCTGGAGTAGGG - Intergenic
962396084 3:135016438-135016460 CTGTTGGAGAGATTGGAGGAGGG + Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963693463 3:148535056-148535078 CTGTAGAGTTGGATGGAGGAGGG + Intergenic
963860775 3:150308146-150308168 CTGTGGCAGTTGGTGGAGGCAGG + Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
964011878 3:151901402-151901424 CTGTGGCAGTGGGTGCAGGCAGG - Intergenic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
964898789 3:161631651-161631673 CTGTGTAATTGGATGGAGCAAGG - Intergenic
965295103 3:166935369-166935391 CTGTGGGGGTGGTTAGGGGAGGG - Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966748857 3:183303215-183303237 TGGTGGGAGTGAGTGGAGGAGGG - Intronic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967099377 3:186203631-186203653 CTGCTGGACTGGATTGAGGAAGG + Intronic
967903172 3:194477790-194477812 CTGTAGGAGTGGATGAAGTGAGG - Intronic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968040978 3:195589015-195589037 CAGTTGGAGTGGGTTGAGGAGGG + Intergenic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
968962793 4:3753706-3753728 CTGGGGGAGTGCATGGGGCAGGG + Intergenic
968978517 4:3834427-3834449 CTGTGTGGGTGGATGGAGGGTGG - Intergenic
969213491 4:5706172-5706194 CCGTGAGAGAGGGTGGAGGAAGG - Intronic
969352229 4:6604441-6604463 GGGTGGGAGTGGCTGGAGGATGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
972215367 4:36891565-36891587 CACTGAGAGTGGATGGAGGGAGG - Intergenic
972541659 4:40044144-40044166 CTGTGGCGGTGGCTGCAGGAGGG + Intergenic
972572955 4:40327302-40327324 CTGTGGGAGAGGTTGGGGGCTGG + Intergenic
973786588 4:54338022-54338044 CTCTGGCACTTGATGGAGGAGGG + Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
975294576 4:72718144-72718166 CTGGGGGAGTTGAAGGAGAATGG + Intergenic
975718362 4:77227284-77227306 CTGTGGGAGGGGATAGGGGGTGG + Intronic
975801868 4:78068455-78068477 TTGAGGCAGTGCATGGAGGATGG + Intronic
976095265 4:81501757-81501779 CTGTGGGAGGCGTTTGAGGATGG + Intronic
976098022 4:81529287-81529309 TTGTGTAAGTGGATGGATGATGG + Intronic
976388388 4:84484540-84484562 CTGGGGGAGGGGGTGGGGGAAGG - Intergenic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
978493319 4:109332670-109332692 CTCTGCTAGTGGATGGAGCATGG + Intergenic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
981118778 4:141023495-141023517 CTTTGGGAGTCTAAGGAGGATGG - Intronic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983574576 4:169247331-169247353 CTGAGAGAGTGAATGGTGGACGG + Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985660158 5:1153093-1153115 CTGTGGGGGTTGGAGGAGGATGG - Intergenic
986953654 5:13123295-13123317 TTGTGGGATGGGTTGGAGGAAGG + Intergenic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
988779641 5:34508551-34508573 ATGTGGGAGTATTTGGAGGAGGG + Intergenic
990349064 5:54897746-54897768 GTGGAGGAGGGGATGGAGGAGGG - Intergenic
991491516 5:67188236-67188258 CTGTGTGATTCCATGGAGGAAGG - Intronic
992085006 5:73270421-73270443 CAGTGGGAGTGGATGGGGATGGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993228884 5:85205214-85205236 CATTGAGAGTGGATGGAGGGAGG - Intergenic
993734001 5:91454054-91454076 ATGTTGGACTGGCTGGAGGATGG + Intergenic
993873932 5:93284400-93284422 CTGTTGTAGTGGATCGAAGATGG - Intergenic
993953199 5:94200381-94200403 CATTGAGAGTGGATAGAGGAAGG - Intronic
994613612 5:102077316-102077338 CATTGAGAGTGGATGGAGGGAGG + Intergenic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995493623 5:112719100-112719122 AAGTGGGACTGTATGGAGGAGGG + Intronic
996059525 5:119017753-119017775 CTTTGGGAGGTGATGGAGGAGGG + Intergenic
996393321 5:122987150-122987172 CTGGGAGAGAGGGTGGAGGAAGG + Intronic
996789508 5:127277627-127277649 CACTGGGAGTGGTTGGTGGAGGG + Intergenic
997005786 5:129814817-129814839 CTGTGGGAGGGCATGGAGGGAGG - Intergenic
997151428 5:131500138-131500160 CTTTGGGAGGCCATGGAGGATGG - Intronic
