ID: 1057182213

View in Genome Browser
Species Human (GRCh38)
Location 9:93036340-93036362
Sequence ACTGCTTTCCAGGTGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 231}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057182213_1057182217 1 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182217 9:93036364-93036386 CTGCATCTGTTGTCCTGCCAGGG 0: 1
1: 0
2: 0
3: 25
4: 258
1057182213_1057182218 2 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182218 9:93036365-93036387 TGCATCTGTTGTCCTGCCAGGGG 0: 1
1: 0
2: 0
3: 15
4: 161
1057182213_1057182216 0 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182216 9:93036363-93036385 TCTGCATCTGTTGTCCTGCCAGG 0: 1
1: 0
2: 2
3: 51
4: 922
1057182213_1057182219 3 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182219 9:93036366-93036388 GCATCTGTTGTCCTGCCAGGGGG 0: 1
1: 0
2: 1
3: 15
4: 161
1057182213_1057182224 14 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182224 9:93036377-93036399 CCTGCCAGGGGGTGGGCAGGTGG 0: 1
1: 1
2: 8
3: 150
4: 1188
1057182213_1057182226 18 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182226 9:93036381-93036403 CCAGGGGGTGGGCAGGTGGCAGG 0: 1
1: 0
2: 9
3: 124
4: 946
1057182213_1057182220 6 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182220 9:93036369-93036391 TCTGTTGTCCTGCCAGGGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 220
1057182213_1057182227 27 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182227 9:93036390-93036412 GGGCAGGTGGCAGGTGAAGATGG 0: 1
1: 0
2: 8
3: 98
4: 1028
1057182213_1057182221 7 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182221 9:93036370-93036392 CTGTTGTCCTGCCAGGGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 208
1057182213_1057182222 11 Left 1057182213 9:93036340-93036362 CCACACACCACCTGGAAAGCAGT 0: 1
1: 0
2: 2
3: 22
4: 231
Right 1057182222 9:93036374-93036396 TGTCCTGCCAGGGGGTGGGCAGG 0: 1
1: 0
2: 1
3: 35
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057182213 Original CRISPR ACTGCTTTCCAGGTGGTGTG TGG (reversed) Intergenic
901120260 1:6885972-6885994 ACTGCTTCCCATGTCCTGTGCGG + Intronic
901489034 1:9587051-9587073 ACTGATTACCTGGTGGTGGGAGG - Intergenic
904037572 1:27567072-27567094 ACTGCTCTCCAGGCCGTCTGTGG + Intronic
904794530 1:33049340-33049362 ACTGAGTTCCAGGGGGTTTGTGG + Intronic
905881689 1:41468178-41468200 ACTGCTTTCCTGCAGGTGTCAGG + Intergenic
906754410 1:48295555-48295577 AGTGGTTTCCAGGAGTTGTGGGG + Exonic
908631683 1:66116431-66116453 GCTGCCTTCCAGGATGTGTGTGG - Intronic
909086794 1:71177895-71177917 ACTGTTTTCCTGGGGGTGGGAGG + Intergenic
911716211 1:101136082-101136104 AGTGGCTTCCAGGAGGTGTGGGG + Intergenic
912414014 1:109495981-109496003 ACTGCTGTCCAGGCACTGTGTGG + Exonic
915571001 1:156744968-156744990 TCTGCTTTCCAGGGGGTCTCTGG + Intronic
