ID: 1057185175

View in Genome Browser
Species Human (GRCh38)
Location 9:93053360-93053382
Sequence GCCGCCAAGTGCCTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057185175_1057185181 5 Left 1057185175 9:93053360-93053382 CCAGTGACCAGGCACTTGGCGGC No data
Right 1057185181 9:93053388-93053410 CTGCTCGCTACGCAGGTGCCGGG No data
1057185175_1057185183 25 Left 1057185175 9:93053360-93053382 CCAGTGACCAGGCACTTGGCGGC No data
Right 1057185183 9:93053408-93053430 GGGCATCAAAGAAGCTTAACTGG No data
1057185175_1057185180 4 Left 1057185175 9:93053360-93053382 CCAGTGACCAGGCACTTGGCGGC No data
Right 1057185180 9:93053387-93053409 GCTGCTCGCTACGCAGGTGCCGG No data
1057185175_1057185177 -2 Left 1057185175 9:93053360-93053382 CCAGTGACCAGGCACTTGGCGGC No data
Right 1057185177 9:93053381-93053403 GCCCACGCTGCTCGCTACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057185175 Original CRISPR GCCGCCAAGTGCCTGGTCAC TGG (reversed) Intergenic
No off target data available for this crispr