ID: 1057180654

View in Genome Browser
Species Human (GRCh38)
Location 9:93028140-93028162
Sequence CAGGCTGAGGTTTCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 1, 2: 5, 3: 39, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057180654_1057180658 -8 Left 1057180654 9:93028140-93028162 CCAGCTCCAGAAACCTCAGCCTG 0: 1
1: 1
2: 5
3: 39
4: 331
Right 1057180658 9:93028155-93028177 TCAGCCTGGTGCTGTTCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057180654 Original CRISPR CAGGCTGAGGTTTCTGGAGC TGG (reversed) Intronic
900499183 1:2991836-2991858 CAGGCTGCTGTTTCTGGACCTGG - Intergenic
902390166 1:16099087-16099109 CAGGTGGAGGTTACTGGAGGGGG - Intergenic
902840355 1:19070349-19070371 CAGGCTGAGCTCCCTGGAGCTGG - Intergenic
903266536 1:22161255-22161277 CAGGCTCAGGCCTTTGGAGCAGG - Intergenic
905858388 1:41330077-41330099 CAGATTCAGGTTTCTGGACCAGG + Intergenic
905905475 1:41615378-41615400 CAGGCTGAGGGTTCTCCAGGTGG - Intronic
909477403 1:76096032-76096054 CAGGCAGAGATTGCAGGAGCTGG + Intronic
912414807 1:109500735-109500757 CAGCCTGAAGTTCCTGGAGCTGG + Intronic
915790851 1:158669384-158669406 TAGGCAGAGTTTTCAGGAGCTGG - Intronic
916709187 1:167387194-167387216 CAGCCTGAGGTTTCTGGAGCTGG + Intronic
917278088 1:173352203-173352225 CAGGCAGAGTTCTCAGGAGCGGG + Intergenic
918283099 1:183024105-183024127 CAGCGTGAGGTTGATGGAGCTGG - Exonic
920202620 1:204269027-204269049 CAGGTGGAGGGTGCTGGAGCCGG - Intronic
920250145 1:204617971-204617993 CAGCCTGGGCTTTCTGGGGCTGG - Exonic
920594826 1:207258862-207258884 CATGCTGAGCTGTCTGGAGCTGG + Intergenic
920972028 1:210751065-210751087 TAGGCAGAGCTTTCTGGAGGAGG + Intronic
921030112 1:211328970-211328992 CAGGGTGAGGGGCCTGGAGCAGG - Intronic
924508118 1:244704991-244705013 CAGGCTGTTTTTTCTGGACCAGG + Intronic
1062899481 10:1131564-1131586 CAGGCAGAGCTCTCAGGAGCCGG + Exonic
1062988381 10:1791114-1791136 CTGCCTGAGGTTTATTGAGCAGG - Intergenic
1063835183 10:10004180-10004202 CATGTGGAGGTTTCTGGAGGGGG - Intergenic
1063868885 10:10397107-10397129 GATGTTGGGGTTTCTGGAGCAGG - Intergenic
1064153392 10:12884235-12884257 CAGGCTGAGGGTTAAGGAACAGG + Intergenic
1064218745 10:13421519-13421541 CAGTCTGTGGTTTCTGGATTTGG + Intergenic
1066455454 10:35568180-35568202 CAGGCCGAGGTTGGTGGAGTTGG + Intronic
1068164382 10:53309329-53309351 CAGGCTGAAGTTTCTGAAACAGG - Intergenic
1069391845 10:67944232-67944254 TATGCTGAGCTCTCTGGAGCTGG - Intronic
1069719375 10:70539777-70539799 CAGGCTGAGGCCTCTGGGGAGGG + Intronic
1069862043 10:71477586-71477608 CTGGAGGAGGTTTTTGGAGCTGG - Intronic
1070947010 10:80400744-80400766 CAAGCTGAGGTTGGTGAAGCAGG - Intergenic
1073456082 10:103637553-103637575 CTGGCTGAGGGTTCTGGAAGTGG - Intronic
1075446685 10:122518229-122518251 GAGGCTGAGGAGTCTGGAGCAGG + Intergenic
1075626112 10:123965585-123965607 CAGGCTGGGGTGTCTGCCGCTGG - Intergenic
1076126707 10:127979844-127979866 CATGCAGAAGTTTCTGGAGCAGG - Intronic
1076250489 10:128980440-128980462 GTGGCTGAGCTGTCTGGAGCGGG + Intergenic
1076273686 10:129178413-129178435 CAGGCAGGGGCTTCCGGAGCAGG - Intergenic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076562079 10:131373603-131373625 CAGGCAGAGGCTGCTGGAGCTGG - Intergenic
1076602385 10:131667207-131667229 CAGGCTGAGGCTTGTGGGGAGGG + Intergenic
1076618674 10:131772985-131773007 CAAGCTGAGGTCTCAGGGGCCGG - Intergenic
