ID: 1057182831

View in Genome Browser
Species Human (GRCh38)
Location 9:93039136-93039158
Sequence GGCTGGCGGTTCTGAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057182831_1057182847 17 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182847 9:93039176-93039198 CTTGGCACATGCTGTTCCCTGGG No data
1057182831_1057182835 -8 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182835 9:93039151-93039173 CGCCAGCCTCCTTTCCCCCTGGG No data
1057182831_1057182836 -7 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182836 9:93039152-93039174 GCCAGCCTCCTTTCCCCCTGGGG No data
1057182831_1057182850 24 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182850 9:93039183-93039205 CATGCTGTTCCCTGGGCCCGGGG No data
1057182831_1057182846 16 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182846 9:93039175-93039197 CCTTGGCACATGCTGTTCCCTGG No data
1057182831_1057182849 23 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182849 9:93039182-93039204 ACATGCTGTTCCCTGGGCCCGGG No data
1057182831_1057182851 25 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182851 9:93039184-93039206 ATGCTGTTCCCTGGGCCCGGGGG No data
1057182831_1057182839 -1 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182839 9:93039158-93039180 CTCCTTTCCCCCTGGGGCCTTGG No data
1057182831_1057182848 22 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182848 9:93039181-93039203 CACATGCTGTTCCCTGGGCCCGG No data
1057182831_1057182834 -9 Left 1057182831 9:93039136-93039158 CCTGGCCTTCAGAACCGCCAGCC No data
Right 1057182834 9:93039150-93039172 CCGCCAGCCTCCTTTCCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057182831 Original CRISPR GGCTGGCGGTTCTGAAGGCC AGG (reversed) Intergenic
No off target data available for this crispr