ID: 1057185272

View in Genome Browser
Species Human (GRCh38)
Location 9:93053958-93053980
Sequence CAAGGCGCCCAGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057185272_1057185276 13 Left 1057185272 9:93053958-93053980 CCTTCTGCCCTCTGGGCGCCTTG No data
Right 1057185276 9:93053994-93054016 CATCACCATTTCTGAACCTGAGG No data
1057185272_1057185278 17 Left 1057185272 9:93053958-93053980 CCTTCTGCCCTCTGGGCGCCTTG No data
Right 1057185278 9:93053998-93054020 ACCATTTCTGAACCTGAGGGCGG No data
1057185272_1057185277 14 Left 1057185272 9:93053958-93053980 CCTTCTGCCCTCTGGGCGCCTTG No data
Right 1057185277 9:93053995-93054017 ATCACCATTTCTGAACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057185272 Original CRISPR CAAGGCGCCCAGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr