ID: 1057179670

View in Genome Browser
Species Human (GRCh38)
Location 9:93022983-93023005
Sequence CAGATTAAACGGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057179670_1057179678 -3 Left 1057179670 9:93022983-93023005 CCTGCCTCCCTCCGTTTAATCTG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1057179678 9:93023003-93023025 CTGGGAAGTTAAAGAGGATGAGG No data
1057179670_1057179680 18 Left 1057179670 9:93022983-93023005 CCTGCCTCCCTCCGTTTAATCTG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1057179680 9:93023024-93023046 GGGCCAAGAGCATCTGTACCTGG No data
1057179670_1057179679 -2 Left 1057179670 9:93022983-93023005 CCTGCCTCCCTCCGTTTAATCTG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1057179679 9:93023004-93023026 TGGGAAGTTAAAGAGGATGAGGG No data
1057179670_1057179677 -9 Left 1057179670 9:93022983-93023005 CCTGCCTCCCTCCGTTTAATCTG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1057179677 9:93022997-93023019 TTTAATCTGGGAAGTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057179670 Original CRISPR CAGATTAAACGGAGGGAGGC AGG (reversed) Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
903906420 1:26690711-26690733 CAGACAAAATGGAGGGAGGCAGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906112272 1:43331977-43331999 CAGAGAAAACGGAGGAGGGCCGG - Intergenic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
906864614 1:49403962-49403984 CAGATAAATGGGAGGGAGACAGG - Intronic
907903452 1:58762693-58762715 CAGAGTACATGGGGGGAGGCCGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909519904 1:76555680-76555702 CAGGTGTAAAGGAGGGAGGCAGG + Intronic
910601868 1:89040989-89041011 AAGATGAAAAGGAGGGAGGGAGG + Intergenic
912555550 1:110513641-110513663 CAGAGAAAAAGGAGAGAGGCGGG - Intergenic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
920544934 1:206808591-206808613 CAGAGTAAATGGAGTGAGGTGGG + Intronic
921898426 1:220424770-220424792 CAGACTAAAAGGAGGGAAGTTGG - Intergenic
922654137 1:227366070-227366092 CATATAAGAGGGAGGGAGGCAGG - Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
924429275 1:243982938-243982960 CAGATACAACGGAGGGAAACGGG + Intergenic
1063575906 10:7261869-7261891 CAGATTCAAAGTAGGGTGGCTGG + Intronic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1065725930 10:28668061-28668083 CAGATTAAAGGATGGGAGGAAGG - Intergenic
1066417922 10:35238378-35238400 CGGATTTCACGGAGAGAGGCCGG + Intergenic
1067257723 10:44660775-44660797 GAAATTAACCAGAGGGAGGCGGG + Intergenic
1070358027 10:75659339-75659361 GAGAGGAAAGGGAGGGAGGCAGG - Intronic
1072449735 10:95530447-95530469 TTCAATAAACGGAGGGAGGCAGG + Intronic
1073065987 10:100759476-100759498 CAGCCAAAAGGGAGGGAGGCAGG + Intronic
1073176255 10:101559420-101559442 CGGGTTAAGTGGAGGGAGGCAGG - Intergenic
1073461871 10:103670481-103670503 CTGATTGAACCCAGGGAGGCAGG - Intronic
1074198259 10:111208095-111208117 CAGATGACATGGAGGAAGGCTGG + Intergenic
1076981988 11:209449-209471 CAGATGACACGGTGGGAGGGTGG - Exonic
1079140077 11:17802745-17802767 CTGATTGAAGGGAGGGAGGGAGG - Intronic