1076644085 10:131939649-131939671 CCTGCTGTGTTTTCTGGAGCAGG - Intronic
1079130554 11:17744649-17744671 CAGGCTGTGGGGTCTGGAGCAGG + Intronic
1079572917 11:21966938-21966960 CTGGCTGAGCTATCTGGACCTGG + Intergenic
1082071415 11:47942742-47942764 TAGGCTGAGGTCACTTGAGCTGG + Intergenic
1083162678 11:60864974-60864996 CAGGCTGAGGGTGCTGGCGAGGG - Intergenic
1083942326 11:65903126-65903148 CAGGGTGATGTTTCTGGAGCAGG - Intergenic
1084043187 11:66554526-66554548 TTGGCTGAGGTTTCTGGGTCGGG - Exonic
1084063092 11:66688226-66688248 CTGGCTGTGGGTTCGGGAGCAGG + Exonic
1084106513 11:66984225-66984247 CAGGGTGAGGTGACTGGAGGAGG + Intergenic
1084943347 11:72625962-72625984 CGGGCTGAGGTTGCTCCAGCCGG - Intronic
1087810771 11:102607366-102607388 CAGGCTCATTCTTCTGGAGCTGG - Intronic
1088631222 11:111775559-111775581 CAGGCTGTGGTTACTGGAAGTGG + Intergenic
1090067020 11:123511693-123511715 AAGGCTCAGACTTCTGGAGCAGG + Intergenic
1090359110 11:126160467-126160489 GAGGCTGATGTTCCTGCAGCTGG + Intergenic
1091442361 12:521355-521377 CACACTGAGGTGTCTGGAGCCGG + Intronic
1091893752 12:4083765-4083787 CAACTTGAGGTTTCTGCAGCAGG + Intergenic
1094601084 12:31909509-31909531 TAGGGTGATGTTTCTGGGGCTGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096837047 12:54357672-54357694 CAGGCTGTGGTCTGTGGAGGTGG + Intergenic
1096938791 12:55317274-55317296 AAGGATGATGTTGCTGGAGCTGG + Intergenic
1099186610 12:79521905-79521927 CAGCCTGAGGTAACTGGGGCAGG + Intergenic
1101835527 12:108292378-108292400 CAGGCTGAAGTTGTTGAAGCAGG + Exonic
1101984292 12:109433607-109433629 CAGGCAGAGCTCTCTGGAGTGGG - Intronic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1103459086 12:121089626-121089648 CAGACTGACCTTTCTGGGGCTGG - Intergenic
1104071641 12:125350905-125350927 CATGCTGAGCTTTCTTAAGCAGG + Intronic
1104836933 12:131797708-131797730 CAGGCTGCCGTGGCTGGAGCAGG + Intronic
1104964828 12:132504154-132504176 CTTGCTGTGGTTTCAGGAGCAGG + Intronic
1105014433 12:132777494-132777516 GAGGCTCAGGATTCTGGAGACGG + Intronic
1105995208 13:25664580-25664602 CGGGCAGTGGTTACTGGAGCTGG + Intronic
1107312448 13:39093709-39093731 CTGGCTGGGGTTTCTGGAAAAGG + Intergenic
1107456364 13:40559508-40559530 CAGGCTGAGGGTTAGTGAGCAGG - Exonic
1107624580 13:42270394-42270416 TAGGCTGATGTTTCTGGGGCTGG - Intergenic
1107979507 13:45720992-45721014 CAGGGTCAGGCTTCTGGAGATGG + Intergenic
1110375364 13:74787279-74787301 CAGGATGAGGTGACTGTAGCTGG - Intergenic
1111303342 13:86373524-86373546 CATGCTGAGCTGTCTGGAGCTGG + Intergenic
1111610987 13:90606412-90606434 CAGGGTGTGGTTTCTTGAGTAGG - Intergenic
1113227695 13:108176989-108177011 CAGTTTTAGGTTTCTGGTGCTGG - Intergenic
1113412297 13:110100960-110100982 CTGGTTGAGGTTTGTGAAGCAGG - Intergenic
1114083057 14:19218396-19218418 CAGGCTGAGGGAACAGGAGCAGG + Intergenic
1114317594 14:21522871-21522893 CAGGCAGGGCTTTCTTGAGCGGG - Exonic
1117071715 14:52063405-52063427 CAGGCTCTGGTTTCTGCAGAGGG - Intronic
1118311616 14:64697733-64697755 CAGTTTGAGGTTTCTTAAGCTGG + Intergenic
1119684831 14:76623300-76623322 CAGGTTGAGGTTTCCAGAGCTGG - Intergenic
1120841964 14:89094096-89094118 GAGGCTAAAGTTTATGGAGCAGG - Intergenic
1121013771 14:90536176-90536198 CAGGGTGAGCTTCCTGGAGGAGG - Exonic
1121358651 14:93235249-93235271 CAGGGTGAGGCTTCTGAAGTTGG - Intergenic
1121509648 14:94502865-94502887 CAGGAAGGGGTTTCTGGGGCAGG - Intronic