915914674 1:159933839-159933861 ACTTCTTACCAGGTGCTGTGTGG - Intronic
916452009 1:164929753-164929775 CCTGCTTGCCAGGTGATGTTGGG + Intergenic
917631387 1:176894492-176894514 AAGGCTTTCCAAATGGTGTGAGG - Intronic
919005618 1:191895779-191895801 CCTGCCCTCCAGGTGGAGTGGGG - Intergenic
919516441 1:198531469-198531491 ACTGATTTTCAGGTGGTTTGTGG + Intronic
921783669 1:219200029-219200051 ACTGCTCACTAGGTGGTGTGGGG - Intronic
922471717 1:225881343-225881365 AGTGCTTTACAGGTGTTGTTTGG - Intronic
922767269 1:228162667-228162689 CCTGCTTCCCAGGTACTGTGGGG - Intergenic
1062907344 10:1187685-1187707 GCTGCCTTCCCGGTGGTGTTTGG - Intronic
1064107716 10:12514116-12514138 AGTGCTTTTCAGCTGGAGTGCGG + Intronic
1065983641 10:30928802-30928824 ATTGCTGTCCAGCTGGAGTGAGG + Intronic
1066402685 10:35090620-35090642 ATTGCTTTCCGGGTGGCGGGGGG - Intronic
1068653904 10:59554818-59554840 AGTGTTTTCCAGGTGGTGAGTGG - Intergenic
1069042572 10:63710703-63710725 ATTGCTTTCCATGTGGAGAGAGG + Intergenic
1069842779 10:71350173-71350195 ACTGCTTTCTAAGGGGTATGAGG - Intronic
1070653104 10:78252217-78252239 ACTTCTGTCCAGGTGGGCTGGGG + Intergenic
1070774664 10:79102658-79102680 ACTGCTTCCCAGGTGGCGCCTGG - Intronic
1073216917 10:101841503-101841525 TCTACTTTCCAAGTCGTGTGTGG + Intronic
1073463087 10:103677759-103677781 CCTGCATTCAAGGTGTTGTGGGG - Intronic
1074435958 10:113434564-113434586 ACTGCATTCCAGATAGAGTGAGG - Intergenic
1074775942 10:116768327-116768349 AGTGCTTGCCAGGGGCTGTGGGG + Intergenic
1074806385 10:117057303-117057325 GCTGCTTACCAGGTGGCTTGGGG - Intronic
1075338070 10:121623176-121623198 ACCGGTTCCCAGGTGATGTGGGG + Intergenic
1076823543 10:132955128-132955150 ACTGCTTTCTAGGGAGTCTGTGG - Intergenic
1077881147 11:6351422-6351444 ACTGATTTCTGGGTGGTGTCTGG - Intergenic
1081150700 11:39627285-39627307 CCTGCTTTCCAGCTGAGGTGGGG - Intergenic
1081297099 11:41404691-41404713 ACAGCTCTCCAGGTGATGTCTGG - Intronic
1081862643 11:46342270-46342292 TCTGCTTTCCAGGTGGGGTGGGG - Intronic
1083736193 11:64682692-64682714 ACTGCTTGCATGGTGGTGGGAGG + Intronic
1084121074 11:67069295-67069317 ACTGCTTGCCTGGTGGAGGGAGG - Intronic
1084974076 11:72787154-72787176 ACTGCTTACTTAGTGGTGTGTGG - Intronic
1085771790 11:79332074-79332096 ACTACTTTACAGGTTGTGTGAGG - Intronic
1085822870 11:79811764-79811786 ACTTCTTCCCAGTTGCTGTGAGG + Intergenic
1088006281 11:104944923-104944945 ACTTCATTCCAGGTGTTGTCTGG - Intronic
1088438195 11:109839185-109839207 AATGCTTTCTAGGTGATCTGAGG + Intergenic
1090249684 11:125242548-125242570 ACTGCTGCCCAGCTGGTGGGGGG + Intronic
1090257539 11:125295926-125295948 GCTGCCTTCCACGTGCTGTGGGG - Intronic
1090278044 11:125433212-125433234 ACGCCTGTCCAGGTGGTGAGTGG - Exonic
1090988461 11:131794762-131794784 AATGCTTTTCACATGGTGTGTGG - Intronic
1091104453 11:132905521-132905543 ACTGCTTTCCAGGCTGGGTGTGG - Intronic
1091263169 11:134249949-134249971 AGTACTTTCCAGCTGGTGGGAGG - Intronic