997546497 5:134712491-134712513 CTTTGGGAGGCCATGGAGGACGG - Intronic
997623572 5:135316647-135316669 CTGTGTGAGTGCATGCACGATGG + Intronic
997836227 5:137195537-137195559 CTGGGGCAGTGGATGAAGGATGG + Intronic
998334405 5:141357944-141357966 CTTTGGGAGTGTGAGGAGGACGG + Intronic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999745595 5:154589605-154589627 CTCTGGGTGTCGATGGTGGAAGG - Intergenic
1000317951 5:160111074-160111096 CTGTGGGAGGGCAAGGAGGGAGG + Intronic
1000527595 5:162377779-162377801 ATATAAGAGTGGATGGAGGAGGG + Intergenic
1000978549 5:167791929-167791951 ATGAGAGAGTGGATGGAGTATGG - Intronic
1001087443 5:168710990-168711012 CTGTCGGAGTGGGTGAAGGCGGG - Exonic
1001686386 5:173597680-173597702 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686461 5:173597880-173597902 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001686493 5:173597964-173597986 GTGGGTGAGTGGATGGAGGGAGG - Intergenic
1001850861 5:174963680-174963702 CTTTGGGACTGGGTGGGGGAAGG + Intergenic
1001975194 5:175993135-175993157 CTGTTGGAATTGTTGGAGGATGG - Intronic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002242237 5:177850635-177850657 CTGTTGGAATTGTTGGAGGATGG + Intergenic
1002318827 5:178362938-178362960 CTGTGGGAGTGGATTGCTGTGGG - Intronic
1002318854 5:178363018-178363040 CTGTGGGAGTGGATTGCTGTGGG - Intronic
1002427552 5:179185184-179185206 CAGTGGGAGGACATGGAGGAAGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1003514115 6:6804247-6804269 CTATGGGAGGGGAAGGAGGCAGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003672773 6:8174787-8174809 CTGTGGGAGTGAAAGGTGGTGGG + Intergenic
1003693290 6:8376137-8376159 CTGTGGGAGCATATGTAGGATGG - Intergenic
1003731511 6:8829804-8829826 CTGTAGGACTGGATGGACAAAGG + Intergenic
1004193590 6:13485981-13486003 CGGTGGGAGTGGTTGGATGGGGG - Intronic
1004375172 6:15084840-15084862 CATTGGGAGAGGATGGAGGATGG + Intergenic
1004899648 6:20182522-20182544 CTGAGGGAGAGAATAGAGGAAGG - Intronic
1005138398 6:22598443-22598465 TCATGGGAGTGGATGGAGGTGGG - Intergenic
1005740327 6:28785393-28785415 CTGGGGGAGGGGGTGGAGGGCGG - Intergenic
1005881648 6:30067037-30067059 CTGCGGGTGTGGGTGGAGGAGGG - Intronic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1006088185 6:31611850-31611872 CTTTGGCAGAGGATCGAGGAAGG - Intergenic
1006154634 6:32007602-32007624 CTGAGGGAGCGGCTGGAGGCTGG + Intergenic
1006160946 6:32040337-32040359 CTGAGGGAGCGGCTGGAGGCTGG + Intronic
1006187370 6:32189071-32189093 ATCTGGGAGTGGATGGAGAAAGG + Intronic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007353595 6:41293992-41294014 CACTGAGAGTGGATGGAGGGAGG + Intergenic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1009437649 6:63636195-63636217 GTGTGGAAGGGGATGGGGGAGGG - Intronic
1010485311 6:76404712-76404734 CTGGGGGAGTGGATAGATGTTGG - Intergenic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1011404723 6:87006919-87006941 CGGGGGGAGTGGAAGGAGGCAGG + Intronic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1014229069 6:118882069-118882091 CGTTGGGATTGGGTGGAGGAAGG - Intronic
1015392131 6:132694609-132694631 CTTTGGGAGTCCAAGGAGGAAGG + Intronic
1015484901 6:133758299-133758321 CTGTTGGAGAGGCTGGAGAAAGG - Intergenic
1016013940 6:139165333-139165355 CAGTGGGGGAGGCTGGAGGAGGG - Intronic
1017054833 6:150427406-150427428 CTGAGGGAGGGGAATGAGGAAGG + Intergenic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018287298 6:162254671-162254693 CTCTGGCAGTGGATGAAGGATGG - Intronic
1018476060 6:164142930-164142952 CTGAGGGAGGGTCTGGAGGAAGG + Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019341419 7:510645-510667 CTGTGGTGGTGGATGCAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019707570 7:2503815-2503837 AGCTGGGGGTGGATGGAGGAAGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019778109 7:2924314-2924336 GAGGAGGAGTGGATGGAGGAGGG + Exonic
1019797337 7:3060781-3060803 CTGTTGGAGTGGATGTAAAATGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020388126 7:7630272-7630294 CTGGGGGAGTGGGTGGATGGTGG + Intergenic
1020550746 7:9601184-9601206 AGGTGGGAGTGGATGGACCAAGG + Intergenic
1020901549 7:14009652-14009674 CTGAGGGGCTGGATGGAGGGAGG - Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1023045673 7:36208191-36208213 CTGTGTGACTGGATGGGGGTGGG + Intronic
1023319242 7:38975863-38975885 CTGGGGGTGTGGGTGGAGGTGGG - Intergenic
1023458567 7:40368438-40368460 CTTTGGGAGGGCAAGGAGGAGGG - Intronic
1023875226 7:44283081-44283103 CTGTGGAGGTGGGTGCAGGAAGG - Intronic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024425863 7:49226077-49226099 CTGTGGGAGTTGATGAACGCAGG - Intergenic
1024712262 7:52029430-52029452 GTGTGGGTGTGGATGGATGGTGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026539819 7:71269817-71269839 CTGGGGGAGGTGATGGAAGACGG + Intronic
1026861431 7:73792680-73792702 CTGTGGAACTGCTTGGAGGATGG - Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032400169 7:131619270-131619292 CTGAGGGAGGTGAAGGAGGATGG - Intergenic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033453552 7:141482546-141482568 TTGTGGAGGTGGATGGGGGAAGG - Intergenic
1033457722 7:141517687-141517709 CTGAGGAAGTGGCTGGATGAGGG + Intergenic
1033648288 7:143321558-143321580 CTGTGGGTGGGGCTGGATGATGG - Intronic
1033674728 7:143529094-143529116 CTCTGGAAGTGGATAGAGTAGGG + Intergenic
1033697108 7:143800345-143800367 CTCTGGAAGTGGATAGAGTAGGG - Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034378394 7:150666698-150666720 ATGTGGCAGAGGATGGAGTAAGG - Intergenic
1034499303 7:151439821-151439843 CTGTGCTAGGGGATGCAGGAGGG - Intronic
1034543984 7:151777665-151777687 CTGTGAGGCTGGATGCAGGATGG - Intronic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034896316 7:154878589-154878611 CTGTGGGAGTGGGAGGAGTCAGG - Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1035021606 7:155804021-155804043 CTGGGGGTGGGGTTGGAGGAAGG - Intronic
1035216198 7:157369229-157369251 CTGTGAGGGTTGATGAAGGACGG - Intronic
1035236446 7:157500654-157500676 GTGTGGGAGCGGGTGGAGAAGGG - Intergenic
1035278964 7:157765505-157765527 GTGGGTGAATGGATGGAGGAAGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035969119 8:4227944-4227966 GTGTGGGATTGAATGCAGGATGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1036778306 8:11628606-11628628 CTGTGGGAATGATTGCAGGAAGG + Intergenic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038200536 8:25408903-25408925 CTTTGGGAGTGAGTGGAGGTGGG - Exonic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040570486 8:48605048-48605070 CTGGAGGAGAGGTTGGAGGAGGG + Intergenic
1041368103 8:57130661-57130683 CTGAGGGAGGGGAAGGAGCAGGG - Intergenic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041732259 8:61074723-61074745 TTGTGGGAGTGGGTGGATGGTGG + Intronic
1042104884 8:65315797-65315819 CTGTGGAAGAGGATGGCAGAAGG - Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044748030 8:95390056-95390078 ATCTGGGAGTGGACTGAGGAGGG + Intergenic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1047213955 8:122862195-122862217 TTGTGGGAGTGGCTGAGGGAGGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048296599 8:133219285-133219307 CTGTGGGAGAGGTCTGAGGAGGG - Intronic
1048992291 8:139767541-139767563 ATGTGGGGGTGGAAGGGGGAGGG + Intronic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049347759 8:142147847-142147869 GTGTGGGAGTGCAGAGAGGAAGG - Intergenic
1049576370 8:143391750-143391772 CTGTGGCCTTGGCTGGAGGAGGG - Intergenic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1049654271 8:143790886-143790908 CTGTGCTAGTGGGTGGGGGATGG + Intergenic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1049738432 8:144222300-144222322 TGATGGAAGTGGATGGAGGAGGG + Intronic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051716675 9:19991938-19991960 CTTGGGGACTGGATGGATGAGGG + Intergenic
1052312725 9:27085623-27085645 CTGTGGTAGGGAGTGGAGGAAGG + Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052543533 9:29843289-29843311 CATTGAGAGTGGATGGAGGGAGG + Intergenic
1052959245 9:34280497-34280519 ATGTGGGAGTGGCTGGAGGTAGG + Intronic
1053540110 9:38964952-38964974 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1053804460 9:41787109-41787131 CAGTAGGAGGGGAAGGAGGAAGG + Intergenic
1054140824 9:61528353-61528375 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1054626030 9:67398969-67398991 CAGTAGGAGGGGAAGGAGGAAGG - Intergenic
1055131287 9:72778301-72778323 CATTGAGAGTGGATGGAGGAAGG + Intronic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056670167 9:88620756-88620778 CTGTGGGAGGCTATGGATGAAGG + Intergenic
1057063801 9:92029272-92029294 CTGTGGGAAAGGAAGGAGGCAGG - Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057476956 9:95411283-95411305 CTGTGGGAGTGGGCGGGGGCGGG + Intergenic
1057504257 9:95619708-95619730 CTGAGGGAGTGAATGAAAGAAGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058442130 9:105019196-105019218 TTGGGGAAGTGGGTGGAGGAAGG - Intergenic
1060061675 9:120466310-120466332 CTGAGGGAGTAGATGGAGTTAGG - Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1061853550 9:133429442-133429464 ATGGAGGGGTGGATGGAGGAGGG - Intronic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062433335 9:136535504-136535526 GGGTGGGAGTGGGTGGAGGGGGG + Intronic
1062433412 9:136535714-136535736 GGGTGGGAGTGGGTGGAGGGGGG + Intronic
1062433470 9:136535875-136535897 GGGTGGGAGTGGGTGGAGGGGGG + Intronic
1062445028 9:136590042-136590064 GGATGGGGGTGGATGGAGGACGG - Intergenic
1062445270 9:136591052-136591074 CTGAGTGTGTGGTTGGAGGAAGG + Intergenic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1185479734 X:437475-437497 CTCTGGGAGTGGGTGGGGGGTGG - Intergenic
1185603615 X:1355019-1355041 GAGGGGGAGAGGATGGAGGAAGG + Intronic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185867885 X:3639343-3639365 GGGTGGGGGTGGATGGATGAAGG + Intronic
1185867918 X:3639429-3639451 GGGTGGGGGTGGATGGATGAAGG + Intronic
1185867929 X:3639453-3639475 GTGGGGGGGTGGATGGATGAAGG + Intronic
1186024536 X:5294896-5294918 CTTTGGGAGAGAAAGGAGGAAGG + Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1189106636 X:38243336-38243358 CTGGGGGAGGGGATGGAGAAGGG + Intronic
1189195851 X:39151933-39151955 GTGTGGGAGTGGGTGGTGGGGGG - Intergenic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190763857 X:53459768-53459790 CTGTGGTGCTGGCTGGAGGAGGG + Intergenic
1190984771 X:55490180-55490202 CTCTGGGAGTTGACGGAGGGAGG + Intergenic
1191019423 X:55843221-55843243 CTGGTGGAGTGGATTCAGGAGGG + Intergenic
1192220602 X:69195145-69195167 ATGTGGGACTGGAAGGTGGAGGG + Intergenic
1192656451 X:72999829-72999851 GTGTGAGAGGGGATAGAGGAAGG - Intergenic
1192665669 X:73083172-73083194 GTGTGAGAGGGGATAGAGGAAGG + Intergenic
1192690247 X:73354674-73354696 CGTTGAGAGTGAATGGAGGAAGG - Intergenic
1193588279 X:83355118-83355140 CTGTGGGAGGCCATGGAGGGGGG - Intergenic
1194206623 X:91018718-91018740 CTGTGGGAGTGGTTTCAGGATGG + Intergenic
1194792446 X:98167739-98167761 CAGTGGGAGAGGATGGTGAAAGG + Intergenic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196574550 X:117302733-117302755 CATTGAGAGTGGATGGAGGGAGG - Intergenic
1198074233 X:133179511-133179533 CGGTAGGAGTGGAAGGGGGACGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1199963851 X:152801547-152801569 TTGGGGGAGAGGATGGAAGAGGG + Intergenic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200116010 X:153770012-153770034 CCATGGGAGAGGAAGGAGGACGG - Intronic
1200552371 Y:4593507-4593529 CTGTGGGAGTGGTTTCAGGATGG + Intergenic