1121564288 14:94896899-94896921 CAGGTTGAGGGTTCTGGTGGGGG - Intergenic
1122217028 14:100211546-100211568 CAGGCTGAGGCACCTGGGGCTGG - Intergenic
1123007233 14:105329822-105329844 GAGGGTGAGGTCTCTGCAGCGGG + Intronic
1202894682 14_GL000194v1_random:164-186 CAGGCTGAGGGAACAGGAGCAGG + Intergenic
1125569546 15:40705501-40705523 CAGTCTGCGGTTGATGGAGCAGG + Intronic
1127260604 15:57323956-57323978 CAGGCAGAGTTTCCTGGAGGAGG + Intergenic
1128229399 15:66024277-66024299 CAGGTTCAGAATTCTGGAGCTGG - Intronic
1130305558 15:82710237-82710259 CAGGCTGGGGGTTCTAGAGCGGG + Intergenic
1131228796 15:90645958-90645980 CGGGCTGAGCTTTCTGTTGCTGG + Intergenic
1133008822 16:2898919-2898941 CAGGCAGAGGCTTCTGGCCCTGG + Intronic
1133021273 16:2967937-2967959 CAGGCTGAGGGTTCTGCCGCGGG + Exonic
1133841791 16:9416710-9416732 CAGGGTGAGGCTTCTGTATCAGG + Intergenic
1134549547 16:15132555-15132577 AAGGCTGAGGCTACTGAAGCAGG + Intronic
1134718921 16:16370442-16370464 AAGGCTGAGGCTACTGAAGCAGG - Intergenic
1134955835 16:18381717-18381739 AAGGCTGAGGCTACTGAAGCAGG + Intergenic
1135121712 16:19771862-19771884 GAGGCAGAGGTTTATGGAGGAGG + Intronic
1136929507 16:34406648-34406670 TAGTCTGTGGTTTCTGGAGTTGG - Intergenic
1136975067 16:35005156-35005178 TAGTCTGTGGTTTCTGGAGTTGG + Intergenic
1137463842 16:48690194-48690216 AAGGCTTAGGATACTGGAGCTGG - Intergenic
1138418825 16:56886429-56886451 CAGGCTGAGGTTCCGGGTGAAGG - Exonic
1138928141 16:61617307-61617329 CAGGTTGAGGATTCAGGAACCGG + Intergenic
1139367998 16:66445626-66445648 CAGGCAGAGGATTCTGAATCAGG + Intronic
1139477426 16:67209705-67209727 GAGGATGAGTGTTCTGGAGCTGG - Intronic
1140048002 16:71455264-71455286 CTGGCTGAGGTTTCTTGTGAGGG - Intronic
1140476072 16:75239785-75239807 CAGGCTGGGGTGCCTGGAGCTGG - Intronic
1141744021 16:85913900-85913922 CAGGCCCAGGCTTCTGCAGCCGG + Intronic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1142567460 17:849930-849952 CAGCCTGGGGTTTCAGGAGCAGG - Intronic
1142688851 17:1592839-1592861 CAGGCTGGGGGTTGGGGAGCAGG + Intronic
1145282485 17:21478083-21478105 CAGGCTGAGGGAACAGGAGCAGG - Intergenic
1145812159 17:27770975-27770997 CAGGCTGAGCTGCCTGGAGGAGG - Exonic
1146842189 17:36163858-36163880 TAGGCTGAGCTTCCTGGAGGAGG - Intergenic
1146866121 17:36336559-36336581 TAGGCTGAGCTTCCTGGAGGAGG + Intronic
1146877756 17:36426790-36426812 TAGGCTGAGCTTCCTGGAGGAGG - Intronic
1148714454 17:49705990-49706012 GAGGCTGAGGTCTCTGGTGCAGG - Intronic
1149568953 17:57658807-57658829 CAGGCCCAGCTGTCTGGAGCAGG + Intronic
1149845346 17:60006301-60006323 CAGGCTGAGCTGCCTGGAGGAGG - Intergenic
1151692820 17:75697348-75697370 AAGGCTGAGGTTGCAGAAGCTGG - Intronic
1152283957 17:79401801-79401823 CAAGCTGCTGTATCTGGAGCCGG - Intronic
1152652224 17:81499960-81499982 CTGGCTGCAGGTTCTGGAGCCGG + Intergenic
1152713083 17:81884636-81884658 CAGCCTGAGGTCCCTGGAGAGGG - Intergenic
1154298826 18:13175047-13175069 AAGGCTGAGGTCCATGGAGCTGG + Intergenic
1154499761 18:14990071-14990093 CAGGCTGAGGAAACAGGAGCAGG + Intergenic
1156506605 18:37599797-37599819 CAGGCTGTGATGGCTGGAGCTGG - Intergenic
1156702723 18:39843641-39843663 CAAGCTCAGTTTTCTGGAGTGGG + Intergenic
1159958536 18:74537599-74537621 CTGGATGAGGTTTGGGGAGCTGG + Intronic
1160015353 18:75135822-75135844 AAGGCAAAGGTTTCTGGAGAAGG + Intergenic
1160414232 18:78696914-78696936 GAGGCTGAGTTTTGTGGAGATGG - Intergenic