1091299540 11:134498627-134498649 ACTTCATTCCAGGGGGTGTGGGG + Intergenic
1091341119 11:134814726-134814748 CCTGATTTCCAGCTGGGGTGGGG + Intergenic
1094476728 12:30846209-30846231 CCTGCTTTTCAGCTGCTGTGAGG - Intergenic
1102374878 12:112414096-112414118 ACTGTTTTCCAGGTGGAGAAGGG + Intronic
1104441344 12:128795859-128795881 AGTGCTTTCCAGCTGGTGGCAGG - Intronic
1105040026 12:132954738-132954760 ATCCCTTTCCAGGTGGTGTTTGG - Intronic
1105631428 13:22173223-22173245 ACAGCTTTCCTGGTGGAGTTTGG + Intergenic
1107129136 13:36876653-36876675 AGTGCTTTCCAAGTTATGTGTGG - Intronic
1107185446 13:37513851-37513873 ACTGCTTTCCAGGTAATCTATGG + Intergenic
1107453700 13:40535633-40535655 CTTGTTTTCCAGATGGTGTGGGG - Intergenic
1109332700 13:60949676-60949698 ACTGCTTTCAATCAGGTGTGTGG - Intergenic
1111993376 13:95138856-95138878 ATTGCAGGCCAGGTGGTGTGAGG - Intronic
1112190798 13:97175449-97175471 TTTGCAATCCAGGTGGTGTGTGG - Intergenic
1112780227 13:102892244-102892266 AGTCATTTCCAAGTGGTGTGTGG - Intergenic
1113984336 13:114301851-114301873 ACGGCTTTCCAGAAGGAGTGAGG + Exonic
1114419996 14:22573985-22574007 ACAGCTTTCCAAGTGGTGACAGG + Intronic
1116972647 14:51082591-51082613 ACTGGTTGCCAGGAGTTGTGGGG + Intronic
1117732132 14:58733757-58733779 AATGCTTGCCAGGTTGTGAGAGG + Intergenic
1118459149 14:65972639-65972661 ACTGCTTTGTAGGTGAAGTGGGG - Intronic
1119550656 14:75511173-75511195 ACTGCTTTCCAAGAGCTGAGGGG + Intergenic
1119616515 14:76102355-76102377 ACAGCATCCCAGGTGGTGGGTGG + Intergenic
1122750537 14:103929255-103929277 AGTGGTTTCCACGTGGTGTAGGG - Intronic
1124707276 15:31976422-31976444 ACTGCATGCCTGGTGTTGTGTGG + Intergenic
1126230297 15:46315644-46315666 ACTGTTTCCCAAGGGGTGTGGGG + Intergenic
1127284441 15:57520068-57520090 CCTGTTTTCCCAGTGGTGTGGGG + Intronic
1128870297 15:71150074-71150096 ACTCCTTTCCAAGTGGCGTGGGG - Intronic
1129156519 15:73721637-73721659 TCTGCCTGCCTGGTGGTGTGGGG + Intergenic
1129693126 15:77724913-77724935 ACTGCTTCCCAGACGGTGTGTGG + Intronic
1129756639 15:78102963-78102985 GCTGCTATCCATGGGGTGTGTGG - Intronic
1130924481 15:88374966-88374988 AATGCTTGGCAGGTGGGGTGGGG + Intergenic
1133822824 16:9251711-9251733 TCTTCATTCCAGGTGATGTGAGG + Intergenic
1134034146 16:11016839-11016861 AGTGCTTTCTAAGTGGTGTGTGG - Intronic
1135141149 16:19923257-19923279 GCTGGTTTCCAAGTGGTGAGAGG - Intergenic
1135473369 16:22751900-22751922 AGTTCTTTCCAGCTGGTGAGTGG - Intergenic
1136293838 16:29290818-29290840 GCTGCTTTCCAGTGGGTCTGGGG + Intergenic
1136912685 16:34157573-34157595 ACTGCACTCCAGCTGGGGTGGGG - Intergenic
1137759005 16:50925491-50925513 ACTGTTTTGATGGTGGTGTGGGG + Intergenic
1138237193 16:55394368-55394390 ACTGCTTTCCTGTTTGTGTTGGG - Intronic
1138659583 16:58509373-58509395 ACCGGTCTCTAGGTGGTGTGGGG - Intronic
1139183939 16:64781158-64781180 ACTGTTTTCCCTGTGGAGTGAGG + Intergenic
