ID: 1057190723

View in Genome Browser
Species Human (GRCh38)
Location 9:93085889-93085911
Sequence GGAGTTGCAATGTGAGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057190717_1057190723 16 Left 1057190717 9:93085850-93085872 CCTGGGCTTCCTCACAACATGGC 0: 11
1: 40
2: 89
3: 131
4: 328
Right 1057190723 9:93085889-93085911 GGAGTTGCAATGTGAGCACCAGG No data
1057190722_1057190723 -9 Left 1057190722 9:93085875-93085897 CCGGCGTTCAAGGTGGAGTTGCA No data
Right 1057190723 9:93085889-93085911 GGAGTTGCAATGTGAGCACCAGG No data
1057190719_1057190723 7 Left 1057190719 9:93085859-93085881 CCTCACAACATGGCAGCCGGCGT No data
Right 1057190723 9:93085889-93085911 GGAGTTGCAATGTGAGCACCAGG No data
1057190715_1057190723 26 Left 1057190715 9:93085840-93085862 CCTCATGTGGCCTGGGCTTCCTC 0: 4
1: 7
2: 25
3: 75
4: 377
Right 1057190723 9:93085889-93085911 GGAGTTGCAATGTGAGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057190723 Original CRISPR GGAGTTGCAATGTGAGCACC AGG Intergenic
No off target data available for this crispr