1161352480 19:3801667-3801689 CAGGCCGCGGTTCCCGGAGCAGG - Exonic
1161361620 19:3853139-3853161 CAGGCTGGGGTCCCTGGGGCTGG + Intronic
1161595339 19:5148442-5148464 CTGGCTCAGGTTTCTGGGTCAGG - Intronic
1162900173 19:13790508-13790530 CAGGCTGTGGTTTCTCAAGACGG + Intergenic
1163605894 19:18275082-18275104 CAGGCAGAGGCTTCTGGGCCAGG - Intergenic
1164989294 19:32673146-32673168 CAGGCAGAGGTGTCTGCAGAGGG - Intronic
1165075391 19:33277462-33277484 CCGGCTGAGGGTTCTGGACGTGG - Intergenic
1165086127 19:33348766-33348788 CTGGCTGAGGCATCAGGAGCTGG + Intergenic
1165590918 19:36969090-36969112 GAGGCTGAGGTGGCTGGATCAGG - Intronic
1166046570 19:40233925-40233947 CAGCCTGGGCTTACTGGAGCTGG - Exonic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1166663935 19:44665863-44665885 CTGGGTGAGGTTTCTGCTGCTGG - Intronic
1166906712 19:46115564-46115586 CAGGCTGAGGTTTCTGGGGTTGG - Intergenic
1167841530 19:52125605-52125627 CAGGCTGTGGTTTCCCGAGCTGG + Intronic
1168121119 19:54253165-54253187 CAGGCTGAGGAGCCTGGGGCAGG - Intronic
925468818 2:4136482-4136504 GAGGCTGAGGATGCTGCAGCAGG + Intergenic
926915089 2:17883626-17883648 CAGGCTGAGGATTCTAAGGCAGG + Intronic
927227355 2:20781802-20781824 GAAGCTGTGGTTTCTGGAGAGGG - Intronic
927909428 2:26885958-26885980 GAGTCTGAGGTTTCTGGATGGGG + Intronic
928377606 2:30788370-30788392 AAGGCTGAGGTTTCTTGTTCAGG + Intronic
928445915 2:31333165-31333187 CAGGCTGAGGATTCTCTTGCTGG - Intergenic
929652344 2:43693160-43693182 GAGGCTGAGGTGTGTGGATCAGG - Intronic
930618582 2:53620694-53620716 CAGGTTGAGGTTTTGGGAGTTGG + Intronic
936275472 2:111092885-111092907 CAAGCTGGTGTTTCAGGAGCGGG + Exonic
937153373 2:119701333-119701355 CAGGCTAAGGTTCCTGGGGCTGG + Intergenic
938465203 2:131520526-131520548 CATCCTCAGGCTTCTGGAGCGGG + Intergenic
938493521 2:131778239-131778261 CAGGCTGAGGGAACAGGAGCAGG - Intergenic
938498970 2:131820426-131820448 CAGGCTGAGGGAACAGGAGCAGG + Intergenic
938753195 2:134354914-134354936 CAAGCTGAGCTTTCAAGAGCTGG - Intronic
940272679 2:151908812-151908834 CAGGACTAGGTTTCTGAAGCAGG + Intronic
940977991 2:159968352-159968374 CAGGCTCAGTTTTCTAGATCAGG + Intronic
941602247 2:167558000-167558022 AAGGCTGAGCATTCTGAAGCAGG - Intergenic
942456277 2:176140590-176140612 CAGCCTCAGGTTTCCGGGGCTGG + Intergenic
943637424 2:190321356-190321378 AGGACTGAGGTTTCTAGAGCGGG - Intronic
943887940 2:193246666-193246688 CAAGAGGAGTTTTCTGGAGCAGG + Intergenic
944616267 2:201464457-201464479 CATGCTGAGCTGCCTGGAGCTGG + Intronic
945162370 2:206905873-206905895 CATGCTGAGATGTCTGGAGCTGG + Intergenic
945803623 2:214464504-214464526 CATGCTGAGCTCCCTGGAGCTGG + Intronic
948422129 2:237866114-237866136 CAGACTGCTGTTTCTCGAGCCGG - Intronic
948598474 2:239095420-239095442 CAGGCTCGGGGTCCTGGAGCAGG - Intronic
948766088 2:240219826-240219848 CAGGCAGAGGTTACAGCAGCTGG + Intergenic
949071229 2:242025502-242025524 TAGTTTGAGGTTTGTGGAGCTGG + Intergenic
1168890952 20:1295132-1295154 GGGACTGAGGTCTCTGGAGCTGG + Intronic
1169083708 20:2814555-2814577 CTGCCTGAGGCTTCTGGGGCTGG - Intergenic
1170842583 20:19935979-19936001 GAGGCTGAGATTTATGGAGTAGG + Intronic
1172250210 20:33474134-33474156 CAGGGAGAGCTTCCTGGAGCAGG - Intergenic
1173660429 20:44729465-44729487 CAAACTAAGGTTTCTGGAGGGGG - Intergenic
1173866147 20:46313742-46313764 CAGACAGAGGTTACAGGAGCGGG - Intergenic
1173916278 20:46710567-46710589 CAGGGTGGGTTTTCTGGAGTAGG + Intronic
1174061216 20:47834265-47834287 AAGGCTGAGGGTTGTGTAGCTGG - Intergenic
1174061224 20:47834321-47834343 AAGGCTGAGGGTTGTGGTGCTGG - Intergenic
1174063067 20:47845943-47845965 CAGGGTGAGCTTTCTGCAGGAGG + Intergenic
1174070552 20:47896378-47896400 AAGGCTGAGGGTTGTGGTGCTGG + Intergenic
1174070560 20:47896434-47896456 AAGGCTGAGGGTTGTGTAGCTGG + Intergenic
1174072656 20:47909731-47909753 CAGGGTGAGCTTTCTGCAGGAGG - Intergenic
1174100559 20:48123444-48123466 AAGGCTGAAGGTTGTGGAGCTGG - Intergenic
1174100569 20:48123500-48123522 TAGTCTGAGGGTTGTGGAGCTGG - Intergenic
1174101078 20:48126615-48126637 CAGTTTGAGGTTCCTGGAGCTGG - Intergenic
1174151419 20:48488974-48488996 CAGGGTGAGCTTTCTGCAGGAGG + Intergenic
1174498092 20:50963638-50963660 CAGGGTGAGGTTTGAGAAGCAGG + Exonic
1175246090 20:57582963-57582985 CAGGCTGAGGGGTCTGGGGTGGG + Intergenic
1176045830 20:63092154-63092176 CAGTCTGGGGTTTCTGGAGAAGG + Intergenic
1176614381 21:9016151-9016173 CAGGCTGAGGGAACAGGAGCAGG + Intergenic
1177040874 21:16109045-16109067 CAGGGTTAGGTTTCAGTAGCTGG - Intergenic
1177607257 21:23396902-23396924 GAGGCTGAGGTGTGTGGATCAGG - Intergenic
1179715985 21:43288825-43288847 CAGGCTCTGTTTTCAGGAGCAGG + Intergenic
1180497722 22:15904285-15904307 CAGGCTGAGGGAACAGGAGCAGG - Intergenic
1181625417 22:24119432-24119454 GAGGCTGGGGTTTCTGCAGCAGG - Exonic
1182476107 22:30577152-30577174 CAGGCTGAGGTATGTGTAGAAGG + Intronic
1182522922 22:30894492-30894514 CAGAGTGAGGTCCCTGGAGCAGG + Intronic
1182557297 22:31136144-31136166 GAGGCTGAGGCTTCTGGCTCAGG - Intronic
1182977865 22:34640371-34640393 CAGGCTGAGGACTCGGGGGCAGG + Intergenic
1183475713 22:38034711-38034733 CAGCCTGGGCTTTCTGGAGGGGG + Intronic
1183587743 22:38762713-38762735 CAGGCGGATGTTCCTGAAGCAGG + Intronic
1183991304 22:41598691-41598713 CAGGCAGAGGGGTCTGGAGCAGG + Exonic
1184182916 22:42843102-42843124 GAGGCTGAGGATGCAGGAGCGGG - Intronic
1184834890 22:47015237-47015259 CAGGATGCGGTTCCTGGCGCAGG + Intronic
1185069729 22:48649385-48649407 GAGGCTGAGCTTGCTGGAGTGGG + Intronic
1185402195 22:50625068-50625090 GAGGCTCAGGTGTCTGGAGGGGG - Exonic
949158894 3:857898-857920 AAGTCTGAGGGTCCTGGAGCTGG - Intergenic
949159091 3:859209-859231 TAGTGTGAGGTTTGTGGAGCTGG - Intergenic
950439266 3:12999249-12999271 CAGGGAGAAGGTTCTGGAGCTGG - Intronic
952260616 3:31736553-31736575 CAGTTTGAGGTTTCTGAGGCGGG - Intronic
953019631 3:39105237-39105259 CAGGCAGTGGTTTCTGCAGGGGG - Intronic
954248879 3:49353150-49353172 CAGACAGAGGTATCTGGGGCAGG - Intergenic
954298001 3:49684823-49684845 CATGCTGTGGGTTCTGGAACAGG + Exonic
954361370 3:50124488-50124510 CAGGCTGTGGTGACTGGGGCTGG + Intergenic
954367168 3:50152385-50152407 CAGGCTGTGGTGCCTGGAGAAGG - Intergenic
956348577 3:68309006-68309028 AAGGGTAAGGTTTCTGAAGCAGG - Intronic
957119143 3:76067108-76067130 CAGGCTGTGAATTCTGGAGTCGG + Intronic
957281860 3:78161258-78161280 CAGGCTGAAGATTTTGGAGGAGG - Intergenic
957762231 3:84573035-84573057 CAGGCTTAAATTTCTGCAGCAGG + Intergenic
958782949 3:98564813-98564835 CAGGGTGAGGATACTTGAGCAGG + Intronic
958864659 3:99486427-99486449 CAGCCTGAGTTTTCAGGAGGTGG - Intergenic
960269544 3:115658912-115658934 CAGGCTGCGGTTGCTGCTGCGGG - Intronic
960870146 3:122239695-122239717 TGTGCTGAGGTTCCTGGAGCTGG - Intronic