1140977242 16:80071885-80071907 ACTGTTTGCCATGTGTTGTGAGG + Intergenic
1142099738 16:88264864-88264886 GCTGCTTTCCAGTGGGTCTGGGG + Intergenic
1142311633 16:89317538-89317560 GCTCCTTCCCAGGTGGTGAGTGG - Intronic
1142816429 17:2429724-2429746 AATACTTTGCAGGTGGTATGTGG - Intronic
1143156799 17:4842449-4842471 ACTTCTTTCCAGGTAGAGAGAGG + Intronic
1145773955 17:27513689-27513711 ATCGTTTTCCAGGTGTTGTGAGG + Intronic
1146407926 17:32555743-32555765 ACGGCTTTGCACGTGGTGTGAGG - Intronic
1149286424 17:55170091-55170113 ACTGCTTTCCAGAATGTTTGTGG - Intergenic
1151231412 17:72687909-72687931 ATGGCTCTCCAGGAGGTGTGTGG - Intronic
1151336213 17:73441166-73441188 GCTGCTTTACAGGAGGGGTGGGG - Intronic
1153385022 18:4483254-4483276 ACTGTTTTTCAGGTGCTCTGAGG + Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1156112884 18:33748600-33748622 ACTGCCTGCCAGGTTGTGTTGGG + Exonic
1156426664 18:37020698-37020720 ATTGCTTTCCAGAAGGTGTATGG + Intronic
1156450749 18:37265412-37265434 TGTGGATTCCAGGTGGTGTGGGG - Intronic
1156570283 18:38244745-38244767 GCTGCTTCCCATGTGTTGTGTGG - Intergenic
1161321810 19:3644872-3644894 ACTGTTTACCAGGAGCTGTGTGG - Intronic
1163098580 19:15079386-15079408 ACGGCCTGTCAGGTGGTGTGGGG + Intergenic
1163559098 19:18008624-18008646 ACCGCCGTCCAGGTGGTGGGAGG - Intronic
1165780976 19:38434162-38434184 CCTGCTTCCAAGATGGTGTGAGG - Intronic
1166572413 19:43806002-43806024 GATGCTTGCCAGGGGGTGTGGGG - Intronic
1168430707 19:56277516-56277538 AGTGATTTCCAGGGGGTGAGGGG + Intronic
926115288 2:10209346-10209368 ACTACTTTCCAGGCTGGGTGCGG - Intronic
926688222 2:15714970-15714992 ACTGTTTTCCTGGTGGTGAATGG - Intronic
928071651 2:28223284-28223306 CCTGCTTTCCAGCTGGTTTGGGG + Intronic
930380005 2:50615712-50615734 AATGCTTTCCAAGTGGTCTAAGG + Intronic
932016729 2:68036146-68036168 ACTTCATTCCTGCTGGTGTGAGG + Intergenic
932663697 2:73679426-73679448 TCTGCTTTCCTGGTGGGCTGGGG + Intergenic
932800362 2:74736811-74736833 ACTGCTTTCCAGGTTCTGAAAGG - Intergenic
933638403 2:84732078-84732100 AATGCTGTGCAGGGGGTGTGGGG + Intronic
937091509 2:119209442-119209464 AGTGCTTTCCAGATGCTGAGTGG + Intergenic
937436274 2:121884488-121884510 ACTGCTTCTTAGCTGGTGTGTGG - Intergenic
938264943 2:129921983-129922005 AGTGGTTTCCAGGGGGGGTGGGG + Intergenic
942009112 2:171740968-171740990 AGTGGTTTCCAGGAGCTGTGGGG - Intronic
942849673 2:180469386-180469408 ATTGCTATCCTGATGGTGTGAGG - Intergenic
943040179 2:182795073-182795095 ACTGCTCTCCAAGTGTTGGGGGG - Intergenic
943719003 2:191183192-191183214 ACTCCATTCCAGGCAGTGTGTGG + Intergenic
943890017 2:193275227-193275249 ACTGCTTTGCAGGTAGTGAAGGG + Intergenic
944398105 2:199292726-199292748 ACTGCTTTCCAGATGCTGAGTGG - Intronic
945183977 2:207121095-207121117 ACTGCTTTCTATGTTGTGGGAGG + Intronic
945340261 2:208644275-208644297 CCTGCTCTTCAGGTGGTGGGTGG + Intronic
