ID: 1057192275

View in Genome Browser
Species Human (GRCh38)
Location 9:93094793-93094815
Sequence TGCCAGAGCCTGACCCGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057192275_1057192284 22 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192284 9:93094838-93094860 GGGAACGGCCCACACAGGCAGGG No data
1057192275_1057192283 21 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192283 9:93094837-93094859 GGGGAACGGCCCACACAGGCAGG No data
1057192275_1057192280 2 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192280 9:93094818-93094840 TCAAATTAGAGCTGCTATGGGGG No data
1057192275_1057192277 -1 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192277 9:93094815-93094837 ATCTCAAATTAGAGCTGCTATGG No data
1057192275_1057192285 26 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192285 9:93094842-93094864 ACGGCCCACACAGGCAGGGAAGG No data
1057192275_1057192279 1 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192279 9:93094817-93094839 CTCAAATTAGAGCTGCTATGGGG No data
1057192275_1057192281 7 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192281 9:93094823-93094845 TTAGAGCTGCTATGGGGGAACGG No data
1057192275_1057192278 0 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192278 9:93094816-93094838 TCTCAAATTAGAGCTGCTATGGG No data
1057192275_1057192282 17 Left 1057192275 9:93094793-93094815 CCATTCCGGGTCAGGCTCTGGCA No data
Right 1057192282 9:93094833-93094855 TATGGGGGAACGGCCCACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057192275 Original CRISPR TGCCAGAGCCTGACCCGGAA TGG (reversed) Intergenic
No off target data available for this crispr