961034686 3:123634334-123634356 AAGGCAGAGGTTACTGGATCTGG + Intronic
963219165 3:142787987-142788009 AAGGCTAACATTTCTGGAGCAGG + Intronic
963779063 3:149469000-149469022 CAGTCTTTGGTTTCTGAAGCAGG + Intergenic
963950746 3:151197487-151197509 CAGGCTCATCTTTCTGGACCTGG + Intronic
964383355 3:156120678-156120700 CAGTCTGGGTTTTCTGTAGCAGG + Exonic
964763278 3:160154507-160154529 CAGGCTGAGCTCTCTAGAACAGG - Intergenic
965065480 3:163841861-163841883 CAGGCTGAGGTTGTTGCAGATGG - Intergenic
965375946 3:167924196-167924218 CATGCTGAGTTTTCTACAGCTGG + Intergenic
966453822 3:180093273-180093295 TGTGCTGAGCTTTCTGGAGCTGG + Intergenic
968105776 3:196000221-196000243 CAGGTTGAGGGCTGTGGAGCTGG - Intergenic
968303984 3:197637447-197637469 CAGGTTGAGGGCTGTGGAGCTGG - Intergenic
968466497 4:754189-754211 CAGGCTGGGGGTTCTGGTGTGGG + Intronic
968487637 4:871579-871601 CAGGCTGAGCTGTGGGGAGCAGG + Intronic
968950824 4:3690505-3690527 CAGGCTGAGGTTGTGGGATCTGG + Intergenic
969580246 4:8060551-8060573 CAGGCTGGGGTGGCTGGGGCGGG + Intronic
969721573 4:8895280-8895302 AGGGCCCAGGTTTCTGGAGCTGG + Intergenic
970520158 4:16875239-16875261 CAGGGTAGGGTTTCTGGGGCTGG + Intronic
970964096 4:21908052-21908074 CAGGCAGAGACTTTTGGAGCAGG - Intronic
971499234 4:27300603-27300625 CAGGCAGAGGTATCTGCTGCAGG - Intergenic
974292396 4:59948920-59948942 CATGCTGAGCTGTCTGGTGCGGG - Intergenic
975344744 4:73281411-73281433 AAGGCAGAGGATTCTGGAGCAGG + Intergenic
977811917 4:101366184-101366206 AAGGCTGTTGTTTCTGGATCTGG - Intergenic
980992294 4:139748275-139748297 TAGGCTGGGGTTTCTAGGGCTGG + Intronic
981173228 4:141649172-141649194 CAGACTGAGATTTCTGGACCAGG - Intronic
982174309 4:152691043-152691065 CAGGTTGAGGGTTCAGGACCTGG - Intronic
985507009 5:287227-287249 TAGTTTGAGGTTCCTGGAGCTGG + Intronic
986043156 5:4012380-4012402 GAGGCAGAGGGTTCTGGAGGAGG + Intergenic
986155852 5:5175450-5175472 CAAGCTGTGCTTTCTGAAGCTGG + Intronic
986649603 5:9950053-9950075 CAGGCTGATGTGGCTGGAACAGG - Intergenic
986735401 5:10663997-10664019 CAGGCTGAGCCTAATGGAGCAGG - Intergenic
987061093 5:14244829-14244851 GAGGCTGCAGTTGCTGGAGCAGG + Intronic
988065274 5:26224163-26224185 AAGTCTGAGGGTTGTGGAGCTGG - Intergenic
988065306 5:26224418-26224440 TAGTGTGAGGTTTGTGGAGCTGG - Intergenic
988065409 5:26225105-26225127 CAGTTTGAGGGTTGTGGAGCTGG + Intergenic
993073875 5:83201597-83201619 GAGGCTGAGGTTTCTAGAGAAGG - Intronic
994514464 5:100753127-100753149 CAGGCTGAGGTTCCAAGAGTGGG + Intergenic
994817132 5:104598316-104598338 TAGGCTGATGTTTTTGGGGCTGG - Intergenic
995480155 5:112585233-112585255 CAGGTTGAGGTTGCTGGGGGAGG + Intergenic
997641137 5:135449651-135449673 GACGCTGAGGTACCTGGAGCAGG - Exonic
998105821 5:139468573-139468595 CAGGCTGAGGAGTCTGCAGAGGG - Intergenic
999060543 5:148629733-148629755 CACCCTCAGGTTTCTGAAGCCGG + Intronic
999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG + Intergenic
999919398 5:156302835-156302857 CATGATGAGCTTCCTGGAGCTGG + Intronic
1006267919 6:32940877-32940899 CAGGCTGGGGCTTCTGGGACAGG - Exonic
1006445488 6:34077463-34077485 TAGGCTGAGGTTTGTGTGGCAGG - Intronic
1006811283 6:36822075-36822097 CAGGCTGGTGTTTCTGGTGTGGG + Intronic
1006837312 6:37006844-37006866 CAGGCTGAGGCCTCTGTGGCAGG - Intronic
1006883979 6:37364838-37364860 GAGGCAGAGGTTTGGGGAGCCGG - Intronic
1007178911 6:39914595-39914617 CAGGCTGGGGGTGCTGGAGGGGG - Intronic