947027520 2:225753396-225753418 ACAGCTTTCTCGGTGGTGTTTGG + Intergenic
948926300 2:241100828-241100850 ACTGATTTTCAACTGGTGTGGGG + Intronic
1171087838 20:22254547-22254569 AGTGGTTTCCAGGGGTTGTGGGG + Intergenic
1173199937 20:40946934-40946956 ACAGGCTTCCAGGTGGGGTGAGG + Intergenic
1174403664 20:50290089-50290111 ACTGTTTTCCAGGTGGAGGGAGG + Intergenic
1174690412 20:52498681-52498703 ACAGATTTCCAGGTGCCGTGTGG - Intergenic
1175224165 20:57435139-57435161 ATTGTTTTTCAGGTGGTGTCTGG - Intergenic
1175253906 20:57627297-57627319 ACTGCTTTCTAGTTTGTCTGAGG + Intergenic
1175740148 20:61414385-61414407 GCTGCTTTCACTGTGGTGTGAGG + Intronic
1176905435 21:14494546-14494568 ACTGCTTGTCAGGGGGTGGGGGG + Intronic
1177197918 21:17922346-17922368 ACTGCTTTAGAGGTGGAGCGAGG + Intronic
1178522747 21:33300037-33300059 ATTGCTTCCCAGGTGGTCAGTGG - Intergenic
1178830325 21:36050902-36050924 ACTGCTCATTAGGTGGTGTGGGG + Intronic
1179895171 21:44357787-44357809 CCTGCTTTCAAGGTGGTGTCTGG - Intronic
1179964432 21:44793183-44793205 ACTGCTAAGCAGGTGGGGTGCGG + Intronic
1182238521 22:28895950-28895972 TCTGCTGTTCAGGTGGTCTGAGG + Intronic
1183269852 22:36854295-36854317 ACTGTTTTCCAGGTCGGGTGTGG - Intergenic
1183513325 22:38248670-38248692 CCTGCATTCTAGGTGGGGTGGGG - Intronic
1184540417 22:45119870-45119892 AGTGATTTCCAGGGGCTGTGGGG + Intergenic
1184583369 22:45431390-45431412 ACGGCTTTCCAGGTAGAGAGAGG + Intronic
1184983344 22:48112179-48112201 AGTGCTTTCCAGGAGCTGAGAGG + Intergenic
1185389656 22:50552252-50552274 CCTGCTGTCCAGGTAGTCTGCGG - Intronic
949306953 3:2652476-2652498 ACTGCTGTGCAGCTGCTGTGGGG + Intronic
952576845 3:34784522-34784544 ACTGTTTTGGAGGGGGTGTGAGG - Intergenic
952760413 3:36908593-36908615 CCTGGTTTCCTGGTGGTGAGAGG - Intronic
953916937 3:46926364-46926386 ACTGCTGTCCTGGTGGACTGTGG - Intronic
954363292 3:50133684-50133706 CCTGCTTTGCTGGTGGGGTGGGG - Intergenic
955192862 3:56778001-56778023 TCTGTGTGCCAGGTGGTGTGTGG + Intronic
955512777 3:59698200-59698222 ACAGCTTGCCAGGTGGTTTCAGG - Intergenic
956647127 3:71467305-71467327 ACTTCGTTCCAGGTACTGTGTGG - Intronic
958080397 3:88738960-88738982 AGTGTTTTGCATGTGGTGTGGGG + Intergenic
958814187 3:98898673-98898695 ACTTCTTTTCAGGTTATGTGAGG + Intronic
960302383 3:116019506-116019528 ATTGCTTACCAGTTGGTGTAAGG + Exonic
960328107 3:116321516-116321538 ACTTCTTTCTAGATGTTGTGTGG - Intronic
960861012 3:122153853-122153875 ACTCCTTTCCTGGGGGTGTGGGG - Intergenic
963530514 3:146469204-146469226 ACTGCTTTACAGGTAGAGAGCGG - Exonic
963537201 3:146544101-146544123 ACTGCTTTACAGGTAGAGAGCGG - Intronic
968884665 4:3321390-3321412 ACTGCCTCCCAGATGGAGTGGGG - Intronic
968953454 4:3706522-3706544 ACTGCTTTCCAGGTGTGAAGCGG - Intergenic
969136579 4:5033982-5034004 ACTGCTGTGCAGGAGATGTGAGG + Intergenic
969157821 4:5227870-5227892 ACTGCTTTCCAGGTAGTCATTGG - Intronic
970280319 4:14447757-14447779 ACTGCTGTCCACGCGATGTGTGG - Intergenic
971025579 4:22585861-22585883 CCTGCTATCCAGGGGGTTTGTGG - Intergenic
971058523 4:22940664-22940686 ACTGCACTCCTGGGGGTGTGGGG - Intergenic
972113228 4:35592526-35592548 ACTGCTTTGCAGGTGGATAGAGG + Intergenic
972292841 4:37706023-37706045 AGTGATTTCCAGGTGCTGAGGGG - Intergenic
973205997 4:47560785-47560807 GCTAGTGTCCAGGTGGTGTGAGG + Intronic
978143213 4:105341451-105341473 ACTGCTTTCCAGAAGCTCTGGGG + Intergenic
980686549 4:136237442-136237464 AGTGGTTTCCATGTGGTGTTGGG + Intergenic
980690219 4:136286576-136286598 AGTGCTTCCCAGGAGTTGTGGGG + Intergenic
985982696 5:3485380-3485402 ACTGCTATCCTGGGGCTGTGGGG + Intergenic
986201630 5:5584525-5584547 AGAGATGTCCAGGTGGTGTGTGG + Intergenic
986982562 5:13466131-13466153 TCTGCTTTCTTGGTGATGTGTGG - Intergenic
988688515 5:33549157-33549179 ATGGCTTGCCAGGTTGTGTGAGG + Intronic
989683581 5:44058741-44058763 CCTGCTTTGCATGTGTTGTGTGG + Intergenic
990764959 5:59171686-59171708 AATGCTTTCCATGTGGTTAGGGG - Intronic
990888859 5:60626123-60626145 AGTGGTTTCCAGGGGTTGTGGGG - Intronic
992390461 5:76326580-76326602 ACTGCGGGCCAGGTGGGGTGGGG - Exonic
992775314 5:80083761-80083783 ACTACATTCCAGGTACTGTGGGG - Intergenic
993180719 5:84548773-84548795 AGTCCTTTCAAGGTGTTGTGAGG + Intergenic
994352526 5:98763364-98763386 ACTGCTTACCAGGGGATGTAGGG + Intergenic
1000575408 5:162969800-162969822 GCTGGTTTCCATGTGGTGTTAGG + Intergenic
1001549890 5:172595182-172595204 ATTGCTGTCCAGGTGTGGTGAGG + Intergenic
1002354362 5:178612337-178612359 ACAGCTTTACTGGTGGGGTGGGG - Intronic
1003463387 6:6353051-6353073 ACAGGTGTGCAGGTGGTGTGCGG - Intergenic
1003643851 6:7898509-7898531 ACTGATTTGAAGGTGGTCTGTGG - Intronic
1008934547 6:56976100-56976122 AATTGTTTCCAGGTGGTATGTGG - Intronic
1009388704 6:63119312-63119334 CCTGCTTTCACTGTGGTGTGTGG + Intergenic
1011061928 6:83279527-83279549 AATGCTTTCCTTGTGGTGTCTGG - Intronic
1011661788 6:89601102-89601124 ACTGCTTTCTAAGAGGTCTGAGG + Intronic
1014175292 6:118325439-118325461 ACTGCTTTCCCTGAGGTTTGTGG + Intergenic
1014569778 6:122995349-122995371 ACTGAGTTCCACGAGGTGTGGGG - Intergenic
1015962987 6:138669725-138669747 TCAGCTTTCCAGGAGCTGTGTGG - Intronic
1017065762 6:150527774-150527796 AGAGCTTTCCAGGTGGGGTCGGG - Intergenic
1017708331 6:157145135-157145157 TCAGCCTTCCAGGTGGTGTTCGG + Intronic
1018053106 6:160028701-160028723 ACTGCTGGGCAGGTGCTGTGGGG + Intronic
1018389180 6:163329760-163329782 CTTTCCTTCCAGGTGGTGTGAGG + Intergenic
1018812599 6:167308541-167308563 ACCACTGTCCAGGTGGGGTGGGG + Intronic
1018898219 6:168035907-168035929 ACCCCTCTCCAGGTCGTGTGTGG - Intronic
1020874865 7:13679950-13679972 ACTGCTTCACAGGTAGTGTGAGG - Intergenic
1022029576 7:26479984-26480006 ACACCTTTCAAGGAGGTGTGTGG - Intergenic
1023855495 7:44180915-44180937 AATGCTTTACAAGTGGTGTTTGG - Intronic
