ID: 1057186828

View in Genome Browser
Species Human (GRCh38)
Location 9:93061807-93061829
Sequence GACCCAGATTGAGGTCACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057186821_1057186828 12 Left 1057186821 9:93061772-93061794 CCTGAAGGTTCCTGTTTCACATT 0: 1
1: 0
2: 1
3: 20
4: 169
Right 1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG No data
1057186826_1057186828 2 Left 1057186826 9:93061782-93061804 CCTGTTTCACATTTGGGGGAACT 0: 1
1: 1
2: 3
3: 42
4: 424
Right 1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG No data
1057186820_1057186828 15 Left 1057186820 9:93061769-93061791 CCTCCTGAAGGTTCCTGTTTCAC 0: 1
1: 0
2: 0
3: 12
4: 189
Right 1057186828 9:93061807-93061829 GACCCAGATTGAGGTCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057186828 Original CRISPR GACCCAGATTGAGGTCACAC AGG Intronic
No off target data available for this crispr