ID: 1057185537

View in Genome Browser
Species Human (GRCh38)
Location 9:93055625-93055647
Sequence CTCCATGGAGCCCTCCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057185537_1057185545 16 Left 1057185537 9:93055625-93055647 CCATCAGGGAGGGCTCCATGGAG No data
Right 1057185545 9:93055664-93055686 GCAAGGAGACACACCCAAGCAGG No data
1057185537_1057185543 -6 Left 1057185537 9:93055625-93055647 CCATCAGGGAGGGCTCCATGGAG No data
Right 1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG No data
1057185537_1057185541 -10 Left 1057185537 9:93055625-93055647 CCATCAGGGAGGGCTCCATGGAG No data
Right 1057185541 9:93055638-93055660 CTCCATGGAGAAGGAGGGTGAGG No data
1057185537_1057185544 -1 Left 1057185537 9:93055625-93055647 CCATCAGGGAGGGCTCCATGGAG No data
Right 1057185544 9:93055647-93055669 GAAGGAGGGTGAGGAAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057185537 Original CRISPR CTCCATGGAGCCCTCCCTGA TGG (reversed) Intergenic
No off target data available for this crispr