1026059024 7:67009860-67009882 ACTGATTCTCACGTGGTGTGGGG + Intronic
1026377778 7:69769393-69769415 ACTGCTGTCCAGGAAGTGGGAGG + Intronic
1026719064 7:72815182-72815204 ACTGATTCTCACGTGGTGTGGGG - Intronic
1028231333 7:88309726-88309748 TCTGGTTTCTAGGTGGTGTTTGG + Intergenic
1030087940 7:105833082-105833104 AGGGCTTTGCAGGTGATGTGAGG - Intronic
1030787340 7:113678542-113678564 TCTGATTTTCAGGTGGTGGGAGG + Intergenic
1030935027 7:115575093-115575115 ATTGCTTTCCATGTGGTAGGTGG + Intergenic
1031969416 7:128053512-128053534 ACAGTTTTCCAGGTAGTGGGGGG - Intronic
1032729689 7:134627327-134627349 ACTGATTTCCAGATGCTGTAGGG - Intergenic
1033444297 7:141406489-141406511 ACAGCTCTCCAAGTGATGTGGGG - Intronic
1033716664 7:144009687-144009709 ACTGGTTTCCACATGGTGTTGGG + Intergenic
1034076495 7:148236579-148236601 TCTGCCTTCCAGGTTATGTGAGG + Intronic
1034096564 7:148414112-148414134 ACTGCACTCCAGCTTGTGTGAGG - Intronic
1036171737 8:6493411-6493433 ACTGAATTCCAGGTGGTGAGAGG - Intronic
1042495562 8:69451428-69451450 AGTGCTTGCCAGGGGGTGTGGGG + Intergenic
1043065733 8:75567934-75567956 AGTGGTTTCCATGTGGTGTTGGG - Intergenic
1044864909 8:96561490-96561512 AATGCTGTACAGGTTGTGTGGGG + Intronic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046245512 8:111555839-111555861 ATGGCCTTTCAGGTGGTGTGGGG - Intergenic
1048280982 8:133105592-133105614 AGAGATTTCCAGGTGATGTGAGG + Intronic
1049566885 8:143344905-143344927 GCTGCTCTCCAGGTGCTGGGTGG - Intronic
1049758719 8:144322254-144322276 ACTGCTTCCTAGGACGTGTGGGG - Intronic
1052592933 9:30521911-30521933 ACTTCATTCCAGGTGGTGGCAGG - Intergenic
1056689274 9:88792841-88792863 CCTCCTTACCAGGTGTTGTGTGG - Intergenic
1057182213 9:93036340-93036362 ACTGCTTTCCAGGTGGTGTGTGG - Intergenic
1060978841 9:127780860-127780882 GCTGCATTCCCAGTGGTGTGAGG - Intergenic
1062637290 9:137498339-137498361 TCTACTTTCCGGGTGGGGTGGGG - Intronic
1185950581 X:4428595-4428617 AGTGATTTCCAGGTGATGTGTGG - Intergenic
1186591055 X:10930452-10930474 ACTGCATCCCAGGAGGTGGGAGG + Intergenic
1188634600 X:32413599-32413621 GCTGCTTTACAGGTGGGATGTGG - Intronic
1188703957 X:33302940-33302962 AGTGTTTTCCAGGGGCTGTGAGG - Intronic
1191701073 X:64043625-64043647 ACTGCATTTTAGGTGGTCTGCGG + Intergenic
1193215704 X:78861266-78861288 GCTGCTTTCAACGTGGGGTGAGG - Intergenic
1194473281 X:94324878-94324900 AATGTTTTCCATGTGCTGTGAGG - Intergenic
1194743039 X:97598028-97598050 ACTGATTTCCCGGTAGTCTGTGG - Intronic
1195981874 X:110587456-110587478 ACTGCTGGCAAAGTGGTGTGAGG - Intergenic
1196081070 X:111631713-111631735 ACTTGTTTGCATGTGGTGTGTGG - Intergenic
1199455053 X:148019553-148019575 ACAGCTTTCCAGGTGTTCTAAGG + Intronic
1199612293 X:149628834-149628856 ACTGCTTTCCTGGTGGTCTGTGG - Intronic
1200000558 X:153057689-153057711 CCTGCTCTCCAGGTGGTCAGTGG + Exonic
1201935541 Y:19407254-19407276 ACTGCTCTCCAGATGGTGTCTGG + Intergenic