1080075510 11:28142953-28142975 CAGTTTAAATGGAGAGAGGTGGG + Intronic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082760581 11:57123537-57123559 CAGATTATACGGTGGGAGCTGGG + Intergenic
1082933720 11:58635301-58635323 CTGATTAAGAGGAGGAAGGCAGG + Intergenic
1083457369 11:62787844-62787866 CTGATTTAACGGATGGACGCAGG - Intronic
1083949438 11:65945929-65945951 CAGATGAAACTCAGGGAGGCAGG + Intronic
1085442647 11:76578278-76578300 CAGATGAAGCGGAGGGTCGCAGG - Intergenic
1086018062 11:82191602-82191624 CATAGTAAAGGGAGGGAGCCAGG + Intergenic
1086048983 11:82566945-82566967 AAGATGAAAGGGAGGGAGGGAGG + Intergenic
1088831139 11:113538006-113538028 CAGATAATACGGAGGCAGGTGGG - Intergenic
1092118774 12:6029044-6029066 CAAAATAAAGGGAGGGAGGAAGG + Intronic
1092759921 12:11800559-11800581 CAGAGTAAAAGAAGGGATGCGGG - Intronic
1092961017 12:13597166-13597188 AAGATTAAAAGTAGTGAGGCAGG + Intronic
1096526561 12:52213437-52213459 CAGCTTGAACTCAGGGAGGCGGG - Intergenic
1097450250 12:59729415-59729437 CAGAATAAAGAGAGAGAGGCAGG - Intronic
1098160655 12:67645983-67646005 CAGATAACAAGGAGGTAGGCAGG - Intergenic
1098842470 12:75493091-75493113 CAGATGAAACGGGGGGAGGAAGG + Exonic
1100816659 12:98393290-98393312 TACATTAAAAGGAGGGACGCAGG + Intergenic
1102543172 12:113637003-113637025 CAGATGACTCGGAGAGAGGCTGG - Intergenic
1103038199 12:117673318-117673340 CAGATAAAAGGAAGGGAGGATGG + Intronic
1105359379 13:19692868-19692890 CAAATTCAATGTAGGGAGGCTGG + Intronic
1107299302 13:38948375-38948397 AAGATTAAACATAGGAAGGCAGG + Intergenic
1108470983 13:50766708-50766730 CAGTTTAAACTCAGGCAGGCAGG + Intronic
1110744434 13:79036383-79036405 AAGAAAAAAGGGAGGGAGGCAGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1127229493 15:56973166-56973188 CAGATGGGAGGGAGGGAGGCGGG - Intronic
1127412617 15:58724319-58724341 CAGATTCTAGGGTGGGAGGCAGG + Intronic
1127446362 15:59067223-59067245 AAAAGGAAACGGAGGGAGGCAGG - Intronic
1128076569 15:64830174-64830196 CAGACTAAACCAAGGAAGGCAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1129848436 15:78778637-78778659 CAGAAACAATGGAGGGAGGCAGG + Intronic
1129907810 15:79201806-79201828 CATATGAAATGGAGGCAGGCAGG + Intergenic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1133547878 16:6825708-6825730 AAGAGGAAAGGGAGGGAGGCAGG + Intronic
1133937495 16:10281055-10281077 CAGATTAAAGGAAGTTAGGCAGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1138264170 16:55647547-55647569 AAGAAGAAACGGAGGGAGGGAGG + Intergenic
1139447354 16:67006028-67006050 CAGGTTAAAGGGGGGGGGGCTGG + Intronic
1142008200 16:87700451-87700473 CAGATAAGGCGGAGGGAGGAGGG + Intronic
1142284092 16:89164619-89164641 GAGATTAAACGCGGGGAGACTGG + Intergenic
1143973840 17:10815489-10815511 CAGATGAAAGGGAGCGGGGCTGG - Intergenic
1146617576 17:34369235-34369257 CAGATTGAAAGGAGGCAGCCAGG + Intergenic
1148457906 17:47820853-47820875 GAGATTAATTGGTGGGAGGCTGG - Intronic
1148624134 17:49055955-49055977 CAGATTAAAGGATGGGAGGAAGG - Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150498764 17:65630078-65630100 CAGATTAAAGAAAGGTAGGCCGG + Intronic
1152042941 17:77916786-77916808 CAGATTAGAGGGAGGGAGACAGG + Intergenic