1007205104 6:40143359-40143381 CAGGTTGAGGGTCCTGGAACAGG - Intergenic
1007902604 6:45424196-45424218 CAGGTTGAGGTTTTAGGATCTGG + Intronic
1007970622 6:46048644-46048666 AGGGCTGAGGTTTCAGGAGCTGG - Intronic
1008965050 6:57306651-57306673 GAGGCTGAGGTTTCAGGACGCGG - Intergenic
1013130300 6:107226403-107226425 GAGACTGGGGTTTCTGGAGATGG + Intronic
1013470601 6:110460710-110460732 AAGGCTGAGGTTGCTTGGGCAGG - Intronic
1014378290 6:120705339-120705361 CAGGCTGGGGTTAATGTAGCTGG - Intergenic
1016228376 6:141771353-141771375 TATGCTGAGCTTCCTGGAGCTGG + Intergenic
1017009386 6:150053036-150053058 CTGTCTGAGGGTTGTGGAGCTGG - Intergenic
1017009401 6:150053145-150053167 TAGTCTGAGGGTTGTGGAGCTGG - Intergenic
1017009571 6:150054160-150054182 CAGGTTGAGGGTCATGGAGCTGG - Intergenic
1017009774 6:150055379-150055401 AAGTCTGAGGGTCCTGGAGCTGG - Intergenic
1017294414 6:152777201-152777223 CCTGCTGAGGATACTGGAGCTGG - Intergenic
1017303472 6:152889330-152889352 CAGGTTGGGGTTTCTGGTGAGGG - Intergenic
1018174160 6:161164501-161164523 CAGGGTCCTGTTTCTGGAGCAGG + Intronic
1018421896 6:163647379-163647401 CGGTCTGAGGTTCCTGCAGCGGG - Intergenic
1018737490 6:166698400-166698422 CAGGCTGAGGTCAATGGAGAAGG + Intronic
1019211237 6:170407133-170407155 CAGGGAGATGTTTCTGGGGCAGG - Intergenic
1019559463 7:1648745-1648767 CGGGCTGAGGATTCAGGAGAAGG - Intergenic
1020027773 7:4911227-4911249 CAGGCTGAACCTTCGGGAGCTGG - Exonic
1023857006 7:44190078-44190100 CAGGCTGAAGCTTCCTGAGCAGG - Intronic
1023882525 7:44328354-44328376 CAGGCTGTGGTTCCCAGAGCAGG + Intronic
1024159514 7:46659923-46659945 GAGGCTGAGATTTCTGGAACTGG - Intergenic
1024997112 7:55280256-55280278 CGGGCTGAGCTTTCTGGGTCTGG - Intergenic
1025233122 7:57216233-57216255 AAGTCTGAGGGTCCTGGAGCTGG + Intergenic
1025233513 7:57218567-57218589 AAGGCTGAGGGTTGTGGAGCTGG + Intergenic
1025233534 7:57218675-57218697 CAGGTTGAGGGTCATGGAGCTGG + Intergenic
1025234002 7:57221352-57221374 TAGTTTGAGGTTTGTGGAGCTGG + Intergenic
1025726149 7:64063494-64063516 CATGCTGAGCTGCCTGGAGCTGG + Intronic
1025754905 7:64329628-64329650 CATGCTGAGCTACCTGGAGCTGG + Intronic
1026323068 7:69284311-69284333 CAGGCTGAGGTGGCGGGAGCAGG - Intergenic
1028418408 7:90605244-90605266 CAGGCTGGGATTTCTGGATGGGG + Intronic
1031412396 7:121456199-121456221 CATGCTGAGCTTCCTGGAGTTGG + Intergenic
1031923663 7:127619362-127619384 CAGTCTGAGGATGCTGGAGGAGG - Intergenic
1031971963 7:128071682-128071704 CAGGCTGAGGTTTGTGGAGAAGG + Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1032349686 7:131149022-131149044 CAGGCTCGGATTTCTGGGGCAGG + Intronic
1032441115 7:131943790-131943812 CAGGCAGCGGTTTCTGAGGCAGG + Intergenic
1032723291 7:134568366-134568388 CAGGCAGAAGTATCTGGATCGGG + Intronic
1033433336 7:141308823-141308845 AAGGCTGGGGATTCAGGAGCCGG - Intronic
1033597500 7:142867801-142867823 CAGTGTGAGGTTTCTGCAGGGGG - Intronic
1034016611 7:147594324-147594346 CGGGCTGTGGCTTCAGGAGCTGG + Intronic
1034080875 7:148276575-148276597 CAGTCAGTGGTTCCTGGAGCAGG + Intronic
1034489864 7:151387423-151387445 CAGGCTGAGGACCCTGGGGCTGG - Intronic
1034931974 7:155169825-155169847 CTGACAGAGGTTGCTGGAGCCGG - Intergenic
1037117642 8:15245877-15245899 CAGGCTGCAGTTTGTGGGGCAGG - Intergenic
1038833884 8:31096822-31096844 CAGCCTCAAGTTGCTGGAGCAGG - Exonic
1040723570 8:50354105-50354127 CTGGCTGAGCTTTCTGGATATGG - Intronic
1040904954 8:52458728-52458750 CAGAATGAGGTGCCTGGAGCAGG - Intronic
1041256471 8:55983444-55983466 GAGGCTGAGGTAGCTGGAGAGGG - Intronic
1041315654 8:56559492-56559514 CAGGCTGAGGAGTCTGGCCCCGG + Intergenic
1042482929 8:69324077-69324099 TAGTTTGAGGTTTGTGGAGCTGG + Intergenic
1042483124 8:69325287-69325309 TAGTGTGAGGTTTGTGGAGCTGG + Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1046934515 8:119873648-119873670 CAAGCTCAAGTTTCTGGGGCCGG + Intergenic
1047215157 8:122870145-122870167 GAGTCTGAGGTTGCTGGAGCAGG + Intronic
1048455365 8:134573446-134573468 CAGGCTGATGTTGCTGGTGGAGG + Intronic
1049408525 8:142462268-142462290 CTGGCTGGGGCTTCTGGATCTGG - Intronic
1050377331 9:4986053-4986075 AAGGCGAAGGTGTCTGGAGCTGG + Intronic
1051912593 9:22171518-22171540 CAGACTGAGGTTTCCTGAACAGG - Intergenic
1052024547 9:23560004-23560026 CAGGCTGAGGACTCATGAGCTGG + Intergenic
1053268061 9:36730359-36730381 CAGGCACAGGGTTCTGGGGCTGG + Intergenic
1053346587 9:37382851-37382873 CAGGCTGTGTTTTCTGCAGGAGG - Intergenic
1053366289 9:37524762-37524784 CGGGCGGAGGTTTCCAGAGCAGG + Intronic
1054328774 9:63731366-63731388 CAGGCTGAGGTAACAGGAGCAGG - Intergenic
1055478695 9:76688717-76688739 AAAGCTGATGTTTCTTGAGCTGG - Intronic
1056029795 9:82541327-82541349 CAGGCCTAGGTTTCTGGAGCAGG - Intergenic
1057060666 9:92001387-92001409 CAGGCTGTGATGTTTGGAGCTGG - Intergenic
1057180654 9:93028140-93028162 CAGGCTGAGGTTTCTGGAGCTGG - Intronic
1057264309 9:93603929-93603951 CAGGCTGGGGGATCTGGAGGTGG - Intronic
1057268573 9:93634475-93634497 AAGGCTGGGGGTGCTGGAGCAGG - Intronic
1057700238 9:97358773-97358795 CAGGCTGGGGTGTCTGGTTCTGG - Intronic
1057700246 9:97358789-97358811 CAGCCTGAAGGTTCTGGAGTGGG + Intronic
1058285152 9:103168724-103168746 CATGTTGAGGATACTGGAGCTGG + Intergenic
1058592871 9:106584009-106584031 AAGGCTCAGGTTTCTCAAGCAGG + Intergenic
1058811252 9:108641722-108641744 CATCCTGATGTTTCTGGAGATGG + Intergenic
1059886708 9:118752097-118752119 CATGCTGAGCTGTTTGGAGCTGG - Intergenic
1059989178 9:119848520-119848542 CAGGCTCATGTTTCTGAAGCTGG - Intergenic
1060016868 9:120094398-120094420 CAGGATGAGGTATATGAAGCTGG + Intergenic
1060786797 9:126457419-126457441 CACACTGGGGTTCCTGGAGCAGG - Intronic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1062426531 9:136508654-136508676 CAATCCCAGGTTTCTGGAGCCGG - Intronic
1062443378 9:136583443-136583465 CAGGCTAGGGTTTCTCGAGCTGG - Intergenic
1062571235 9:137186331-137186353 CAGGCTCAGTCTGCTGGAGCGGG - Exonic
1062613964 9:137387745-137387767 CTGGCTGGGGCTTCTGGGGCCGG - Intronic
1186242297 X:7582491-7582513 CAGGCTTAGGTATCTCGAGAAGG + Intergenic
1186388148 X:9130925-9130947 CAGGCTGTGGTGTCTGGAGCTGG + Intronic
1187050011 X:15686473-15686495 CAGGCTCAGTTTTCTTGGGCTGG + Intergenic
1187058171 X:15760518-15760540 CAGGCTCAGTTTTCTTGGGCTGG + Intronic
1187684498 X:21803019-21803041 CAAGATCAGGTTTCTGGACCAGG + Intergenic
1188715736 X:33457121-33457143 CATTCTGAGCTATCTGGAGCAGG - Intergenic
1189705293 X:43753546-43753568 AAAGCTCAGGTTTCTGGAGCTGG + Intergenic
1197846600 X:130810508-130810530 GAGTCTGAGGCTTCAGGAGCTGG - Intronic
1198228682 X:134669733-134669755 CAGCTTGGTGTTTCTGGAGCTGG + Intronic
1202373581 Y:24214141-24214163 TAGGCTCATGTTTCTGGAGGAGG - Intergenic
1202497200 Y:25455979-25456001 TAGGCTCATGTTTCTGGAGGAGG + Intergenic