ID: 1057172090

View in Genome Browser
Species Human (GRCh38)
Location 9:92969160-92969182
Sequence CGGGTGGCCCAGAATCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057172090_1057172103 11 Left 1057172090 9:92969160-92969182 CCCTCATGATTCTGGGCCACCCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1057172103 9:92969194-92969216 CGGCTCTTGCCCACAGGGCTGGG No data
1057172090_1057172101 6 Left 1057172090 9:92969160-92969182 CCCTCATGATTCTGGGCCACCCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1057172101 9:92969189-92969211 GCGGGCGGCTCTTGCCCACAGGG No data
1057172090_1057172102 10 Left 1057172090 9:92969160-92969182 CCCTCATGATTCTGGGCCACCCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1057172102 9:92969193-92969215 GCGGCTCTTGCCCACAGGGCTGG No data
1057172090_1057172096 -9 Left 1057172090 9:92969160-92969182 CCCTCATGATTCTGGGCCACCCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1057172096 9:92969174-92969196 GGCCACCCGGGTGCAGCGGGCGG No data
1057172090_1057172106 26 Left 1057172090 9:92969160-92969182 CCCTCATGATTCTGGGCCACCCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1057172106 9:92969209-92969231 GGGCTGGGACCCATTGCATAAGG No data
1057172090_1057172100 5 Left 1057172090 9:92969160-92969182 CCCTCATGATTCTGGGCCACCCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1057172100 9:92969188-92969210 AGCGGGCGGCTCTTGCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057172090 Original CRISPR CGGGTGGCCCAGAATCATGA GGG (reversed) Intronic
906745570 1:48219942-48219964 CGGATGACCCAGAGTCATCAAGG - Intergenic
907522183 1:55031193-55031215 CGGAGGTCTCAGAATCATGACGG - Intergenic
912074813 1:105860763-105860785 CAGGTAGCTCAGAATCATGGTGG + Intergenic
912658660 1:111509348-111509370 TGGGTGGCCAAGAGACATGAGGG - Intronic
919626900 1:199919952-199919974 GGGGTGCCTCACAATCATGATGG + Intergenic
920675318 1:208034227-208034249 GGAGTGGCCCAGAACCAGGAAGG - Intronic
920935084 1:210425120-210425142 CATGTGGCCAAGAATCATGTGGG - Intronic
1068354671 10:55896448-55896470 GGGAGGGCTCAGAATCATGATGG + Intergenic
1068400164 10:56518198-56518220 AGGGGGGCTCAGAATCATGGTGG + Intergenic
1069841050 10:71339702-71339724 CGGCTGGCACAAAAGCATGAAGG - Intronic
1072631037 10:97146630-97146652 CTTGTGGTCCAGAAACATGAAGG - Intronic
1072681790 10:97512880-97512902 AGGGTGGGCCAGACACATGAAGG - Intronic
1085050961 11:73380051-73380073 CAGGTGGCCCACAACAATGAAGG - Intronic
1085316702 11:75549411-75549433 CTGGTGGCCCAGTGTCATCAGGG + Intergenic
1087749169 11:101987580-101987602 CGGGTGGCCCAGCTTTATGGTGG - Intronic
1091832660 12:3560992-3561014 TGTGTGGCCAAGAATCATCAAGG - Intronic
1098989201 12:77046244-77046266 CGGGTGGCTAAGAATCAGTATGG - Exonic
1101631160 12:106496309-106496331 GGAGTGGCCCAGAATCGTTAGGG - Intronic
1105967318 13:25396603-25396625 CGGGTAGCCTGCAATCATGAGGG + Intronic
1107483728 13:40806761-40806783 CTGGTTGCCCTCAATCATGAAGG + Intronic
1109076896 13:57846945-57846967 CGTGAGCCTCAGAATCATGATGG + Intergenic
1111641574 13:90977004-90977026 CTGGTGGCGCAGACTCATGAGGG - Intergenic
1111929564 13:94499758-94499780 AGGGTTGGCCAGAGTCATGAGGG - Intergenic
1119261650 14:73241309-73241331 CTGGTGGCCCAGCTGCATGAAGG + Intronic
1123203527 14:106691417-106691439 CAGGGGGCACAGAATCACGAGGG - Intergenic
1128112193 15:65083651-65083673 CAGCTGGGGCAGAATCATGAGGG - Intergenic
1130060773 15:80568471-80568493 CAGAATGCCCAGAATCATGACGG + Intronic
1148579911 17:48736349-48736371 TGGCTGGCCCAGAACCTTGAGGG - Intergenic
1156507318 18:37606157-37606179 GGGGAGGCCCACAATCATGGTGG - Intergenic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1157957880 18:52119200-52119222 CTGGGAGGCCAGAATCATGAAGG - Intergenic
1158415179 18:57244043-57244065 GGAGTGGCACAGAAGCATGATGG - Intergenic
1161764018 19:6196541-6196563 CCCGTGGCCCAGAGCCATGATGG - Intronic
1162814289 19:13183897-13183919 CGGGTGCCTCAGAATCCTGCAGG - Intergenic
1162876413 19:13624029-13624051 AGGGTGGCCCAGAGACAGGAGGG + Intergenic
1163034492 19:14563148-14563170 CGGGGAGCCCAGACTCAGGATGG - Intronic
1166046076 19:40231998-40232020 TGGGTAGCCCAGAATGAGGAGGG - Exonic
925377936 2:3401394-3401416 AGGGAGGCCCAGGAGCATGAAGG - Intronic
929234308 2:39590270-39590292 AGGCTGGCCCAGAGTCAAGATGG + Intergenic
935359001 2:102231883-102231905 CTGGTGGGCCTGAATCAAGAGGG + Intronic
946694649 2:222342471-222342493 CGGAAGCCCCACAATCATGATGG + Intergenic
948009002 2:234635791-234635813 GGGGAGGCCCACAATCATGGTGG - Intergenic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1170934429 20:20797249-20797271 TGGGTGGTCCGGAATAATGAAGG + Intergenic
1181476106 22:23168722-23168744 CTGGTGGCCCTGAATACTGAGGG - Intergenic
949875311 3:8622881-8622903 TGGCTGGCCCAGGATCATGTTGG + Intronic
950293397 3:11806079-11806101 GGGGTGTCTCAGAATCATGGCGG - Intronic
950435766 3:12978896-12978918 CGGGTGGCCCAGCAGGATAAAGG + Intronic
950800617 3:15549306-15549328 GGGGAGGCTCAGAATCATGGTGG - Intergenic
954465402 3:50651538-50651560 CGGCTGGCCCAGACTCCTCATGG - Intergenic
956107895 3:65840697-65840719 GGGGTGGCCTAGATTCATGAGGG + Intronic
957642549 3:82875429-82875451 AGGGTGGCCCAGTGTCAAGATGG + Intergenic
959052347 3:101536314-101536336 GAGGTGGCCCCCAATCATGAGGG + Intergenic
959237628 3:103745266-103745288 TGAGTGGCCCAGAATCTTCAGGG - Intergenic
960812371 3:121637050-121637072 CGGGTGCCCCAGAATACAGAGGG - Intronic
960967720 3:123116694-123116716 GGGGTGGACCAGAAGCATAAAGG + Intronic
961436000 3:126916997-126917019 CAAGTGGCCCACCATCATGAGGG + Intronic
969849143 4:9943029-9943051 CTGGTGCCCCAGGATCCTGAGGG - Intronic
975186394 4:71409057-71409079 TGGGAGGCCCAGAATCATGGAGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979599063 4:122566616-122566638 TGGGAGGCCCACAATCATGGTGG - Intergenic
985500693 5:242772-242794 CGGGTAGCTCAGAAGCATCAGGG + Intronic
989492700 5:42076636-42076658 CTGGTGGCACAGGATCATGAGGG - Intergenic
990371620 5:55124969-55124991 CGGGTAGCCCAGCATCATGTTGG - Exonic
995061426 5:107815098-107815120 AGAGTGGCCCAGAATAAGGAAGG + Intergenic
996471690 5:123868452-123868474 CAGCTGGCCCAGACTCATAAAGG + Intergenic
997847577 5:137301953-137301975 CAGGTGGCCCATAATGCTGAGGG + Intronic
1002015071 5:176314740-176314762 CAGATGGCCCTGACTCATGATGG + Intronic
1013100145 6:106979376-106979398 AGGGTGGCACAGAATTAAGAGGG - Intergenic
1016042796 6:139449258-139449280 TGGGTAGCCCAGACTCATGTGGG - Intergenic
1017649646 6:156569064-156569086 CAGCTGGCCCAGAGTCAAGACGG + Intergenic
1035331868 7:158101844-158101866 AGGGTGGGCCAGAATGAAGAAGG - Intronic
1040595583 8:48834800-48834822 CGGGTGGCCCCTCATCAGGAGGG + Intergenic
1040948833 8:52915308-52915330 CAGTTGGCCAAGAATGATGATGG + Intergenic
1048091669 8:131247835-131247857 AGGGAGGCTCAGAATCATGGCGG - Intergenic
1055726613 9:79237123-79237145 CTGGTGGCCCAAAAACATGCAGG + Intergenic
1056498983 9:87189611-87189633 CGTGTGCCCCAGAATCTTCAGGG - Intergenic
1057172090 9:92969160-92969182 CGGGTGGCCCAGAATCATGAGGG - Intronic
1189920577 X:45899682-45899704 GGGGTGGCCCAGAATCTTCATGG + Intergenic
1195246303 X:102998631-102998653 CCGGTGGCCCAGAATGGTCAGGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic