ID: 1057184909

View in Genome Browser
Species Human (GRCh38)
Location 9:93052002-93052024
Sequence GTGATGAGCCGGCCTGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057184901_1057184909 19 Left 1057184901 9:93051960-93051982 CCTAGGGAGAGTAGTCAACAGCC No data
Right 1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG No data
1057184903_1057184909 -2 Left 1057184903 9:93051981-93052003 CCTGCACCAGAGTGTCGGCCTGT No data
Right 1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG No data
1057184904_1057184909 -8 Left 1057184904 9:93051987-93052009 CCAGAGTGTCGGCCTGTGATGAG No data
Right 1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG No data
1057184899_1057184909 23 Left 1057184899 9:93051956-93051978 CCGCCCTAGGGAGAGTAGTCAAC No data
Right 1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG No data
1057184900_1057184909 20 Left 1057184900 9:93051959-93051981 CCCTAGGGAGAGTAGTCAACAGC No data
Right 1057184909 9:93052002-93052024 GTGATGAGCCGGCCTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057184909 Original CRISPR GTGATGAGCCGGCCTGGGAA TGG Intergenic
No off target data available for this crispr