ID: 1057185543

View in Genome Browser
Species Human (GRCh38)
Location 9:93055642-93055664
Sequence ATGGAGAAGGAGGGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057185537_1057185543 -6 Left 1057185537 9:93055625-93055647 CCATCAGGGAGGGCTCCATGGAG No data
Right 1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057185543 Original CRISPR ATGGAGAAGGAGGGTGAGGA AGG Intergenic
No off target data available for this crispr