1152137561 17:78513730-78513752 CAGATTAAATAGAGGAAAGCCGG - Intronic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1152663389 17:81553186-81553208 CTTCTTAAACGGAGGGAGGCGGG - Intronic
1158101202 18:53832235-53832257 CAAAATAAACGGATGGAGGAAGG - Intergenic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1163630863 19:18417408-18417430 GAGATTAAACTGGGGGTGGCAGG + Intergenic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1166818248 19:45560173-45560195 CAGATGAAAGGGAGTGAGTCTGG - Intronic
1167157882 19:47750417-47750439 CAGATTAGAGGGAGGGAGTCTGG + Intronic
1167717151 19:51150823-51150845 GTGATTAGACAGAGGGAGGCAGG + Intronic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927486712 2:23492941-23492963 CAGCTGCAACGGAGAGAGGCAGG - Intronic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
933084871 2:78043637-78043659 CAGACAGAACGGAGAGAGGCAGG - Intergenic
937028158 2:118716438-118716460 CAGATGAAAGGGAGGGAGAATGG - Intergenic
938089981 2:128425079-128425101 CAGATAAAATGAAGGGAGGGCGG + Intergenic
938931393 2:136089352-136089374 CAGAAGAAACGAAGGTAGGCAGG - Intergenic
939299738 2:140320073-140320095 TAGATTAAATGGAAGGAGGGAGG - Intronic
939579369 2:143930169-143930191 AATATCAAAGGGAGGGAGGCTGG + Intergenic
940321811 2:152385326-152385348 CAGTTTGTAGGGAGGGAGGCTGG + Intronic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
947671526 2:231939581-231939603 CAGATTAAACCCAGGTGGGCTGG + Intergenic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1169357872 20:4923235-4923257 CATCTTGAAGGGAGGGAGGCAGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1175221224 20:57417583-57417605 AAGATGAAATGGAGGGAGGGAGG + Intergenic
1178300053 21:31445322-31445344 CGTATTAAACAGAGTGAGGCTGG - Intronic
1179261659 21:39763437-39763459 GAGATGAAAAGGAGGGAGGAGGG - Intronic
1179876475 21:44271522-44271544 CAGATTAAACAGTGGCACGCTGG + Intergenic
1181375568 22:22455164-22455186 CAGAGGGAACGGAGGGAGCCAGG + Intergenic
949263305 3:2127388-2127410 CAAATTAAGTGGAGGGAGGGAGG + Intronic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
951230590 3:20174084-20174106 CTGATTAAACAGTGGGGGGCTGG - Intronic
951948884 3:28175734-28175756 CAGTTCAAATGGATGGAGGCTGG - Intergenic
954945243 3:54418393-54418415 CTGATTAAGAGGAGGAAGGCTGG + Intronic
955205823 3:56895087-56895109 CAAATTACAGGGAGGGAGGGAGG - Intronic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
957157564 3:76564975-76564997 AAGATGAAAAAGAGGGAGGCTGG + Intronic
957945338 3:87056695-87056717 CATATTACACGGATGGCGGCAGG + Intergenic
962616778 3:137134585-137134607 CTGATTAAACAAAGGGAGCCGGG - Intergenic
964120700 3:153180310-153180332 GAGAATAAAGGGAGGGAGGGAGG - Intergenic
966836030 3:184050147-184050169 CAGCTTAAAAGGAGGGACGTTGG - Intergenic
967096756 3:186183564-186183586 CAGATTCCAAGGATGGAGGCTGG - Intronic
968084668 3:195868940-195868962 CAGCTTAGACGGAGCGAGGCGGG - Intronic
969387779 4:6867312-6867334 CAGAGTAGAAGGACGGAGGCAGG + Intronic
971116325 4:23650018-23650040 CTGATTCAAGGGAGGGAGTCAGG - Intergenic
971414637 4:26413058-26413080 CGGATTTAACTGAGGGAGGAGGG - Intronic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
973547483 4:51996092-51996114 CAGATGAATGGGAGGAAGGCGGG + Exonic
976381808 4:84407974-84407996 CAGATTAAATGGATGAAGGATGG + Intergenic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
980064252 4:128166403-128166425 CAGAATGAAAGGAGGGAGACAGG - Intronic
981253617 4:142634025-142634047 CAGATAAAAAGGAGGGAGGTGGG + Intronic
986536075 5:8788795-8788817 CAAATAAAAAGGAGGGAGGGAGG - Intergenic
987890289 5:23867667-23867689 AAGATGAAAAGGAGGGAGGGAGG - Intergenic
994900736 5:105765330-105765352 CAGATTACAGGGAGAGAGGTGGG + Intergenic
994987150 5:106950787-106950809 CAGAATAAAAGGAGAAAGGCGGG - Intergenic
999618203 5:153447815-153447837 CAGATTAAAAAGAGGGGGCCGGG - Intergenic
1001493061 5:172169081-172169103 CTGATTAAACGCAGGTAGGGAGG - Intronic
1003775330 6:9354306-9354328 CAGAGACAAAGGAGGGAGGCAGG + Intergenic
1005584149 6:27259827-27259849 CAAATTCAGAGGAGGGAGGCAGG - Intergenic
1006373784 6:33660515-33660537 CAGATTTAAGGGAGGGAGGGAGG - Intronic
1006428095 6:33978668-33978690 GAGATTAGACGTGGGGAGGCGGG + Intergenic
1006883609 6:37360989-37361011 CAGATTGAAAGGAGTGAGGAAGG - Intronic
1007044843 6:38762576-38762598 CAGAATAAATGGAGGGTGGGGGG + Intronic
1008018660 6:46550689-46550711 CAGATAAAGCGAAGGGTGGCAGG - Intronic
1012978477 6:105805268-105805290 CAGATTGGAGGGCGGGAGGCTGG + Intergenic
1013820200 6:114145534-114145556 CTGATTAGAAGGAGGGAGTCTGG + Intronic
1014490604 6:122057197-122057219 CAGATAAAGGGGAGAGAGGCAGG + Intergenic
1016395772 6:143621934-143621956 CAGATTAGAAGGAGGGAGATGGG - Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1028519311 7:91712250-91712272 CAGACAAAAAAGAGGGAGGCTGG + Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1029273547 7:99391340-99391362 AAGAAAAAAAGGAGGGAGGCAGG - Intronic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1037170693 8:15887886-15887908 CAGAGAAAATGGAGGGAGGGAGG + Intergenic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1041225935 8:55698085-55698107 CAGATTACACTGAGAGAGTCTGG - Intronic
1042117890 8:65452123-65452145 TAGAATAAAAGGAGGGAGGAAGG - Intergenic
1043441886 8:80283607-80283629 TAGATTTAAAGGAGGGAGGCCGG + Intergenic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1049245015 8:141557770-141557792 CGGGTTAAGTGGAGGGAGGCGGG + Intergenic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057329858 9:94103836-94103858 CATATGATATGGAGGGAGGCAGG - Intronic
1057820199 9:98324193-98324215 CAGCTCACACGGAGGAAGGCAGG + Intronic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1060212590 9:121719636-121719658 CAGATTAGACTGGGGGAGGGAGG + Intronic
1061628602 9:131857064-131857086 GAGATGAACCTGAGGGAGGCCGG - Intergenic
1185524937 X:770325-770347 AAGATAAAAGGGAGGGAGGGAGG + Intergenic
1185561955 X:1066753-1066775 GAGATGAAACGGGGGGTGGCGGG + Intergenic
1185610929 X:1393106-1393128 CGGAGAAAAAGGAGGGAGGCGGG - Intergenic
1188922530 X:35995112-35995134 CAGATTAAAAGGATGGAAGCGGG + Intergenic
1189153422 X:38730453-38730475 CAGTTTACACAGAGAGAGGCAGG - Intergenic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1199699749 X:150366176-150366198 CAGATTAAATGGAAGTAGGAGGG - Intronic
1200052392 X:153441582-153441604 CAGATTAAACTGAAGAATGCTGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic