ID: 1057191870

View in Genome Browser
Species Human (GRCh38)
Location 9:93092882-93092904
Sequence CTTGGAAGGCAGAGCCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057191857_1057191870 29 Left 1057191857 9:93092830-93092852 CCAGGCAAGACATAACAGGGATG No data
Right 1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057191870 Original CRISPR CTTGGAAGGCAGAGCCCACA GGG Intergenic
No off target data available for this crispr