ID: 1057194797

View in Genome Browser
Species Human (GRCh38)
Location 9:93110951-93110973
Sequence CATGAGAGAGAGACGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1977
Summary {0: 1, 1: 0, 2: 5, 3: 164, 4: 1807}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057194797_1057194801 -3 Left 1057194797 9:93110951-93110973 CCTTCCTCCGTCTCTCTCTCATG 0: 1
1: 0
2: 5
3: 164
4: 1807
Right 1057194801 9:93110971-93110993 ATGGCAGTTTTCACACAGCATGG 0: 1
1: 0
2: 2
3: 16
4: 253
1057194797_1057194802 -2 Left 1057194797 9:93110951-93110973 CCTTCCTCCGTCTCTCTCTCATG 0: 1
1: 0
2: 5
3: 164
4: 1807
Right 1057194802 9:93110972-93110994 TGGCAGTTTTCACACAGCATGGG 0: 1
1: 0
2: 2
3: 19
4: 203
1057194797_1057194803 -1 Left 1057194797 9:93110951-93110973 CCTTCCTCCGTCTCTCTCTCATG 0: 1
1: 0
2: 5
3: 164
4: 1807
Right 1057194803 9:93110973-93110995 GGCAGTTTTCACACAGCATGGGG 0: 1
1: 0
2: 0
3: 28
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057194797 Original CRISPR CATGAGAGAGAGACGGAGGA AGG (reversed) Intronic
900181844 1:1314579-1314601 CATGAGAGACAGAAGGAGCCTGG + Intronic
900324700 1:2102876-2102898 CTTGAGAGAGAGACAGACGGGGG - Intronic
900408821 1:2503857-2503879 CAGAAGAGAGAGAGGGAGGCAGG - Intronic
900819892 1:4878625-4878647 CATGGGAGAAAGATGGAGGCTGG - Intergenic
900892300 1:5458339-5458361 AAGGAGGGAGAGAAGGAGGAAGG - Intergenic
901198983 1:7456140-7456162 CATAACAGAGGGATGGAGGAAGG + Intronic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901519097 1:9769018-9769040 AATGAGGGAGAGAGGGAGAAAGG + Intronic
901639320 1:10685494-10685516 GATGAGAGAGAGAGGGAGGAAGG - Intronic
901649341 1:10734675-10734697 AAAGAGAGAGAGAGGGAGAAGGG + Intronic
901761930 1:11477500-11477522 CATGTGAGAGGGTGGGAGGAGGG - Intergenic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902113182 1:14099959-14099981 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
902398294 1:16144135-16144157 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903106408 1:21084363-21084385 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
903268698 1:22174348-22174370 CAGGAGAGAGGGATGGAAGAAGG - Intergenic
903298344 1:22360414-22360436 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903733486 1:25515172-25515194 CACGAGGGAGAGTGGGAGGAAGG - Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904118093 1:28176939-28176961 CATGAGAGTGAGAAAGAGGAGGG + Exonic
904335413 1:29794107-29794129 CAGGAGGGAGAGAGGGAGGGAGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904995097 1:34625601-34625623 CATGTGTGAGAGTTGGAGGAAGG - Intergenic
906005664 1:42467535-42467557 TATGAAATAGAGAAGGAGGAGGG + Intronic
906065342 1:42976466-42976488 AATGAGGGAGGGAGGGAGGAAGG + Intergenic
906275215 1:44510249-44510271 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
906287550 1:44597446-44597468 CATGAGAGAGAGAGAGAGAAGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906893546 1:49744289-49744311 CAAGAGAGAGAGAGAGAGGGTGG - Intronic
907082412 1:51636130-51636152 CAAGAGAGAGAGAGGAAGGAAGG - Intronic
907437368 1:54458550-54458572 CAAGAGAGAGGGAGGGAGGGAGG + Intergenic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907548439 1:55283674-55283696 CATGAGAGAGAGAGAGAGGTAGG - Intergenic
907588077 1:55639402-55639424 AATGAGAGAGACACAGAGCAAGG - Intergenic
907622359 1:55994662-55994684 AATGGGAGAGAGACGAGGGATGG - Intergenic
907683751 1:56589933-56589955 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
907940912 1:59086040-59086062 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
908061346 1:60353068-60353090 CTTGAGGGAGGGAGGGAGGAAGG - Intergenic
908230537 1:62100416-62100438 CATGAGGCAGAGAGGGAGGGGGG + Intronic
908250275 1:62260277-62260299 TCAGAGAGAGAGAAGGAGGAAGG - Intronic
908252451 1:62275831-62275853 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
908348182 1:63257542-63257564 CAGGAGAGAGAGACTGGGGAGGG - Intergenic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
909046835 1:70720631-70720653 CAAGAGAGAGGGAAGGAGGGAGG - Intergenic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909197558 1:72647342-72647364 CAAGAGAGAGAGAGACAGGAGGG + Intergenic
909288733 1:73854915-73854937 CGGGAGGGAGAGAGGGAGGAAGG + Intergenic
909344034 1:74564649-74564671 CAGGAGAGAGAGAGAGAGCAAGG + Intergenic
909361934 1:74770392-74770414 TATGAGAGAGAGAGAGAGAATGG - Intergenic
909434016 1:75619226-75619248 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909779046 1:79519976-79519998 TATGAGAGAGAGGGGGAGGGGGG + Intergenic
909954016 1:81754697-81754719 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
909977648 1:82064189-82064211 CTTGAGAGAGAGCCTGAGAAAGG + Intergenic
910536184 1:88300489-88300511 CAGGAGAGAGAGATGCTGGAGGG - Intergenic
910556599 1:88541464-88541486 CAAGAGAGAGAGAGAGAGGAGGG + Intergenic
910588555 1:88904325-88904347 CATGGGAGAAAGATGGAGGCTGG - Intergenic
910731145 1:90398766-90398788 CAGGAGAGAGAGAGGGAGCAAGG + Intergenic
910741041 1:90516846-90516868 CATGATAGAGAAAGGGAGGACGG + Intergenic
910831821 1:91469068-91469090 CATGGGAGAAAGACAGAGGCTGG + Intergenic
910928181 1:92417441-92417463 AGAGAGAGAGAGACGGAAGAAGG + Intergenic
911369422 1:96978790-96978812 CATGGGAGAGAAATGGAGGCAGG - Intergenic
911526532 1:98994181-98994203 GATGAGAGAGGGAGGGAGAAAGG + Intronic
911636105 1:100238091-100238113 CTTGAGGGAGGGAGGGAGGAAGG - Intronic
911716277 1:101137051-101137073 ATTGAGAGAGAGAGGGAGGGAGG - Intergenic
912028374 1:105206761-105206783 CAAGAGAGAGAGACAGTGAATGG + Intergenic
912614453 1:111084127-111084149 CAGGAGAGAGAGAAGCATGAAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913272890 1:117111470-117111492 CATGGCATAGAGACGGAGTAGGG + Exonic
914003685 1:143714546-143714568 AAAGAGAGAGAGATAGAGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
915004423 1:152623298-152623320 CAGGGGAGAGGGCCGGAGGAAGG - Intergenic
915525475 1:156473475-156473497 CATGTGAGAGAACCTGAGGAAGG + Intronic
915546187 1:156599455-156599477 CCTGAGCCAGAGACAGAGGAAGG + Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915720552 1:157982058-157982080 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
915949648 1:160180454-160180476 TATGAGAGAGAGACTGCAGAGGG - Intronic
916081653 1:161237173-161237195 AATAAGAGAGGGAGGGAGGAAGG - Intronic
916512120 1:165481816-165481838 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916759312 1:167802295-167802317 CAGGAGAGAGAGAGTGAGGGTGG + Intergenic
916796538 1:168172623-168172645 CATCAGAGAGAGAAGGAGCTGGG - Intergenic
917005115 1:170406498-170406520 CATGGGAGAAAGACGTAGGCTGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
917400376 1:174642684-174642706 AAAGAGAGAGAGACAGAGAAAGG - Intronic
917641089 1:176983778-176983800 CTTGAGAGAGAGAAAGAGGCTGG - Intronic
917665333 1:177220438-177220460 CAAGAGAGAGAGAGAGAGGTGGG - Intronic
917727012 1:177837863-177837885 TGTGAGAGAGAGACAGAGGGAGG - Intergenic
917914845 1:179690939-179690961 CATGAGGGAGGGAGGGAGGAGGG + Exonic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918204341 1:182295900-182295922 CAAGAGAGACAGAGGAAGGAAGG - Intergenic
918204342 1:182295904-182295926 CAAGCAAGAGAGACAGAGGAAGG - Intergenic
918621099 1:186606781-186606803 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
918683633 1:187387638-187387660 CAAGAGAGAGAAAGGGAGCAAGG + Intergenic
919510193 1:198453538-198453560 CATTAGAGAGAGAATGTGGAAGG - Intergenic
919732549 1:200922524-200922546 CATGAGAGAGAGACTGCCGGGGG + Intergenic
919841078 1:201609850-201609872 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
920049721 1:203156237-203156259 GGTGTGAGAGAGAGGGAGGAGGG + Intronic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920112333 1:203595933-203595955 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
920169756 1:204064566-204064588 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
920169760 1:204064617-204064639 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
920523742 1:206649675-206649697 CATGGGAGAGGAAAGGAGGAGGG - Intronic
920537955 1:206752562-206752584 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
920618947 1:207525055-207525077 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920620727 1:207543611-207543633 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920622509 1:207562168-207562190 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
921488118 1:215740180-215740202 AATGAGGGAGAGATGGAGGGAGG - Intronic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
921669773 1:217912746-217912768 CAGGAGAGAGACAGAGAGGAGGG - Intergenic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
921833995 1:219759366-219759388 AGGGAGAGAGAGAGGGAGGAGGG + Intronic
921838120 1:219799134-219799156 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
921914094 1:220587304-220587326 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922456115 1:225774959-225774981 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
922964997 1:229682112-229682134 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
923037206 1:230292600-230292622 GTTGAGAGAGAGAGGGAGGGAGG - Intergenic
923084734 1:230694785-230694807 CATGGGAGAGAGACAGAGAAGGG + Intergenic
923263295 1:232288008-232288030 CAAGAGAGAGAAAGGAAGGAAGG + Intergenic
923324230 1:232866669-232866691 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
923369498 1:233295911-233295933 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
923459254 1:234194440-234194462 CAGGAGAGAGGGTGGGAGGAGGG + Intronic
923472447 1:234304101-234304123 AATGAGAGAGAGAGGGAGAGAGG - Intronic
923718446 1:236447118-236447140 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
924130668 1:240904540-240904562 AATTTGAGAGAGACAGAGGAAGG - Intronic
924158583 1:241206915-241206937 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
924469849 1:244332950-244332972 AAAGAGAGAGAGACGGAGGGAGG + Intergenic
1063010635 10:2019218-2019240 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1063071358 10:2669704-2669726 CAAGAGAGAAAGAGGAAGGAAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063194406 10:3727742-3727764 CAGGAGGGAGAGAGGGAGAAAGG - Intergenic
1063225644 10:4013058-4013080 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1063470837 10:6283530-6283552 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1063525282 10:6778981-6779003 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1063605370 10:7518752-7518774 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1063700843 10:8383963-8383985 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
1063713135 10:8500166-8500188 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1063907063 10:10792032-10792054 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1063917045 10:10893735-10893757 CAGGAGCAAGAGACGGACGAGGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064281356 10:13954484-13954506 CATGAGAGAGACCCGGTGGGAGG - Intronic
1064333240 10:14414365-14414387 AAAGAGAGAGAGAGGCAGGAAGG + Intronic
1064333260 10:14414422-14414444 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1064504703 10:16015825-16015847 GAAGGGAGAGAGAGGGAGGATGG + Intergenic
1064627967 10:17280940-17280962 GAAGAGAGAGAGACTGAGGGGGG + Intergenic
1064769055 10:18705094-18705116 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1064794085 10:18991588-18991610 CATGAGAGAGACCCGGTGGGAGG - Intergenic
1064949222 10:20828683-20828705 CATGTGAGAGGGAGGGAGGGAGG + Intronic
1065120069 10:22520707-22520729 CATGAGAGAGAGAGGGAGGGAGG - Intergenic
1065223001 10:23515018-23515040 AAAGAGAGAGAGAGAGAGGATGG - Intergenic
1065671120 10:28119121-28119143 AATGAGAGAAAGACAAAGGATGG - Intronic
1065699209 10:28408407-28408429 AAAGAGAGAGAGACGGAGAAAGG - Intergenic
1065850139 10:29780931-29780953 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1065942520 10:30577789-30577811 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1066043466 10:31576717-31576739 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1066458833 10:35595545-35595567 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1066728907 10:38419098-38419120 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1067460063 10:46451611-46451633 CATGAGAGAGAGACAGAGAGAGG - Intergenic
1067627127 10:47933002-47933024 CATGAGAGAGAGACAGAGAGAGG + Intergenic
1067768247 10:49105316-49105338 AAAGAGAGAGAGACGGGGGGGGG + Intronic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1068051593 10:51956965-51956987 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1068147861 10:53093940-53093962 CAGGAGCGAGAGAGAGAGGAGGG - Intergenic
1068192913 10:53676470-53676492 CATGAAAGAGAGAGGGAGAGTGG - Intergenic
1068530475 10:58180365-58180387 GAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1068807966 10:61221641-61221663 GATGAGAGAGAAAGAGAGGAAGG + Intergenic
1068830647 10:61491158-61491180 AAAGAAAGAGAGAGGGAGGAAGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069065963 10:63942152-63942174 CATGAGAGAGATAGGGAGATAGG + Intergenic
1069138390 10:64794018-64794040 CAAGAAAGAGAGAAGGAAGAAGG - Intergenic
1069141357 10:64830060-64830082 CCTGAGAGAGAGAGAGAGGCTGG - Intergenic
1069360308 10:67633862-67633884 CCTGAAAGAGACAGGGAGGATGG + Intronic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069796421 10:71055046-71055068 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1070427719 10:76305415-76305437 CATGAAAGAAAGAAAGAGGAAGG - Intronic
1070703928 10:78623538-78623560 AGTGAGAGAGAGAGGAAGGAAGG + Intergenic
1070962715 10:80510053-80510075 CATGAGAGAGATAAGAGGGATGG - Intronic
1071033076 10:81207423-81207445 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1071160687 10:82742109-82742131 CAGACGAGAGAGAGGGAGGAAGG - Intronic
1071378707 10:85035968-85035990 CATGGGAGAAAGATGTAGGATGG - Intergenic
1071393590 10:85199652-85199674 AGTGAGAGAGGGAAGGAGGAAGG + Intergenic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1072248280 10:93562004-93562026 AAAGAGAGAGAGAAGGAGGGAGG + Intergenic
1072455595 10:95572891-95572913 GATGAGAGAGAGAGGGAGGGAGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072612044 10:97023956-97023978 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1072713121 10:97731012-97731034 AAAGAGAGAGAGATGGAGGCTGG + Intergenic
1072870929 10:99119086-99119108 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1073055322 10:100696490-100696512 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1073086732 10:100895874-100895896 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1073701594 10:105933966-105933988 CAAGAGAGAGTGATGGGGGAAGG - Intergenic
1073753031 10:106551194-106551216 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1073806629 10:107105617-107105639 CATGGGAGAAAGATGGAGGCCGG + Intronic
1073859512 10:107721572-107721594 CAGGAGAGAGAGAGAGAGCAGGG - Intergenic
1073940003 10:108686093-108686115 AGAGAGAGAGAGAGGGAGGAGGG + Intergenic
1074641941 10:115395015-115395037 CTAGAGAGAGAGAGGCAGGAAGG - Intronic
1074828014 10:117228543-117228565 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1075076303 10:119352935-119352957 CAGGGGAGAGAGAGGGAGGACGG - Intronic
1075105588 10:119538167-119538189 GAGGAGAGAGGGATGGAGGAAGG + Intronic
1075769803 10:124923711-124923733 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1076049491 10:127321235-127321257 GAGGAGAGAGAGGGGGAGGACGG - Intronic
1076053995 10:127356605-127356627 CATGAGAGAGAGAGAGAGGCAGG + Intronic
1076086083 10:127633608-127633630 CAAGAGAGAGAGAGTGAGGGGGG + Intergenic
1076130108 10:128008244-128008266 AATGAGGGAGAGAGGGAGGGAGG - Intronic
1076160712 10:128242526-128242548 CATGACAGAGACACAAAGGATGG - Intergenic
1076182406 10:128420520-128420542 CAGGAGAGAGAGAGGGCGCAGGG + Intergenic
1076302031 10:129435780-129435802 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1076304867 10:129458844-129458866 GATGAGAGAGGGAGAGAGGAGGG - Intergenic
1076435267 10:130436801-130436823 CAAGAGAGAGAGAGAGGGGAGGG - Intergenic
1076473793 10:130738511-130738533 CATGAGACAAGGAGGGAGGAGGG - Intergenic
1076558735 10:131347121-131347143 AATGAGAGAAAGAGGAAGGAAGG - Intergenic
1076676726 10:132150941-132150963 GATGATAGATAGATGGAGGATGG - Intronic
1076681372 10:132173203-132173225 GATGAGAGAGAGAGGGAAGGAGG - Intronic
1077439054 11:2559842-2559864 CCAGAGACAGAGAGGGAGGAAGG - Intronic
1077465153 11:2730502-2730524 CATAAGAGAAAGAGGGAGGAAGG - Intronic
1077543486 11:3158680-3158702 CAGGAGAGAGGGAGGGAGGAAGG + Intronic
1077728034 11:4696384-4696406 GATGAGAGAGAGAAAGAGGAGGG - Intronic
1077733700 11:4765218-4765240 CATGGCAGAGAAACTGAGGAAGG + Intronic
1077736970 11:4801467-4801489 AATGAGAGAGAGAAGGGGGAGGG + Intronic
1077739990 11:4835168-4835190 GAAGAGAGAGAGAGGGGGGAGGG - Intronic
1078024228 11:7679546-7679568 CAGGAGAGAGAGAATGAGGGAGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078393530 11:10957059-10957081 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1078544419 11:12236332-12236354 CATGAGAGAGGGAAGGAACAGGG - Intronic
1078550841 11:12279671-12279693 CAGCAGAGAGAGAGGCAGGAAGG - Intronic
1078580988 11:12539434-12539456 GATGAGAGAGCCAGGGAGGAGGG + Intergenic
1078757769 11:14227505-14227527 CCTGACAGAGAGCAGGAGGAGGG - Intronic
1078827168 11:14940335-14940357 CAGGAGAGAGAGAGGGGGAAGGG + Intronic
1078897887 11:15614105-15614127 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1078994919 11:16687314-16687336 CAAGAGAGAGAGTGGGTGGAAGG + Intronic
1079418919 11:20267942-20267964 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1079877786 11:25881496-25881518 CATGAGAGAGAGAGGCACCAGGG - Intergenic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1079964399 11:26963213-26963235 CAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1079991106 11:27248175-27248197 GATGGGAGAGAGAAGAAGGAAGG + Intergenic
1080117324 11:28635507-28635529 CAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1080313556 11:30923027-30923049 AGGGAGGGAGAGACGGAGGAAGG + Intronic
1080466056 11:32498360-32498382 CAGGAAAGAGAGACAGAGTAGGG + Intergenic
1080471073 11:32546248-32546270 CAAGAGAGAGAGGTGGGGGAGGG + Intergenic
1080790857 11:35521349-35521371 AATGAGAGGGAGAAGGTGGAAGG - Intronic
1081207244 11:40290778-40290800 GAAGAGGGAGAGAGGGAGGAAGG + Intronic
1081578586 11:44335214-44335236 AGGGAGAGAGAGAGGGAGGAAGG - Intergenic
1081641274 11:44755975-44755997 ATGGAGAGAGAGATGGAGGAGGG + Intronic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1081785427 11:45743434-45743456 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1081952026 11:47052574-47052596 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1082040816 11:47683374-47683396 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1082053851 11:47796501-47796523 ATTGAGAGAGAGAGGAAGGAAGG + Intronic
1082189261 11:49223001-49223023 CAGCAGAGAGAGACAGAGAAAGG - Intergenic
1082236560 11:49824693-49824715 CAAGAGAGAGAGAGAGAGGGAGG + Intergenic
1082240009 11:49859187-49859209 CAAGAGAGAGAGAGAGAGGGAGG + Intergenic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083370327 11:62173816-62173838 AAAGAGAGAGAGAAGAAGGAAGG - Intergenic
1083747465 11:64743926-64743948 TGTGTGTGAGAGACGGAGGATGG - Intronic
1083755950 11:64791846-64791868 CATGAGAGACCGAGGGAGGGAGG - Intronic
1083902033 11:65647848-65647870 GAGGAGAGAGAGAGGAAGGAAGG - Intronic
1084021528 11:66420838-66420860 AATGAGAGAGGGAGGGAGGCGGG - Intergenic
1084021878 11:66422612-66422634 GCTGAGAGAGAGACAGTGGATGG - Intronic
1084337689 11:68470434-68470456 CCTGAGGGAGAGTGGGAGGAGGG + Intronic
1084453880 11:69256285-69256307 CAGGAGAGAGAGCGCGAGGAAGG + Intergenic
1085314897 11:75538863-75538885 CTTGAGAGAGAACAGGAGGAAGG + Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085569543 11:77547329-77547351 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1085748654 11:79138147-79138169 CATGAGAGAAAGATGTAGGCTGG - Intronic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1085937971 11:81172719-81172741 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1085983671 11:81757351-81757373 GGAGAGAGAGAGAAGGAGGAAGG + Intergenic
1086049218 11:82569037-82569059 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1086333796 11:85779919-85779941 CAAGAGAGAGAGACTGAGCTGGG - Intronic
1086432608 11:86749698-86749720 CATGATAGAGTGAAGGAGAAGGG + Intergenic
1086670066 11:89535580-89535602 AAGGAGAGAGAGACAGAAGAGGG - Intergenic
1086677262 11:89623605-89623627 CAGCAGAGAGAGACAGAGAAAGG + Intergenic
1087211504 11:95449886-95449908 CATGAGAAAGATACAGAGGGAGG + Intergenic
1087366937 11:97232004-97232026 CATGAGAGAAAGATGAAGGCTGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1087576524 11:99996793-99996815 CAGGAGAGAGAGAGGGAGCATGG + Intronic
1087736925 11:101844670-101844692 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1087805895 11:102555058-102555080 GATCAGAGAGACAGGGAGGAAGG - Intergenic
1087817916 11:102679380-102679402 CAAGAGAGAGAGTAGGAGGAGGG + Intergenic
1088381277 11:109195117-109195139 AAAGAGAGAGAGAAAGAGGAAGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088741375 11:112770119-112770141 CATGAGGGTCAGACTGAGGACGG + Intergenic
1088904991 11:114148416-114148438 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1089145617 11:116327834-116327856 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
1089558533 11:119330575-119330597 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1089582279 11:119488936-119488958 CAAGAGAGAGAGGTGGGGGAGGG + Intergenic
1089587391 11:119519245-119519267 GATGAGAGAGAGAGAGAGGAGGG + Intergenic
1089687617 11:120166755-120166777 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1089878506 11:121749930-121749952 AATGAGAGAATGAAGGAGGATGG + Intergenic
1089960767 11:122615474-122615496 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1090018351 11:123105396-123105418 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1090183396 11:124719998-124720020 AGAGAGAGAGAGAAGGAGGAAGG + Intergenic
1090347586 11:126083604-126083626 AAAGAGAGAGAGACAGAGGTAGG - Intergenic
1090569481 11:128031009-128031031 GAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1090580403 11:128152885-128152907 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090580420 11:128152929-128152951 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090625014 11:128599622-128599644 CCTGAGAGAGAGTCTGAGAAAGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090833720 11:130438630-130438652 AAAGAGAGAGAGAGGGAGAAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091119830 11:133047666-133047688 AGTGGCAGAGAGACGGAGGAGGG - Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091370401 11:135052658-135052680 AAAGAGAGAGAGACCGAGGTGGG - Intergenic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091665924 12:2418542-2418564 GAGGAGAGAGAGGAGGAGGAGGG + Intronic
1091703413 12:2678653-2678675 GATGAGGAAGAGACGGAGCAGGG - Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1092231519 12:6778209-6778231 ATGGAGAGAGAGACGGAGGGCGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092566605 12:9672670-9672692 CCTGAAAGAGACAGGGAGGATGG - Intronic
1092692684 12:11131186-11131208 CATGGAAGAGAGAGAGAGGAGGG - Intronic
1092776565 12:11949337-11949359 CATGACCGAGAAAGGGAGGATGG + Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1092848662 12:12607566-12607588 CATGACACAGAGACTGAGAAAGG - Intergenic
1092893703 12:12993162-12993184 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1093141281 12:15513030-15513052 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1093176627 12:15920013-15920035 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093814671 12:23530836-23530858 CATGTGAGAGAGAGAGAGAAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094125519 12:27018878-27018900 CAGGAGGGAGAGAAGGAGGAAGG + Intergenic
1094166172 12:27446281-27446303 GGGGAGAGAGAGATGGAGGAGGG + Intergenic
1094347526 12:29487068-29487090 CATGAGAAAGCGATGGAGGATGG + Intronic
1094408345 12:30143394-30143416 CATGAGAGAGAGAAAGAGAGAGG - Intergenic
1095095913 12:38149110-38149132 GAAAAGAGACAGACGGAGGAAGG - Intergenic
1095314065 12:40737520-40737542 CATGGGAGAAAGACGTAGGCTGG + Intronic
1095449844 12:42318759-42318781 AGAGAGAGAGAGACGGAGGGAGG + Intronic
1095695481 12:45139013-45139035 CATGAGAGAAAGGAGGAGGAAGG - Intergenic
1095779967 12:46048655-46048677 CCTGAGATAGAGATGGAGCAGGG + Intergenic
1095903644 12:47354893-47354915 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096733335 12:53632310-53632332 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1096775918 12:53964051-53964073 CTAGAGAGAGAGCCAGAGGAGGG - Intergenic
1097058623 12:56266324-56266346 CATGAGAGAAAGACGAAGGCCGG - Intergenic
1097313633 12:58149199-58149221 CAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1097377572 12:58858276-58858298 GAGGAGAGAGAGAGGGAAGAGGG - Intergenic
1097589932 12:61562310-61562332 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1097718904 12:62999334-62999356 GGTGAAAGAGAGAAGGAGGAGGG + Intergenic
1097747311 12:63315460-63315482 AAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1098302520 12:69068823-69068845 CCTGGGAGAGAGATGGTGGAGGG + Intergenic
1098325475 12:69297755-69297777 CAAGAGAGAGAGAGAGAGGTGGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098460768 12:70730839-70730861 AATGAGAGAGAGCAGAAGGAAGG + Intronic
1098460812 12:70731119-70731141 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1098521008 12:71435628-71435650 CAGGAGAGAGAGAGGGTGAATGG + Intronic
1098529843 12:71529343-71529365 CAGGAGAGAGAGAGCGAGGGGGG + Intronic
1098750148 12:74282169-74282191 CATGAGAGAAAGATGTAGGCTGG - Intergenic
1098824159 12:75271765-75271787 CATGGGAGAAAGATGGAGGCCGG + Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099059094 12:77883642-77883664 AATGAGAGAGAGAAAGAGTATGG + Intronic
1099230254 12:80014920-80014942 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1099407299 12:82280523-82280545 CATGGGAGAGAGATGAAGGCTGG - Intronic
1099784161 12:87238766-87238788 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1099910952 12:88832770-88832792 CATGAGAGAGAGGTGGAGGTGGG + Intergenic
1100101153 12:91107370-91107392 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1100241612 12:92715206-92715228 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1100262866 12:92949462-92949484 AAAGAGGGAGAGAGGGAGGAAGG + Intergenic
1100521261 12:95378403-95378425 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1100569812 12:95837200-95837222 CAGGAGAGAGAGAGGGAGAGAGG + Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1100677667 12:96885888-96885910 AATGAAAGAAAGAGGGAGGAAGG - Intergenic
1100706070 12:97201887-97201909 TATGAGAGAGAGACAGAGACAGG + Intergenic
1100820397 12:98423965-98423987 CATGACAGAGAGGCTGAGGCAGG + Intergenic
1101186640 12:102287806-102287828 CATGAAAGAGACAGGGAGAATGG - Intergenic
1101200235 12:102427820-102427842 CAGGAGAGAGGGAAGGAGGGAGG + Intronic
1101264468 12:103068707-103068729 CATGAGAGAAAGATGTAGGTTGG - Intergenic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101621725 12:106395401-106395423 CAAGAGAGCGTGAGGGAGGAGGG + Intronic
1101808504 12:108087011-108087033 GATGAGACAGAGAAGGAGGAAGG - Intergenic
1102136627 12:110581541-110581563 CATGAGAGGGAGACTTAGAAAGG - Intronic
1102249500 12:111376589-111376611 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102393943 12:112572586-112572608 GAGGAGAGAGAGAGGAAGGAAGG - Intronic
1102501151 12:113353538-113353560 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1102556407 12:113729582-113729604 CATGAGAGAGCAACAGAGGCTGG + Intergenic
1102598762 12:114012961-114012983 AAGGAGGGAGAGACGGAGGAGGG + Intergenic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1102673241 12:114637757-114637779 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
1102752436 12:115307194-115307216 TTTGAGAGAGAGAGAGAGGAGGG - Intergenic
1102754146 12:115323253-115323275 AAAGAGAGAGGGACGGAGGGAGG + Intergenic
1102789883 12:115636023-115636045 TATGAGAGAGGGAGAGAGGAGGG + Intergenic
1102907196 12:116685908-116685930 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1103247662 12:119471953-119471975 GAAGAGGGAGAGAGGGAGGAAGG - Intronic
1103256218 12:119543672-119543694 CAAGACAGAGAAAGGGAGGAGGG + Intergenic
1103497135 12:121371526-121371548 CAACAGAGAGAGAGAGAGGAAGG - Intronic
1103540350 12:121661886-121661908 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1103547245 12:121711081-121711103 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1103800981 12:123537000-123537022 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1104043883 12:125147925-125147947 CATGGGAGAAAGACGTAGGCTGG - Intergenic
1104140033 12:125979125-125979147 CAAGAGAGAGAAACTGAGGAAGG + Intergenic
1104191072 12:126482426-126482448 GAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1104280553 12:127372658-127372680 AATGAGAGAAAGAGGGAGGCAGG + Intergenic
1104365471 12:128172742-128172764 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1104382747 12:128322151-128322173 CAAGAGAGACAGATGGAGGCTGG - Intronic
1104386300 12:128354507-128354529 AAAGAGAGAGAGAAGAAGGAGGG - Intronic
1104439845 12:128785683-128785705 TATGAGTGAAAGACGGAGGCAGG - Intergenic
1104490353 12:129188720-129188742 AATGAGAGAGAGAGGGAAGGAGG + Intronic
1104494649 12:129225754-129225776 CAAGAGAGAGAGGAAGAGGAGGG + Intronic
1104590515 12:130081004-130081026 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1104753349 12:131253812-131253834 CAGGAGAGAGAGAGCGAGTAGGG - Intergenic
1104938116 12:132377776-132377798 GAAGAGAGAGAGATGGAGGGGGG + Intergenic
1104938195 12:132378279-132378301 GAAGAGAGAGAGATGGAGGGGGG + Intergenic
1105780381 13:23701037-23701059 CATGAGACAGGGACAAAGGAAGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106001868 13:25731231-25731253 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1106231728 13:27825941-27825963 CAGGAGAGAAAGGAGGAGGAAGG + Intergenic
1106262128 13:28077028-28077050 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1106548265 13:30749327-30749349 CATGAGAAAGAGAAGGAAGCAGG + Intronic
1106657709 13:31764221-31764243 AAAGAGAGAGAGACAGACGAGGG - Intronic
1106951200 13:34885694-34885716 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1106951220 13:34885839-34885861 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1107213060 13:37881428-37881450 AAGGAGAGAGAGAGAGAGGACGG + Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1108069646 13:46615315-46615337 CAAGAGAGAGCAAGGGAGGAGGG + Intronic
1108185043 13:47880377-47880399 AAAGAGAGAGGGAAGGAGGATGG + Intergenic
1108507549 13:51126430-51126452 GATGAGACAGAGACGCAGGAGGG + Intergenic
1108639828 13:52372692-52372714 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1108844396 13:54660145-54660167 CATGTGAGGGAGACTGAGGGAGG - Intergenic
1108907138 13:55490553-55490575 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109174280 13:59135936-59135958 AATGAGAGAGAAACAGTGGAAGG - Intergenic
1109551887 13:63914847-63914869 CAAGAGAGAGAAATGGGGGATGG + Intergenic
1109689433 13:65866450-65866472 CATGGGGGAGGGATGGAGGATGG - Intergenic
1110013942 13:70375792-70375814 CATGAGAGAAAGATGAAGGCTGG + Intergenic
1110215661 13:73021847-73021869 AAAGAGGGAGAGAAGGAGGACGG + Intergenic
1110237569 13:73232489-73232511 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1110583469 13:77159650-77159672 CAGGAGAGAGAGAAGGGGAAAGG - Intronic
1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG + Intergenic
1110704018 13:78584424-78584446 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1110745912 13:79053359-79053381 TAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1110842736 13:80161424-80161446 CAAGAGAGAGAGAAAGAGAATGG + Intergenic
1110940408 13:81341630-81341652 AAAGAGAGAGAAAGGGAGGAAGG + Intergenic
1111044531 13:82797184-82797206 CATGAGAGAAAGAAGAAGGCTGG - Intergenic
1111198858 13:84907459-84907481 CATGGGAGAAAGACGTAGGCTGG - Intergenic
1111305802 13:86410899-86410921 CCTGAAAGAGAGAGGGAGAATGG + Intergenic
1111360163 13:87165658-87165680 AAAGAGAGAGAGACAGAGAAGGG - Intergenic
1111567787 13:90039238-90039260 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1111712240 13:91831259-91831281 CATGAGAGAAAGATGCAGGCTGG + Intronic
1111955217 13:94749839-94749861 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1112184313 13:97113420-97113442 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1112367687 13:98769716-98769738 CAAGAGAGAGAGAGAGAGCAGGG + Intergenic
1112647814 13:101355060-101355082 CACGAGAGAGAGATAGTGGAGGG - Intronic
1112713744 13:102160081-102160103 TAGGAGAGTGAGATGGAGGAAGG - Intronic
1112881631 13:104113909-104113931 CAAGAAAGAGAGACGGAAAAAGG - Intergenic
1112962129 13:105139569-105139591 CATGAGAGAGAGAGGCAGAGCGG + Intergenic
1112967377 13:105213116-105213138 CAGGGGAGAGAGACGGATGGGGG - Intergenic
1113024095 13:105921464-105921486 TCTGAGAGAGAGACTGGGGAGGG + Intergenic
1113147236 13:107220863-107220885 TATGAGAAAGAGAGGGAGGAAGG + Intronic
1113159217 13:107360851-107360873 AATAAGAGAGAGAGGGAGGAGGG - Intronic
1113267256 13:108633449-108633471 CATGAGAGAAAGATGTAGGCTGG + Intronic
1113341961 13:109434460-109434482 AAAGAGAGAGAGACTGAGGCAGG + Intergenic
1113580568 13:111425793-111425815 CAAGAGTGAGAGACGGGAGAGGG - Intergenic
1113614507 13:111671081-111671103 GAAGAGAGAGGGAGGGAGGAAGG - Intronic
1113619975 13:111755995-111756017 GAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113808533 13:113123654-113123676 TGTGAGGGAGAGACGGAGCAGGG + Intronic
1114180697 14:20365240-20365262 CAAGAAAGAGAGAGGGAGGGCGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114330207 14:21629152-21629174 CAGGAGAGAGAGACAGTGAAGGG + Intergenic
1114379883 14:22191274-22191296 CATGGGAGAAAGATGAAGGATGG + Intergenic
1114402466 14:22422562-22422584 GAAGAGAGAGAGATGGATGAGGG - Intergenic
1114428617 14:22641308-22641330 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114632110 14:24165745-24165767 CATGATGGAGAGAGGTAGGAGGG - Intronic
1114632673 14:24169538-24169560 CGAGAGAGAGAGAGAGAGGAGGG - Intergenic
1114738198 14:25064964-25064986 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1114778394 14:25512491-25512513 CAGGAGAGAGAGAGTGAGCAAGG + Intergenic
1114792265 14:25672904-25672926 AATGAGAGAGAGAACGAGGGAGG + Intergenic
1115305727 14:31931652-31931674 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116002930 14:39263614-39263636 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1116020535 14:39454918-39454940 CAGGAGAGAGAGAGAAAGGAAGG + Intergenic
1116198569 14:41760679-41760701 GATGAGAGAGGGAGGGAGGAAGG + Intronic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116377432 14:44221273-44221295 GGAGAGAGAGAGACGGAGGGAGG + Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116414648 14:44665821-44665843 CATGAGAGAAAGATGTAGGCTGG - Intergenic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1116974125 14:51096268-51096290 AAAGAGGGAGAGAGGGAGGAAGG + Intergenic
1116982376 14:51185233-51185255 CAGGAGAGAGAGAGCAAGGAGGG + Intergenic
1117229273 14:53698762-53698784 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1117325460 14:54665036-54665058 CACGACACAGAGACAGAGGAAGG - Intronic
1117535422 14:56698284-56698306 CATGAGAGAAAGATGAAGGCTGG + Intronic
1117930299 14:60835000-60835022 AATGAGAGAGAGAGGGAGGGAGG - Intronic
1117983279 14:61363029-61363051 CGGGTGAGAGAGAAGGAGGAAGG + Intronic
1118331425 14:64818619-64818641 GAGGAGAGGGAGACAGAGGATGG + Intronic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1118502134 14:66371649-66371671 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
1118509227 14:66451988-66452010 CATGAGAGAGACAGAGAGGCAGG - Intergenic
1118620638 14:67611240-67611262 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1118769455 14:68932281-68932303 CACGGGAGAGAGATGGAGGCTGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119184764 14:72632578-72632600 AAGGAGAGAGAGAGGAAGGAGGG + Intronic
1119257229 14:73208932-73208954 CATGGGAGGGAGACTGAGGAGGG - Intronic
1119352053 14:73974013-73974035 TAAGTGAGAGAGAGGGAGGAAGG + Intronic
1119611347 14:76065493-76065515 CAAGGGAGAGAGAGGAAGGATGG - Intronic
1119659565 14:76440584-76440606 GTTGAGAGAGAGAGAGAGGAAGG - Intronic
1119693085 14:76692031-76692053 CAGGAGAGAGAAGCGGAGGCAGG + Intergenic
1119737166 14:76990310-76990332 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1119757873 14:77131550-77131572 AATGGGAGGGAGAGGGAGGAGGG - Exonic
1119867876 14:77989278-77989300 TATGAGAGAGAGAGAGAGGTGGG + Intergenic
1120235589 14:81886993-81887015 CATATGAGACAGACAGAGGATGG - Intergenic
1120255767 14:82117484-82117506 TATGAGAGGGAGATGGAGGAAGG + Intergenic
1120263656 14:82221059-82221081 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1120386887 14:83857738-83857760 CATTACAAAGAGACAGAGGAAGG - Intergenic
1120431698 14:84426312-84426334 ACAGAGAGAGAGACGGAGGAAGG - Intergenic
1120645139 14:87065021-87065043 CAGGAGAGAGAGCCAGAGGAGGG + Intergenic
1120901164 14:89576778-89576800 CAGTTGGGAGAGACGGAGGAGGG - Intronic
1120955696 14:90079977-90079999 GATGAGGGAGAGAAGGAGGGAGG + Intronic
1121532280 14:94663586-94663608 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1121629684 14:95413175-95413197 GAAGAGAGAGAAAAGGAGGAAGG - Intronic
1121779759 14:96614811-96614833 GCAGAGAGAGAGAGGGAGGAAGG + Intergenic
1121796597 14:96741305-96741327 AATGAGAGACAGGCGGAGGCAGG - Intergenic
1121870106 14:97399600-97399622 CAGGAGAGAGAGAGAGAGGTGGG + Intergenic
1121882585 14:97514316-97514338 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1122059974 14:99130537-99130559 CGAGAGAGAGAGAGGGAGGGAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122868496 14:104621878-104621900 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1123000353 14:105290711-105290733 CAAGACAGAGTGATGGAGGAGGG - Intronic
1123170288 14:106366835-106366857 TGTGAGAGAGAGAAGGAGGGAGG + Intergenic
1123184593 14:106504836-106504858 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1123189252 14:106552049-106552071 CAGGAGAGAGAGAAAGAGCAAGG - Intergenic
1123213985 14:106789248-106789270 GGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1202933252 14_KI270725v1_random:59325-59347 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124532463 15:30519542-30519564 AAAGAGAGAGAGACAGATGAAGG - Intergenic
1124766190 15:32488103-32488125 AAAGAGAGAGAGACAGATGAAGG + Intergenic
1125025203 15:35022738-35022760 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1125561590 15:40638197-40638219 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1125703493 15:41709724-41709746 TATGAGAGTGAGACTGAGCACGG - Intronic
1125949630 15:43741093-43741115 CTTGTGGGAGAAACGGAGGAGGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127121785 15:55778178-55778200 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1127137553 15:55940476-55940498 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1127546716 15:59999764-59999786 CAAGGGAGAGAGGCGGGGGAGGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128050115 15:64656744-64656766 AAAGAGGGAGAGAGGGAGGAGGG - Intronic
1128078012 15:64840620-64840642 AAGGAGAGAGAGAGGAAGGAGGG - Intergenic
1128285878 15:66436694-66436716 TATGAAAGAAAGAGGGAGGAAGG - Intronic
1128480641 15:68034934-68034956 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1128481021 15:68038356-68038378 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1128735303 15:70050318-70050340 CATCAGAGAGGGGCAGAGGAGGG - Intronic
1128809212 15:70557901-70557923 CAAGAAAGAGAGACGGAGACTGG + Intergenic
1128885242 15:71280603-71280625 AATGAGAGAGAGAGGGAGGGAGG - Intronic
1129209731 15:74060725-74060747 CAGCAGAGAGAGAGGGAGGGAGG + Intergenic
1129329153 15:74818027-74818049 AAAGAGAGAGAGAAGAAGGAGGG + Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129687681 15:77695900-77695922 CAAGAGAGAGAAACGGAGGGAGG + Intronic
1129905653 15:79185468-79185490 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1129911476 15:79230954-79230976 CAAGAGAGAGAGAGAGGGGAGGG + Intergenic
1130046201 15:80446848-80446870 AATGAGACAGAGACAGAGGAAGG - Intronic
1130354656 15:83118277-83118299 CAAGAGAGAGAGAGGCAAGATGG + Intronic
1130784900 15:87085249-87085271 GATGAGAGAGAGAAGATGGATGG - Intergenic
1130784904 15:87085287-87085309 GATGAGAGAGAGAAGATGGATGG - Intergenic
1130830207 15:87591574-87591596 CATGACAGAAAGACAGAGCAAGG - Intergenic
1131166957 15:90149031-90149053 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1131292647 15:91120287-91120309 CAGGAGAGAGAGAGTGAGGGAGG + Intronic
1131446657 15:92503940-92503962 TATGAGGGAGAGAGAGAGGAAGG + Intergenic
1131835276 15:96384100-96384122 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1132169926 15:99640500-99640522 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1132236232 15:100223977-100223999 CATGGGAGAAAGACGTAGGCTGG + Intronic
1132299318 15:100766561-100766583 CATGAGACAGAGATGGTGGGGGG + Intergenic
1132477302 16:147050-147072 CATGAGAGAGTGAAAGAAGATGG + Intergenic
1132661766 16:1064741-1064763 CAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1132792268 16:1698196-1698218 CACAAGAGAGGGATGGAGGATGG + Intronic
1133002386 16:2857941-2857963 CAGGAGGGAGAGAGGGAGGGAGG + Intronic
1133062481 16:3183680-3183702 AATGAGGGAGAGACGAAGGAGGG - Intergenic
1133260668 16:4547758-4547780 AATGAGAGAGAGAGAGAGGGAGG - Intergenic
1133494522 16:6304409-6304431 CATGGAGGTGAGACGGAGGAGGG - Intronic
1133589546 16:7229541-7229563 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1133589574 16:7229640-7229662 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589602 16:7229747-7229769 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589611 16:7229783-7229805 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589620 16:7229819-7229841 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589625 16:7229837-7229859 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589634 16:7229873-7229895 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589639 16:7229891-7229913 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589644 16:7229909-7229931 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589649 16:7229927-7229949 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589654 16:7229945-7229967 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589659 16:7229963-7229985 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133589664 16:7229981-7230003 GAAGGGAGAGAGAGGGAGGAAGG + Intronic
1133680878 16:8118673-8118695 CATGGGAGAAAGATGGAGGCTGG + Intergenic
1133729096 16:8564508-8564530 AATGAGTGAGTGACGGAGGGAGG + Intergenic
1133729103 16:8564584-8564606 AATGAGTGAGTGACGGAGGGAGG + Intergenic
1133758649 16:8781035-8781057 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1133988388 16:10685639-10685661 GATGAGATAGAGACAGAGAAAGG - Intronic
1134252599 16:12584979-12585001 CATGAGAGACTGAAGGAGCAGGG - Intergenic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134384333 16:13757857-13757879 AAAGAGAGAGAGACAGAGAAGGG - Intergenic
1134600596 16:15530665-15530687 CATGAGAGGGACCCGGTGGAAGG + Intronic
1135016125 16:18926274-18926296 GGTGAGAGAGAGGCGGATGAAGG + Exonic
1135321743 16:21502101-21502123 GGTGAGAGAGAGGCGGATGAAGG + Intergenic
1135331591 16:21564601-21564623 GAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1135628997 16:24021376-24021398 CAGGTGAGAGAGATGGAGGAGGG - Intronic
1135663359 16:24315635-24315657 AATGAGAGAGAGAGAGAGAAAGG - Intronic
1135683674 16:24480205-24480227 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1135694693 16:24575754-24575776 AAAGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135833514 16:25800438-25800460 CATCAGAGAGAGAAAGAGGTGGG - Intronic
1135899841 16:26447214-26447236 TATGAGAGAGACACTGAGTATGG - Intergenic
1135920023 16:26641541-26641563 CAGGGGAGGGAGATGGAGGATGG - Intergenic
1136228275 16:28873078-28873100 CATGAGACATTGAGGGAGGAGGG - Intronic
1136299614 16:29325016-29325038 CAAGAGAGAGGAAGGGAGGAGGG - Intergenic
1136333216 16:29595208-29595230 GGTGAGAGAGAGGCGGATGAAGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136597595 16:31262270-31262292 AATGAGAGAGGGAGGAAGGAAGG - Intronic
1136605499 16:31330984-31331006 GAGGACAGAGAAACGGAGGAGGG + Intronic
1137014078 16:35356409-35356431 CAGGAGAGAGAGAGAGAGAAAGG + Intergenic
1137372915 16:47925434-47925456 TATGAGAGAGAGACGGGTGTGGG + Intergenic
1137524769 16:49225047-49225069 CATGAGAGGGACCCGGAGGGAGG - Intergenic
1137840625 16:51637474-51637496 CAAGAGAGGGAGAAGAAGGAGGG + Intergenic
1137950135 16:52775616-52775638 CATGAGAGATAGATGTAGGCTGG - Intergenic
1138109767 16:54314319-54314341 CAGGAAAGAGAGAGGGAGCAGGG - Intergenic
1138376358 16:56566857-56566879 AATGAGGGAGAGAGGAAGGAAGG + Intronic
1138647035 16:58433114-58433136 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1138813756 16:60180591-60180613 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1138889167 16:61121394-61121416 CCTGAGAGAGAGAGGAAAGAGGG - Intergenic
1139147965 16:64345415-64345437 CATGGGAGAGAGGCTGAGCAGGG + Intergenic
1139259270 16:65576563-65576585 CAGGAGTGAGAGAGTGAGGAAGG + Intergenic
1139291228 16:65859684-65859706 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1139303108 16:65961978-65962000 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139342245 16:66275210-66275232 CAAGAGAGAGAGACAGTGAAAGG - Intergenic
1139427068 16:66888049-66888071 AAAGAGAGAGAGAGGAAGGAAGG - Exonic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139580181 16:67868475-67868497 CAAGAGAGAGAGTGGGAGGTGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139966108 16:70746350-70746372 CATGAGTGGGAGAGGGATGAAGG - Intronic
1140063888 16:71593665-71593687 CAATAGAGAGAGAGAGAGGAAGG - Intergenic
1140137700 16:72222391-72222413 AATAAGAGATAGAAGGAGGAAGG - Intergenic
1140328236 16:74026885-74026907 AAAGGGAGAGAGAGGGAGGAAGG + Intergenic
1140564354 16:76023757-76023779 CATGAGAGAGACACACATGAAGG + Intergenic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1141109316 16:81258936-81258958 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141149254 16:81552808-81552830 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141177152 16:81728554-81728576 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1141188760 16:81808368-81808390 TTTTAGAGAGAGAGGGAGGAGGG + Intronic
1141293936 16:82749174-82749196 ACAGAGAGAGAGAAGGAGGAAGG + Intronic
1141773015 16:86102296-86102318 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1141844542 16:86598378-86598400 AATGAGAGAGAGAGCGAGGTTGG - Intergenic
1141884272 16:86880991-86881013 CATGAGGGAGAGACTCAGGAAGG + Intergenic
1141938865 16:87261049-87261071 CAGGAGAGAGAGAGGCAAGAGGG + Intronic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1142111588 16:88334844-88334866 CATGTGACAGAGACGGACGTGGG + Intergenic
1142399885 16:89852993-89853015 CTTGAGGGTGAGAGGGAGGATGG - Intronic
1142418791 16:89957733-89957755 CCTGAGAGAGAGCCAGAGGCTGG - Intronic
1142570748 17:872225-872247 AGAGAGAGAGAGACGGAGGGAGG + Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1142943089 17:3399513-3399535 CATGAGAGAGTGGAGGAGGATGG - Intergenic
1143462347 17:7112031-7112053 GATGAGAGAGAGAGAGGGGAGGG + Intronic
1143924056 17:10353906-10353928 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
1144193859 17:12871781-12871803 AATAAGAGAGAGACGGGGGGAGG - Intronic
1144247770 17:13384392-13384414 AAGGAGGGAGAGAGGGAGGAAGG + Intergenic
1144267377 17:13584440-13584462 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1144352921 17:14415882-14415904 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1144465474 17:15493577-15493599 GATGGGAGAGAGAGGGAGGGAGG - Intronic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1144961453 17:19046491-19046513 CTAGAGAGAGAGACAGAGTATGG - Intronic
1144973707 17:19128033-19128055 CTAGAGAGAGAGACAGAGTATGG + Intronic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146367257 17:32238779-32238801 AATGAGAGAGGGAGGGAGGGAGG - Intronic
1146367272 17:32238819-32238841 AACGAGAGAGGGAGGGAGGATGG - Intronic
1146410683 17:32581532-32581554 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146469358 17:33111702-33111724 TGTGAGAGAGGGACAGAGGATGG - Intronic
1146963075 17:37001334-37001356 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1147122514 17:38343903-38343925 CGTGAGAGGGAGACGGAGAGAGG - Intergenic
1147131380 17:38411549-38411571 GAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1147164054 17:38584157-38584179 CGATAGAGAGAGACGGAGGCAGG + Intronic
1147193362 17:38749396-38749418 CAGGAGGGAGAGAACGAGGAGGG + Exonic
1147213954 17:38888221-38888243 GATGAGAGAGGGATGGAGAAGGG + Intronic
1147377915 17:40033735-40033757 CAGGAGAGAGAGGCAGAGGGAGG + Intronic
1147770351 17:42863765-42863787 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1148233503 17:45951917-45951939 AGAGAGAGAGAGAGGGAGGAAGG + Intronic
1148378672 17:47175028-47175050 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1148548064 17:48531709-48531731 AAAGAGAGAGAGAGGGAAGATGG - Intergenic
1148619335 17:49022601-49022623 CAGGAGAGGGAGGGGGAGGAGGG - Intronic
1148733676 17:49852503-49852525 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1148894823 17:50833543-50833565 GATGAGAGGGGGTCGGAGGAGGG - Intergenic
1148971618 17:51488224-51488246 CATGTTAGAGAGACGGAGGGCGG + Intergenic
1149062115 17:52434738-52434760 GAAAAGAGAGAGAGGGAGGAAGG + Intergenic
1149186683 17:54006315-54006337 CATGACAGAGAAAAGAAGGAAGG - Intergenic
1149189417 17:54041251-54041273 CAAGAAAGAGAGAGGGAGGGAGG + Intergenic
1149461319 17:56832432-56832454 CATCCCAGAGAGACAGAGGAAGG - Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150078309 17:62213262-62213284 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1150456021 17:65307580-65307602 TGTGAGAGAGAGAGGGAGGGAGG - Intergenic
1150477801 17:65487892-65487914 GGAGAGAGAGAGACGGAGGGAGG + Intergenic
1150477868 17:65488166-65488188 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150477915 17:65488386-65488408 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150515868 17:65808645-65808667 CATGAGAGAGAGAGAGAAGGGGG - Intronic
1150598389 17:66627439-66627461 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1150612988 17:66748818-66748840 CCGGAGAGAGAGAGGGAGGGCGG + Intronic
1150893865 17:69186462-69186484 AATGAGAGATAGACGGAGGGTGG - Intronic
1150902609 17:69298305-69298327 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1150984815 17:70184433-70184455 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151124997 17:71835031-71835053 CATGAGACAGATTTGGAGGAAGG + Intergenic
1151133647 17:71924383-71924405 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1151305647 17:73261302-73261324 CAGAAGAGAGAGACAGAGAAGGG + Intronic
1151352795 17:73541592-73541614 CAGCAGGGAGAGACGGAGGGAGG - Intronic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151699370 17:75734815-75734837 TATGAGAGAGGAAGGGAGGAAGG + Intronic
1151846017 17:76656076-76656098 CAATAGAGAGACACAGAGGAGGG + Intergenic
1151961033 17:77405750-77405772 CGTGACACAGAGAGGGAGGACGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152283484 17:79399019-79399041 CATGAGAGAAGGACGCATGACGG + Intronic
1152337063 17:79704792-79704814 CAAGAGGGCGAGAGGGAGGAGGG + Intergenic
1152632667 17:81417511-81417533 CAGGGGAGGGAGACCGAGGAGGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153015114 18:576431-576453 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1153074467 18:1147242-1147264 AATGAGAGAGAGAAGTAGTAAGG - Intergenic
1153267599 18:3286314-3286336 GAAGAGAGAGAGCGGGAGGAGGG + Intergenic
1153457049 18:5294501-5294523 CTTGAGAGAGAGAGGGGAGAGGG - Intronic
1153466649 18:5395555-5395577 CTTGAGAGCGAGCTGGAGGAAGG - Intronic
1153498144 18:5721315-5721337 AATGAGGTAGAGAGGGAGGAAGG + Intergenic
1153613437 18:6910632-6910654 CATGAGAGAAAGACCAAGCATGG - Intronic
1153690297 18:7585640-7585662 CATGAGAGGGAGATAGATGAGGG - Intronic
1153903125 18:9636670-9636692 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154013406 18:10594883-10594905 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1154152579 18:11918146-11918168 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1154448214 18:14452131-14452153 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1155041851 18:22071453-22071475 AAAGAGAGAGAGAGGGAAGAAGG - Intergenic
1155058209 18:22204173-22204195 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1155135449 18:22987222-22987244 CAAGAGAGAGGGAAGGGGGAGGG + Intronic
1155219228 18:23669403-23669425 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1155463909 18:26114579-26114601 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1155524492 18:26702710-26702732 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1155555863 18:27018831-27018853 CAGGAGAGAGAGCAGGAGAATGG + Intronic
1155557975 18:27042790-27042812 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1155728962 18:29127916-29127938 CAGGAGAGAGAGAAGGCGAAGGG + Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156573748 18:38288500-38288522 CATGAGAGATAGAGAGAGAAGGG + Intergenic
1156595592 18:38544343-38544365 GAGGAGAGAGAAAGGGAGGAAGG - Intergenic
1156829854 18:41478666-41478688 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1156898747 18:42276283-42276305 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1158117366 18:54010889-54010911 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
1158213383 18:55074577-55074599 CATGAGAGAGACACATGGGAGGG + Intergenic
1158320642 18:56258404-56258426 CAAGAGAGAGAGAAAGAGAAAGG + Intergenic
1158615119 18:58980034-58980056 CATGAGAGAGAGAGAGACAAAGG + Intronic
1158725502 18:59968224-59968246 CAAGAGACAGAGATGGAGGCAGG + Intergenic
1158736885 18:60092495-60092517 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1158739198 18:60120364-60120386 CATTAGAGGGAGATGGGGGATGG - Intergenic
1158806547 18:60980413-60980435 CGTGAGAGAGAGAGGGAGAAGGG + Intergenic
1159175721 18:64831234-64831256 CAAGAGAGAGAGAATAAGGAGGG + Intergenic
1159236797 18:65685299-65685321 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1159398480 18:67897290-67897312 CATGACCCAGAGACGAAGGAAGG + Intergenic
1159634665 18:70790091-70790113 CATGAGAGGGAGCTGGTGGAAGG - Intergenic
1159797425 18:72862076-72862098 CATAAGAGAGGGACAGAGTATGG - Intronic
1159819481 18:73121638-73121660 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1160029345 18:75244957-75244979 CAAGAGAGAGAGATGGGGGAAGG - Intronic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160408079 18:78656496-78656518 CATGTGGGAGCGAGGGAGGAGGG - Intergenic
1160521146 18:79508895-79508917 CATGAGAGAGAAAGGGAGGGAGG - Intronic
1160674638 19:383347-383369 CCTGAGAGAGGGACAGGGGAGGG - Intergenic
1161023826 19:2025515-2025537 AAGGAGAGAGAGAGGAAGGAGGG - Intronic
1161117641 19:2507601-2507623 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1161122908 19:2539968-2539990 AAAGAGAGAGAGAAGGAGGGAGG - Intronic
1161256000 19:3310063-3310085 GAGGAGAGAGAGATGGAGGGAGG - Intergenic
1161319291 19:3633576-3633598 CAAGAGAGGCAGAGGGAGGAAGG + Intronic
1161353084 19:3804424-3804446 CATCAGGGAGAGAGGGAGGAAGG + Exonic
1161414749 19:4139716-4139738 CAAGGGGGAGAGAAGGAGGAGGG + Intergenic
1161664214 19:5565143-5565165 CAAGGGGGAGAGAGGGAGGAAGG - Intergenic
1161696100 19:5769161-5769183 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161994219 19:7702598-7702620 GAGGAGAGAGAGGCAGAGGAAGG + Intergenic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162085614 19:8247254-8247276 CAAGGGGGAGAGAGGGAGGAGGG - Intronic
1162104564 19:8362545-8362567 AATGAGGGAGAGAAAGAGGAAGG + Intronic
1162131174 19:8526984-8527006 CAGGTGAGAGAGACAGATGAAGG + Intronic
1162222080 19:9186248-9186270 CATCAGAGAAATATGGAGGAGGG - Exonic
1162291671 19:9785522-9785544 CGTGAGCGAGAGACGGGGGCGGG - Intronic
1162414690 19:10528334-10528356 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1162459955 19:10808951-10808973 CATAGGAGATAGAAGGAGGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162754279 19:12847826-12847848 CCTGCGGGAGGGACGGAGGAGGG - Exonic
1162839935 19:13349060-13349082 AGTCAGAGAGAGACGGATGAAGG + Intronic
1162847904 19:13407970-13407992 CAGGAGAGAGAGAGTGAGGGGGG - Intronic
1162877784 19:13633682-13633704 GAAAAGAGAGAGACAGAGGAAGG - Intergenic
1162877798 19:13633798-13633820 AAAGAGAGAGAGACAGAGGAAGG - Intergenic
1162877817 19:13633931-13633953 GAAGAGAGAGAGACAGAGGAAGG - Intergenic
1163015808 19:14453538-14453560 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1163190217 19:15672229-15672251 CCTTAGAGGGCGACGGAGGAAGG - Intergenic
1163373566 19:16915996-16916018 CAAGAGAGAGAGAGAGAGGAAGG - Intronic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1164578423 19:29419399-29419421 AAAGAGAGAGACACGGAGCAGGG + Intergenic
1164693003 19:30224940-30224962 GAGGAGAGAGAGACGGAGAAGGG - Intergenic
1165021532 19:32928368-32928390 AAAGAGAGAGAGAGAGAGGAGGG - Intronic
1165156061 19:33788819-33788841 GATGAGGGAGGGAGGGAGGAGGG + Intergenic
1165357806 19:35314544-35314566 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1165393344 19:35550643-35550665 CCTGGGAGAGAGAGGGAGAAAGG + Exonic
1165433630 19:35785383-35785405 CAGGAGAGGGAGAGGTAGGAGGG - Intronic
1165512719 19:36274635-36274657 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165513270 19:36277178-36277200 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165513824 19:36279730-36279752 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165514374 19:36282265-36282287 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165514928 19:36284804-36284826 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165515479 19:36287334-36287356 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165516030 19:36289873-36289895 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165516580 19:36292407-36292429 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165517133 19:36294936-36294958 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165517685 19:36297459-36297481 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165518238 19:36299994-36300016 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165518788 19:36302528-36302550 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165519337 19:36305047-36305069 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165519885 19:36307573-36307595 CGTGAGAGAGAGACAGAAGTCGG - Intergenic
1165624181 19:37271020-37271042 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165626342 19:37281138-37281160 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165627423 19:37286187-37286209 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165628500 19:37291237-37291259 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165629041 19:37293760-37293782 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165629583 19:37296288-37296310 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165630125 19:37298815-37298837 CGTGAGAGAGAGACAGAAGTCGG + Intergenic
1165793439 19:38505746-38505768 GATGAGAGAGGGGTGGAGGAAGG - Intronic
1165885344 19:39074138-39074160 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1166112873 19:40633717-40633739 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166231435 19:41427476-41427498 CAGGAGAGAGGGAGGGAGGGAGG + Exonic
1166329581 19:42070216-42070238 CAGGAGAGAGAGAAGAGGGAGGG + Intronic
1166459385 19:42972885-42972907 AATGAGAGAGAGAGAGAGAAAGG + Intronic
1166473951 19:43104456-43104478 AAGGAGAGAGAGAGAGAGGAAGG + Intronic
1166548572 19:43649632-43649654 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
1166573109 19:43811720-43811742 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1166633294 19:44427036-44427058 CAGGAGAGAGACAGCGAGGAAGG + Exonic
1166636365 19:44455325-44455347 TATGAAAGAGAGACGGCAGAAGG + Intergenic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166997696 19:46727650-46727672 CAAGAGAGAGAGACGGGGAGAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167163128 19:47780442-47780464 CAAGAGACAGAGAAGGGGGAGGG - Intronic
1167582602 19:50355031-50355053 CACGGGAGAAAGACGGAGGCTGG + Intronic
1167657810 19:50777623-50777645 CATGAGAGAGAGACAGAACATGG - Intergenic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1167999149 19:53431355-53431377 AAAGAGAGAGAGACGAGGGAGGG + Intergenic
1168090588 19:54080473-54080495 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1168379824 19:55910737-55910759 CATGAGGGAGAGACAGAACACGG + Intronic
1168468234 19:56621104-56621126 GATCAGAGAGGGAGGGAGGAGGG - Intronic
1168522297 19:57062002-57062024 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1168637033 19:58004253-58004275 CATGAGAGAGGTAAGGTGGAAGG + Intronic
1168657673 19:58142832-58142854 GATGAGAGGGAGAAGGAGAAAGG - Intronic
1168690027 19:58370917-58370939 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
924970799 2:126228-126250 CATGAGAGGGAAACTGTGGAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925430566 2:3788862-3788884 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
925498819 2:4482126-4482148 CATGGGAGAAAGATGGAGGCTGG - Intergenic
925612379 2:5712556-5712578 CGAGAGAGAGAGAGAGAGGAGGG + Intergenic
925637112 2:5951165-5951187 CTGGGGAGAGAGAAGGAGGAAGG - Intergenic
925653892 2:6123776-6123798 GAAGAGAGAGAGAGGGAGGGAGG - Intergenic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925693517 2:6549620-6549642 AATGAGGGAGAGAGGGAAGAAGG - Intergenic
925832424 2:7909629-7909651 CAGGAGAGAGAGAGAGAGAAGGG + Intergenic
925833289 2:7917637-7917659 AGGGAGAGAGAGAGGGAGGAAGG + Intergenic
925913703 2:8589560-8589582 ATAGAGAGAGAGAGGGAGGAGGG + Intergenic
925965689 2:9063088-9063110 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
926110184 2:10177718-10177740 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
926461239 2:13131521-13131543 CAGGAGAGAGAGAGAGAAGAGGG - Intergenic
926638093 2:15205774-15205796 CAGGAGAGAGAGGGGGTGGAAGG - Intronic
926663716 2:15496654-15496676 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
926720247 2:15954829-15954851 CAAGAGAGAGAGAGAGAGAAAGG - Intergenic
926728681 2:16018176-16018198 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
926851512 2:17203266-17203288 CAAGAGAGAGAGAAAGAGAATGG + Intergenic
927035531 2:19171324-19171346 CATGAGAGAAAGATGTAGGCTGG + Intergenic
927099108 2:19774260-19774282 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
927287462 2:21371536-21371558 CTGGAGAGAGAGAAAGAGGAAGG + Intergenic
927311318 2:21635017-21635039 TGTGAGAGAGAGAGGGAGAAGGG - Intergenic
927532288 2:23818250-23818272 GAAGAGAGGGAGACGGAGGGAGG + Intronic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927659510 2:24981039-24981061 AAAGAGAGAGAGAAGAAGGAGGG + Intergenic
927828535 2:26327686-26327708 CATGAGAGAGAGAGAGATGGTGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928155855 2:28875809-28875831 CCTGAGAAAGAGATGGAGGGTGG - Intergenic
928426627 2:31183846-31183868 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928734877 2:34276538-34276560 CCTGAGAGAGAGACCCAAGAAGG + Intergenic
928903297 2:36344474-36344496 AATGAGAGAGGGAGGGAGGGAGG + Intergenic
929124003 2:38506543-38506565 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
929270403 2:39965258-39965280 CATGGGAGAAAGATGGAGGCTGG + Intergenic
929315224 2:40469355-40469377 CATGGGAGAGAAAGTGAGGAGGG - Intronic
929464182 2:42129891-42129913 CATGAGGGACAGAAGGAGGCAGG + Intergenic
929475448 2:42242646-42242668 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
929820997 2:45273462-45273484 AGTGAGAGAGAGAGGGAGGGAGG - Intergenic
930793990 2:55368450-55368472 AAAGAGAGAGAGAGGGAGGGGGG - Intronic
931113061 2:59134268-59134290 TATCAGAGAGTGACAGAGGAAGG - Intergenic
931133413 2:59366300-59366322 GAAGAGAGAGGGAGGGAGGAAGG + Intergenic
931348801 2:61470759-61470781 GAGGGGAGAGAGGCGGAGGAGGG + Exonic
931767434 2:65469420-65469442 CATGAGAGAGAGAGAGAGCGGGG - Intergenic
931825876 2:66000533-66000555 GATGAGAGAAAGAAGGATGAAGG + Intergenic
932154407 2:69403016-69403038 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
932564276 2:72895807-72895829 TGTGAGAGAGAGAGGGAGGGGGG - Intergenic
932855383 2:75228300-75228322 CATGGGAGAAAGACGAAGGCTGG + Intergenic
932859080 2:75269793-75269815 CATGGGAGAAAGATGTAGGATGG + Intergenic
932878757 2:75479936-75479958 CGTGAGAGAGAGAGAGAGGATGG - Intronic
932957001 2:76363915-76363937 CACGAGAGAAAGACAGAGGCCGG - Intergenic
932957155 2:76365991-76366013 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
933085445 2:78049018-78049040 GATGAGAGAGAGTGGGAGAAGGG - Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933346532 2:81093081-81093103 GAGGAGAGAGAGAGGGAAGAAGG + Intergenic
933577868 2:84090379-84090401 GGAGAGAGAGAGAAGGAGGAAGG - Intergenic
933589699 2:84218591-84218613 CATGATACAGATAGGGAGGAAGG + Intergenic
934012344 2:87836304-87836326 AAAAAGAGAGAGAGGGAGGACGG + Intergenic
934070943 2:88383337-88383359 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
934119225 2:88824036-88824058 CATGAGAAAGATACAGGGGAGGG + Intergenic
934325230 2:92007685-92007707 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
934579104 2:95424277-95424299 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
934600341 2:95652430-95652452 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
934731888 2:96664136-96664158 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
934781290 2:96971291-96971313 AAGGAGAGAGAGAGGGAGGTGGG - Intronic
934784865 2:96997681-96997703 CATGAGAGAGAGACGGGAGGGGG + Intronic
934789265 2:97044528-97044550 CTTGAGAGAGTGTGGGAGGAGGG - Intergenic
934817213 2:97338013-97338035 CTTGAGAGAGTGTGGGAGGAGGG + Intergenic
934820483 2:97370471-97370493 CTTGAGAGAGTGTGGGAGGAGGG - Intergenic
935124041 2:100207402-100207424 CATGAGGGACAGAAGGAGGAAGG - Intergenic
935358447 2:102226659-102226681 AAAGAGAGAGAGAGGGAGGAAGG + Intronic
935438989 2:103069378-103069400 GATGAGAGAGGGAAGGAGGAAGG - Intergenic
935599384 2:104907114-104907136 CATGTTAGAGAGATGGGGGAAGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935712224 2:105909386-105909408 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
935717238 2:105950115-105950137 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
936162681 2:110096534-110096556 CATGAGAAAGATACAGAGGAGGG + Intronic
936416718 2:112322147-112322169 CAAGAGGGAGGGAGGGAGGAAGG - Intronic
936478584 2:112864197-112864219 CATGAGAGAAAGATGTAGGCTGG + Intergenic
936673184 2:114683539-114683561 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
936673191 2:114683563-114683585 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
936688337 2:114855139-114855161 AAAGAGAGAGAGACGTTGGAAGG + Intronic
937061883 2:118986535-118986557 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937112717 2:119378784-119378806 CAAGAGAGTGAGGAGGAGGAGGG - Intergenic
937113772 2:119388430-119388452 CTTGAGAGATAGAGGGATGATGG - Intergenic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
937475933 2:122215234-122215256 TATTAGAGAGAGGAGGAGGAGGG + Intergenic
937476653 2:122221245-122221267 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
937517439 2:122671187-122671209 CAAGAGAGAGAAACCTAGGAAGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
938122650 2:128644789-128644811 TAGGAGAGAGAGAGGCAGGAAGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938671372 2:133589508-133589530 CAGGAGAGAGAGACCCAGGATGG + Intergenic
938869704 2:135462574-135462596 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939138660 2:138326406-138326428 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
939276089 2:139998251-139998273 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
939384516 2:141478525-141478547 AATGAGAGAGAGAGGGAGGGAGG - Intronic
939962746 2:148580115-148580137 CATGAGAGAGAGACCAAGTGAGG + Intergenic
940023885 2:149184704-149184726 CAAGAGAAAGAGACAGAGGTTGG - Intronic
940092470 2:149936418-149936440 CATGTGGGAGAGACTTAGGAAGG + Intergenic
940115490 2:150204102-150204124 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
940115499 2:150204136-150204158 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
940119645 2:150249868-150249890 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
940121121 2:150267372-150267394 AATGAGACAGAGAGGGAGGAAGG - Intergenic
940179723 2:150918576-150918598 GATGAGGGAGAAAGGGAGGAAGG + Intergenic
940307864 2:152245760-152245782 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
940563728 2:155334147-155334169 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
940575120 2:155493716-155493738 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
940599743 2:155843975-155843997 CATGAGTGGGAGAGTGAGGAAGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941099271 2:161278965-161278987 CATGAAAGAGAGAGGGCAGAAGG - Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941366787 2:164620085-164620107 CAAGAGAGAGAGAAGGCGGTGGG - Intronic
941428693 2:165384790-165384812 CATGAGACAGAGAAGGAGTGGGG + Intronic
941451589 2:165666564-165666586 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
941451642 2:165666992-165667014 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
941503272 2:166308453-166308475 CAGGAGAGGGAGAAAGAGGAGGG - Intronic
941758532 2:169214898-169214920 CATGAGTGACAGGCTGAGGATGG + Intronic
941952632 2:171172660-171172682 CAAGAGAGAGAAATGGGGGAAGG - Intronic
942034348 2:171996281-171996303 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
942106245 2:172636360-172636382 CGGGAGAGAGAGGGGGAGGAAGG + Intergenic
942163263 2:173214973-173214995 CCTGAGAGACAGATTGAGGAAGG + Intronic
942489061 2:176471698-176471720 AAAGAGAGAGGGACAGAGGAAGG - Intergenic
942971940 2:181967656-181967678 AAAGAGAGAGAGAAGGAGGGAGG - Intronic
942977471 2:182035655-182035677 CATGAGAGAGAGAGAGCGAAGGG - Intronic
943016877 2:182523290-182523312 TATGAGAGAGAGAAGGAGAAAGG + Intergenic
943060933 2:183040715-183040737 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
943356470 2:186862222-186862244 TATGAGAGAGAGAGAGAGAAAGG + Intergenic
943499254 2:188666190-188666212 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
943509047 2:188801823-188801845 CATGGGAGAAAGATGGAGGCTGG - Intergenic
943513553 2:188856678-188856700 CACGAGAGAAAGATGGAGGCTGG + Intergenic
943532091 2:189095470-189095492 CGAGAGAGAGAGAGGGAGAAAGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944008125 2:194936876-194936898 CAGGAGAGAGAGAGAGAGGGAGG + Intergenic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
945010278 2:205453979-205454001 AATGAGGGAGAAAGGGAGGAAGG - Intronic
945178102 2:207064027-207064049 CCTTAGAGAGAGATGGGGGACGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945332006 2:208550932-208550954 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
945744645 2:213705261-213705283 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
946083458 2:217148031-217148053 AATGTGAGAGACACAGAGGAAGG - Intergenic
946323415 2:218968060-218968082 AAAGAGAGAGAGAAGGAAGAGGG + Intergenic
946517228 2:220425945-220425967 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
946644257 2:221816319-221816341 CAGGAGAGAGAAAAAGAGGAGGG - Intergenic
946789241 2:223284083-223284105 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
947084645 2:226437363-226437385 CAAGAGAGAGAGATAAAGGAAGG + Intergenic
947159084 2:227193869-227193891 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947159101 2:227193936-227193958 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
947231929 2:227896631-227896653 TATGAGAGAGAGAGAGAGAAAGG + Intronic
947527682 2:230889229-230889251 CAGGAGAGAGAGAGAGAGCACGG + Intergenic
947779160 2:232741962-232741984 CTGGAAAGAGAGTCGGAGGAAGG - Intronic
947829135 2:233126370-233126392 CAAGTGAGAGAGTAGGAGGAGGG - Intronic
947906941 2:233771755-233771777 AAGGAGAGAGGGACGGAGGAAGG - Intronic
947941921 2:234064238-234064260 AGAGAGAGAGAGACAGAGGAAGG - Intronic
947998014 2:234544777-234544799 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
948045440 2:234940222-234940244 CATCAGAAACAGACGTAGGAGGG + Intergenic
948058866 2:235029205-235029227 CATGAGAGAGGGACGGGGCAGGG + Intronic
948233221 2:236366801-236366823 AAAGAGAGAGAGGAGGAGGAAGG - Intronic
948250198 2:236521655-236521677 AAAGAGAGAGAGATGGAGGGAGG + Intergenic
948637571 2:239349230-239349252 CACGAGAGACACACGGAGGGAGG + Intronic
948859667 2:240746718-240746740 CTTGAGAGAGTGGTGGAGGAAGG - Intronic
948986313 2:241526635-241526657 CAAGAGAGAGAGACAGCGAAAGG + Intergenic
1168826785 20:819398-819420 AAAGAGACAGAGAGGGAGGAAGG - Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169259441 20:4125019-4125041 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1169546514 20:6656300-6656322 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1169647004 20:7823082-7823104 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1169990249 20:11495270-11495292 GGTGAGAGACAGAGGGAGGAAGG + Intergenic
1170496348 20:16929062-16929084 CAGGAGAGAGAGAAGAATGAAGG - Intergenic
1170660310 20:18332898-18332920 CAAAAGGGAGAGACGGAGGGTGG + Intergenic
1170933040 20:20786040-20786062 GAAGAGAGAGAGAAGAAGGAGGG - Intergenic
1170943593 20:20869686-20869708 AATGGGACAAAGACGGAGGAGGG + Intergenic
1170958183 20:21000941-21000963 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1170988291 20:21278569-21278591 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1170990556 20:21298148-21298170 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1171016253 20:21544559-21544581 CAAGAGAGAGAGTAGGAGGGAGG + Intergenic
1171079071 20:22159656-22159678 CACTAGAGAGAGAGGGAGGAGGG - Intergenic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1171123550 20:22584370-22584392 CGCGAGAGAGGGAGGGAGGAGGG - Exonic
1171368080 20:24640354-24640376 CGAGAGAGAGAGAGAGAGGAAGG + Intronic
1171377108 20:24700991-24701013 CATGAGAGAAACACAGGGGATGG - Intergenic
1171778036 20:29389066-29389088 GATGAAGGAGAGAAGGAGGAGGG - Intergenic
1171956010 20:31464364-31464386 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1172072420 20:32268005-32268027 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1172134994 20:32680908-32680930 CATCAGAGAGGGAAAGAGGAAGG - Intergenic
1172224628 20:33297215-33297237 CATGAGAGTGAAATGGAGGCTGG - Intronic
1172283915 20:33727788-33727810 CATGTTAGAGACAGGGAGGAAGG + Intergenic
1172606036 20:36214700-36214722 CAGCAGAGAGAGAGAGAGGATGG + Intronic
1172783223 20:37449652-37449674 CATGAGAGTGACAGGGAGGGTGG - Intergenic
1172800545 20:37573439-37573461 AATGAGACAGAGAAGGAGTAGGG + Intergenic
1173443175 20:43095868-43095890 GAAGAGAGAGAGAGGGAGGGTGG - Intronic
1173443204 20:43095988-43096010 GAAGAGAGAGAGAGGGAGGGTGG - Intronic
1173902336 20:46600235-46600257 AGGGAGAGAGAGATGGAGGAAGG + Intronic
1173927378 20:46790956-46790978 CAAGAGAGAGAGCAAGAGGAGGG + Intergenic
1174084956 20:48000765-48000787 AAAGAGAGAGAGACAGAGAAAGG - Intergenic
1174418144 20:50381088-50381110 CGAGAGAGAAAGAGGGAGGAAGG + Intergenic
1174664984 20:52249543-52249565 CAGGAGAGAGAGACTGAAGGGGG - Intergenic
1174763503 20:53229768-53229790 AAGGAGGGAGAGAGGGAGGAGGG + Intronic
1174797388 20:53533642-53533664 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1174857957 20:54064622-54064644 CAGGAGAGCGAGACTGCGGAGGG - Intronic
1174869376 20:54168890-54168912 AAAGAGAGAGAGACAGAGAAAGG - Intronic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175146383 20:56899581-56899603 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1175162078 20:57016044-57016066 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1175356794 20:58375127-58375149 GGAGAGAGAGAGATGGAGGAAGG - Intergenic
1175369941 20:58481527-58481549 GAGGAGAGAGGGATGGAGGATGG + Intronic
1175503226 20:59464932-59464954 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
1175559627 20:59910125-59910147 CATGTCAGAGAGACAGAAGAAGG + Intronic
1175596113 20:60234620-60234642 TATGAGAGAGAGAGAGAGAAAGG - Intergenic
1175661465 20:60816576-60816598 CAGGAGAGAGAGACAGAGCTAGG - Intergenic
1175717139 20:61262766-61262788 GAGGAGAGAGGGAAGGAGGAAGG - Intronic
1176113840 20:63422543-63422565 CATGGGGAAGAGACGGGGGAGGG + Intronic
1176594655 21:8681498-8681520 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1176965656 21:15208867-15208889 CATGAGAGAGAGACAAAGCCAGG + Intergenic
1176975116 21:15312245-15312267 CAGGAGAGAGAGAGCGTGGAGGG - Intergenic
1177046902 21:16182558-16182580 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1177076864 21:16586944-16586966 CATGAGAGAGAAAAGCAAGAAGG - Intergenic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177783706 21:25646595-25646617 AGAGAGAGAGAGAGGGAGGATGG + Intronic
1177803376 21:25849608-25849630 CAGGAGAGAGAGACGGTGCAGGG - Intergenic
1178043934 21:28673030-28673052 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
1178070363 21:28958906-28958928 AAAGAGAGAGAGAAAGAGGAAGG + Intronic
1178100347 21:29261476-29261498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178321303 21:31607963-31607985 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178899242 21:36585913-36585935 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1178919577 21:36729695-36729717 GATGAAAGAGAGAGGGATGAAGG - Intronic
1178957242 21:37034325-37034347 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1179014061 21:37579662-37579684 TATGAGAGAGAGTTGGAAGACGG + Intergenic
1179462326 21:41545599-41545621 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1180277507 22:10658627-10658649 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1180691189 22:17717404-17717426 CATGAGAGATTCACGGAAGAGGG - Intronic
1180971107 22:19816150-19816172 CATGAGAGAGAGGCAGAGACAGG - Intronic
1181094534 22:20496282-20496304 AATGAGAGAGTGAAGGAGGGAGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1182007042 22:26969715-26969737 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1182048511 22:27295766-27295788 TAGGAGAGAGGGAAGGAGGAAGG + Intergenic
1182059689 22:27388136-27388158 CATAAGAGAAAGAAGGAGAAAGG + Intergenic
1182134829 22:27891674-27891696 CAGGAGAGAGAGGAGGAGGAAGG - Intronic
1182519327 22:30876495-30876517 CATGAGAGAGAAACAGGGTATGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182567396 22:31210578-31210600 AATGTGAGAGAGAATGAGGAGGG + Intergenic
1182819300 22:33201353-33201375 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1182903533 22:33918918-33918940 CCAGAGAGAGAGAGAGAGGAGGG - Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183102638 22:35593336-35593358 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1183103622 22:35599142-35599164 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1183264878 22:36818984-36819006 CAGCAGGGAGAGATGGAGGAAGG - Intronic
1183275775 22:36896639-36896661 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1183729958 22:39612829-39612851 AAGGAGGGAGAGAAGGAGGAAGG - Intronic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1183982109 22:41547211-41547233 CAAGAGAGAGAGTGGGAGGAGGG - Intergenic
1184033058 22:41905956-41905978 CAGGAGAGAGAAACTCAGGAAGG - Exonic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184345434 22:43909980-43910002 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1184392195 22:44210315-44210337 TATAAGAGAGACACAGAGGAGGG - Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1185009927 22:48307160-48307182 CCTGAGACAGAGCAGGAGGAAGG - Intergenic
1185028792 22:48430871-48430893 CCTGAGCAAGAGAGGGAGGAGGG - Intergenic
949401064 3:3665849-3665871 AAAGAGAGAAAGACAGAGGAAGG + Intergenic
949638342 3:6008808-6008830 CATGGGAGAAAGACGTAGGCTGG - Intergenic
950060661 3:10069485-10069507 CATCAGAGGGAGACGGGAGAGGG - Intronic
950156395 3:10724597-10724619 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
950342853 3:12262968-12262990 CATGAGACAGAGACAGAGAAAGG + Intergenic
950795950 3:15510809-15510831 CAAGAGAGAGGAAGGGAGGAAGG + Intronic
951033002 3:17903756-17903778 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
951234034 3:20213619-20213641 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
951253088 3:20416972-20416994 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
951563163 3:23988057-23988079 AAAGAGAGAGAGAAGAAGGAAGG - Intergenic
951617343 3:24562423-24562445 TATGGGAGAAAGACTGAGGAAGG + Intergenic
951993515 3:28701954-28701976 CATGAGAGAAAGATGAAGGCTGG + Intergenic
952029299 3:29121291-29121313 AATGAGAGAGAGAAGGAGGGAGG + Intergenic
952089262 3:29864905-29864927 GAAGAGAGAGAGAGGAAGGAAGG + Intronic
952089266 3:29864927-29864949 GAAGAGAGAGAGAGGAAGGAGGG + Intronic
952652977 3:35748192-35748214 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
952721863 3:36541981-36542003 TATGTTAGAGAGAGGGAGGAAGG + Intronic
953104017 3:39857240-39857262 CAGGAGGGAGGGAGGGAGGAAGG + Intronic
953449915 3:42997417-42997439 CATGAGAGAGAGACAGAGAGAGG + Intronic
953774569 3:45804185-45804207 CAAGAGAGAGAGAGGAAGAAGGG - Intergenic
953911071 3:46893323-46893345 CAAGAGAGAGAAAGAGAGGATGG - Intronic
954365116 3:50141509-50141531 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954573847 3:51663844-51663866 AATGAGTGAGAGAAGGAGGGTGG + Exonic
955080594 3:55654859-55654881 AATGAGAGACAGGCAGAGGAAGG - Intronic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955150499 3:56362156-56362178 AAAGCCAGAGAGACGGAGGAAGG + Intronic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955240876 3:57176977-57176999 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
955483583 3:59413756-59413778 GATGAGAGAGAGAGAGAGAATGG - Intergenic
955874539 3:63476050-63476072 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
955901853 3:63764383-63764405 GAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
956486018 3:69722693-69722715 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
956695237 3:71913130-71913152 CAGGAGAGAGGGAGGGAGGAAGG + Intergenic
956771057 3:72526268-72526290 CATGAGGGAGGGAGGGAGGGAGG + Intergenic
957556538 3:81769285-81769307 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
958715273 3:97773223-97773245 CATGGGAGAAAGACGTAGGCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959456839 3:106573187-106573209 CATGGGAGAAAGATGTAGGATGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959647946 3:108724283-108724305 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
959758564 3:109928845-109928867 GAAGAGAGAGAGAAGGAGGGAGG + Intergenic
960034805 3:113091729-113091751 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
960282318 3:115793006-115793028 CATGAGAGAAAGAGGTAGGCTGG - Intergenic
960290376 3:115877278-115877300 CATGAGGGTGGGAGGGAGGAAGG - Intronic
960633336 3:119755487-119755509 GAAGAGAGAGAGAGGGAGAATGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960879906 3:122333595-122333617 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
960959535 3:123060273-123060295 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
960996717 3:123345096-123345118 CATGGGAGAGAGACAGAGGGAGG + Intronic
961004593 3:123396408-123396430 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
961040118 3:123672238-123672260 CGAGAGAGAAAGAGGGAGGAAGG + Intronic
961180508 3:124872744-124872766 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
961206230 3:125084057-125084079 AGTGAGAGAGACACAGAGGATGG + Intronic
961560607 3:127726253-127726275 AAAGAGAGAGAGAAGGAGGGAGG + Intronic
961879414 3:130050328-130050350 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
961963822 3:130881378-130881400 GATGAGAGAGAGACAAAGGAGGG - Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962585669 3:136840586-136840608 GAAGAGAAAGAGACGGAGGGAGG - Intronic
962916327 3:139907242-139907264 CATGAGAGAGAGAGAGAAGCGGG + Intergenic
962952212 3:140229635-140229657 CCTGAGTGAGTGAAGGAGGAAGG + Intronic
963359217 3:144248971-144248993 AATGAGAGAGAGAGAAAGGAAGG - Intergenic
963359222 3:144249061-144249083 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
963475362 3:145796922-145796944 GATGAGGGAGGGAAGGAGGAGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963772846 3:149406527-149406549 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964426904 3:156563129-156563151 CTTGAGACAGAGGCAGAGGAAGG - Intergenic
964640748 3:158907606-158907628 CATGAAAGATAAAGGGAGGATGG - Intergenic
964646604 3:158964872-158964894 CATGGGAGAAAGACGTAGGCTGG + Intronic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
965038115 3:163468807-163468829 AACGAGAGAGAGAGGAAGGAAGG + Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965077170 3:163993786-163993808 CAAGAGAGAGAGTGGGAGCAGGG - Intergenic
965089879 3:164148798-164148820 AATGAGAGAGAGAGGAAAGAGGG + Intergenic
965291439 3:166886992-166887014 CATGGGAGAAAGATGGAGGCTGG + Intergenic
965321308 3:167254901-167254923 AATGAGAGAGAGAGAGAGAAAGG + Intronic
965636392 3:170785734-170785756 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
966017467 3:175159812-175159834 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966272660 3:178126357-178126379 AAAGAGAGAGTGAGGGAGGAAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
966833513 3:184031204-184031226 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
966947381 3:184786512-184786534 CCAGAGAGAGAGAGAGAGGAGGG + Intergenic
967094581 3:186166658-186166680 AAAGACAGAGAGAAGGAGGAGGG + Intronic
967205113 3:187112548-187112570 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
967227247 3:187303696-187303718 AGAGAGAGAGAGACGGAGGGCGG - Intergenic
967232672 3:187355155-187355177 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
967251688 3:187546619-187546641 CATGAGAGGGAGAAGGTGTAGGG - Intergenic
967283522 3:187846031-187846053 AAAGAAAGAGAGAGGGAGGAAGG - Intergenic
967328112 3:188262613-188262635 CAAGAGAGAGAGAGAGATGAGGG - Intronic
967352073 3:188524939-188524961 GAAGAGAGAGAGAGGAAGGAAGG - Intronic
967512426 3:190327053-190327075 GAGGAGAGAGAGAGAGAGGAAGG + Intronic
967577931 3:191118968-191118990 GATGAGAGACAGAGAGAGGAAGG + Intergenic
968022600 3:195407033-195407055 TATGAGAGAGAGAGGAAGGAAGG + Intronic
968080829 3:195845710-195845732 CAAGCGAGAAAGAGGGAGGAAGG - Intergenic
968150276 3:196332402-196332424 AAAGAGAGAGAGAGAGAGGAGGG + Intronic
968431205 4:560183-560205 CATGTGAGACAGATTGAGGATGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968699397 4:2047471-2047493 CAGGAGACAGAGGCGGAGGTGGG + Intergenic
968862801 4:3185903-3185925 GAAGAGAGAGGGAGGGAGGAAGG + Intronic
968957336 4:3726036-3726058 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
968957350 4:3726081-3726103 GATGAGAGAGGGAGGGAGGGAGG + Intergenic
968973203 4:3807100-3807122 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
968991617 4:3917157-3917179 AAGGAGAGAGGGACGGAGGGAGG + Intergenic
969032128 4:4223951-4223973 GAGGAGAGAGAGAGGGAAGAGGG + Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969444959 4:7239434-7239456 CAAGAGAGAGAGGAAGAGGAGGG - Intronic
969648523 4:8448467-8448489 CATGGAAGAGAGGCGGATGAAGG + Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
970282651 4:14475043-14475065 TATGAGAGAGAGACTGATGATGG + Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970628407 4:17915149-17915171 GATGAGAGAGAGAGAGATGAAGG - Intronic
970672415 4:18412095-18412117 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
970683341 4:18536313-18536335 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
970758407 4:19453633-19453655 CAGGAGAGAGAGAGTGAGAAGGG - Intergenic
970769372 4:19592145-19592167 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
970833062 4:20366144-20366166 AATAAGAGAGGGAGGGAGGATGG - Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971046747 4:22813527-22813549 CATGGGAGAGAGACGTAGGCTGG - Intergenic
971219779 4:24694221-24694243 CAGGAGAGAGAGAGAGATGAAGG + Intergenic
971221098 4:24706569-24706591 CATGAAAGAGAGAGAGAGAAAGG - Intergenic
971263526 4:25077807-25077829 GAAGAGAGAGAGAGGAAGGAAGG + Intergenic
971345645 4:25809645-25809667 AGAGAGAGAGAGATGGAGGAAGG - Intronic
971443179 4:26712460-26712482 CATGAAAGAGAGAAGCAGCAGGG - Intronic
971496707 4:27274447-27274469 CATGAAAGAGAGCTGGAGCAGGG + Intergenic
971727548 4:30333142-30333164 CATGGGAGAAAGATGCAGGATGG - Intergenic
971757097 4:30719630-30719652 TAGGAGAGAGCGAGGGAGGAGGG - Intergenic
971826694 4:31632363-31632385 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
971864211 4:32147734-32147756 AGAGAGAGAGAGACAGAGGAGGG + Intergenic
972096353 4:35351457-35351479 AAAGAGAGAGAGAGAGAGGAGGG + Intergenic
972208476 4:36807029-36807051 CAGGAGAGAGAGAGAGAAGAAGG + Intergenic
972281464 4:37605956-37605978 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
972413278 4:38814505-38814527 CAAGAGAGAGAGAGAGAGGAAGG + Intronic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972919875 4:43925455-43925477 CATGGGAGAAAGATGGAGGCTGG - Intergenic
972986660 4:44773597-44773619 CATTAGAGAGAGATGAAGGTTGG + Intergenic
973171350 4:47147866-47147888 GATAAGATAGAGACAGAGGAAGG + Intronic
973232999 4:47864391-47864413 CAAGACAGAAAGGCGGAGGAAGG - Intronic
973260741 4:48160812-48160834 AAAGAGAGAGAGACAGAGGGAGG + Intronic
973669365 4:53199908-53199930 CATGGCAGAGAGAAGGAGGGAGG + Intronic
973884547 4:55307157-55307179 CAAGAGAGAGAGAGGGTGGTGGG - Intergenic
973926967 4:55748609-55748631 TTTGAGAGAGAGAGAGAGGAGGG + Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974164713 4:58186246-58186268 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
974179002 4:58360638-58360660 CATGGGAGGGAGACTGAGGTGGG - Intergenic
974231212 4:59116576-59116598 CATGAGAGGGACACAGTGGAAGG + Intergenic
974260331 4:59518128-59518150 CATGGGAGAGAGGCTGAGGTTGG - Intergenic
974435910 4:61857049-61857071 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
974469337 4:62297940-62297962 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
974603592 4:64121316-64121338 CCTGAAAGAGATACGGAGAATGG - Intergenic
974606629 4:64160200-64160222 CAGGAGAGAGAGAGGGAAGGCGG - Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975174963 4:71277618-71277640 AATGAGAGAGAGAGGAAGGAAGG - Intronic
975257383 4:72254269-72254291 CATGGGAGAAAGACGTAGGCTGG - Intergenic
975300090 4:72779990-72780012 CAAGAGAGAGAGAGTGGGGAGGG - Intergenic
975319157 4:72990456-72990478 AAAGAGAGAGAAAGGGAGGAAGG + Intergenic
975504416 4:75122597-75122619 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975787459 4:77907491-77907513 GGAGAGAGAGAGACGGAGGGAGG - Intronic
976413776 4:84747623-84747645 CATGAGAGGGACACAGTGGAAGG + Intronic
976486146 4:85607349-85607371 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
977076902 4:92464980-92465002 CAAGAGAGAGAGAGTGAAGAGGG - Intronic
977184925 4:93925121-93925143 CATGTGAGAGAGAGAGAGGTAGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977292924 4:95182516-95182538 GAGGAGAGACAGATGGAGGATGG + Intronic
977320117 4:95503213-95503235 CATGAGAGAGAAACCAAGAAGGG - Intronic
977414914 4:96720934-96720956 CATGAAAGAGACAGGGAGAATGG - Intergenic
977499814 4:97824287-97824309 TATGAGAGAGAGAGAAAGGAAGG - Intronic
977601936 4:98942990-98943012 CATGAGAGAAAGACGTAGGCTGG - Intergenic
977627042 4:99198854-99198876 CATGGGAGAAAGACGTAGGCTGG + Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978498427 4:109384459-109384481 CATGAGAGGGAGACTGAGTCAGG + Intergenic
978646023 4:110932373-110932395 GAAGAGAGAGAGAGGAAGGAAGG - Intergenic
978872307 4:113594125-113594147 AACAAGAGAGAGAAGGAGGAAGG + Intronic
978900806 4:113947511-113947533 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
978993229 4:115113878-115113900 GATGTGAGAGAGAGGGAGGGAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979363203 4:119788876-119788898 CATAAGAGAGAGAAAAAGGAGGG + Intergenic
979363799 4:119796262-119796284 CTTAAGAGAGAGTAGGAGGAAGG + Intergenic
979523943 4:121697702-121697724 TATGAGAGAGAGGGGGAGGGAGG + Intergenic
979649007 4:123107740-123107762 CATGGGAGGGAGGCTGAGGAGGG - Intronic
979740809 4:124148298-124148320 GAAGAGAAAGAGAGGGAGGAAGG - Intergenic
979767289 4:124476862-124476884 CATGAGAGAAAGATGTAGGCCGG - Intergenic
979869119 4:125794326-125794348 TGTGAGAGAGAGAGAGAGGAAGG - Intergenic
979968656 4:127107364-127107386 CCTGAAAGAGATAAGGAGGATGG + Intergenic
979996856 4:127441554-127441576 CAAGAGAGAGAGAGAGAGGGAGG - Intergenic
980135203 4:128852134-128852156 CATGCCATAGAGACTGAGGAAGG + Exonic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980332371 4:131426352-131426374 CGAGAGAGAGAGAGGAAGGAAGG + Intergenic
980436601 4:132783819-132783841 CAGGAGAGAGAGAGTGAGGGTGG + Intergenic
980500002 4:133637428-133637450 CAAGAGAAAGAGAGGAAGGAAGG + Intergenic
980521895 4:133946747-133946769 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
980670256 4:135995502-135995524 AATGAGAGAGAGATGGAGGAGGG - Intergenic
980763384 4:137266549-137266571 CATGGGAGAAAGACAGAGGCCGG - Intergenic
980854724 4:138425365-138425387 CATGAGAGAAAGATGCAGGCTGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980977933 4:139628890-139628912 CTTGAGAGAGAAAGGGAGAAGGG - Intergenic
981489947 4:145328464-145328486 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982129031 4:152210431-152210453 AAAGAAAGAGAGAGGGAGGAAGG + Intergenic
982183631 4:152774079-152774101 CAGGAGGGAGAGAGGAAGGAAGG - Intronic
982310128 4:153975706-153975728 CAGGAGAGAGAGAGAGAGGGAGG - Intergenic
982348158 4:154384666-154384688 CACAAGAGATAGACAGAGGAAGG + Intronic
982370442 4:154627424-154627446 CAGGGGAGGGAGACGGAGGAAGG - Intronic
982397093 4:154924579-154924601 CATGAAAGAGACAGGGAGAATGG - Intergenic
982527152 4:156492114-156492136 CATGAGAGAAAGATGTAGGCTGG - Intergenic
982541613 4:156679135-156679157 CATGAGAGCTATACAGAGGAAGG - Intergenic
982560708 4:156925752-156925774 AAAAAGAGAGAGACGGGGGATGG + Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
982886859 4:160792260-160792282 CAAGAGAGAGAGAGAGAGTAGGG - Intergenic
982904506 4:161050502-161050524 CATGGGAGAAAGATGAAGGACGG + Intergenic
983350509 4:166581900-166581922 GATCAGAGAGACAGGGAGGAGGG + Intergenic
983355760 4:166655720-166655742 AAAGAGAGAGAGGCGGAGGAAGG + Intergenic
983443436 4:167817587-167817609 TGTGAGAGAGAGACAGAGTAGGG - Intergenic
983459051 4:168004212-168004234 CATGAGAGAAAGATGAAGGCTGG + Intergenic
983689547 4:170451620-170451642 CATGAGAGAAAGATGTAGGCTGG - Intergenic
983691044 4:170469578-170469600 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
984145806 4:176058718-176058740 CATGACAGAGAGACTGGGGTGGG + Intergenic
984587159 4:181577966-181577988 CATGAAAGAGCAATGGAGGATGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985031222 4:185792516-185792538 GAAGAGAGAGAGAGGGAGGGAGG + Intronic
985219224 4:187685200-187685222 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
985219230 4:187685223-187685245 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
985777685 5:1853360-1853382 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
985873940 5:2581098-2581120 CAGGAGGGAGGGAGGGAGGAAGG - Intergenic
985884313 5:2664796-2664818 TTTGAGATAGAGAGGGAGGAAGG + Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
986181102 5:5393596-5393618 CATGGGAGAAAGACGAAGGCTGG + Intergenic
986225367 5:5807140-5807162 GAAGAGAGAGAGAGGGAGGTGGG - Intergenic
986309862 5:6543944-6543966 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
986313172 5:6569831-6569853 CATGAGAGAAAGATGTAGGCTGG - Intergenic
986368612 5:7059246-7059268 CATGAGGGACAGAAGTAGGAAGG + Intergenic
986796754 5:11220097-11220119 CATGAGAGAAAAACAGAAGAGGG + Intronic
986837006 5:11650214-11650236 GAAGAGAGAGTGAAGGAGGAGGG - Intronic
987494733 5:18629530-18629552 CAAGAGAGAGAGAGAGAGAAGGG + Intergenic
987517048 5:18924083-18924105 AATGAGAGAGAGAAAGAAGAAGG + Intergenic
987542925 5:19277884-19277906 CAGGAGAGAGAGAGAGAGAAAGG - Intergenic
987602931 5:20095476-20095498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
987815742 5:22899624-22899646 GATGAGAGAGAAAAGGAGGCAGG + Intergenic
987824582 5:23012581-23012603 AAGGAGAGAGAAAGGGAGGAAGG - Intergenic
988161244 5:27520436-27520458 CATGGGAGAGAGATGTAGGCTGG + Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988329372 5:29815178-29815200 AAGGAGAGAGGGAGGGAGGAAGG + Intergenic
988360387 5:30229870-30229892 AAAGAGAGAGAGGAGGAGGAAGG + Intergenic
988438161 5:31200716-31200738 AGTGAGGGAGAGAGGGAGGAAGG + Intronic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
988587160 5:32517259-32517281 CATGAGAGAGGGAAGGAGTATGG + Intergenic
988773073 5:34450999-34451021 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
989071223 5:37513709-37513731 CATGGGAGAAAGACGTAGGCTGG + Intronic
989214277 5:38888062-38888084 CATGCGAGACAGACGGAGGAGGG + Intronic
989331356 5:40262784-40262806 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
989425453 5:41290911-41290933 CATGGGAGGGAGACTGAGCAGGG - Intergenic
989525360 5:42447613-42447635 AAAGAGAGAGAGATGGAGGGAGG - Intronic
989525382 5:42447712-42447734 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
989545342 5:42665981-42666003 CATGAGAGGGAGCTGGTGGAAGG - Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
989724774 5:44575101-44575123 AATGACAGAGAGATGGAGGATGG - Intergenic
989782199 5:45281309-45281331 CAGGAGAGAGAGAGAGAGAAGGG - Intronic
989810611 5:45668380-45668402 CAGGAGAGAGAGATTGAGGGAGG - Intronic
990183956 5:53192627-53192649 CATAAGAGAGAGGCAGAGGGGGG + Intergenic
990213892 5:53509466-53509488 CAGGAGAGAGAGAGAGAAGAGGG + Intergenic
990235053 5:53758354-53758376 CATGAGAGAGAGAGGCTGGGGGG - Intergenic
990336747 5:54780723-54780745 AATGAGAGAGAGAGAGAGAAGGG - Intergenic
990339170 5:54805435-54805457 GAGGAGAGAGAGATAGAGGATGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990846014 5:60140518-60140540 AAAGAGAGAGAAAAGGAGGAAGG + Intronic
990892033 5:60660299-60660321 CAGGAGAGAGAGACAAAGGGGGG + Intronic
990985347 5:61636503-61636525 CATGCGAGAGAGAGAGAGGAAGG - Intergenic
991073119 5:62508611-62508633 AAAGAGAGAGAGACGGAGGGAGG - Intronic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991172497 5:63645145-63645167 CATGATAGAGGCATGGAGGATGG - Intergenic
991204693 5:64037563-64037585 CAGGAGAGAGAGAGGGAGAGGGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
991429590 5:66530424-66530446 GATGAGGGAGAGAGGGAGGGAGG - Intergenic
991548615 5:67811838-67811860 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
992154717 5:73943758-73943780 AATGAGAGAGATACAGAGGTTGG - Intergenic
992575591 5:78107430-78107452 AAAGAGAGAGAGAGGGAGCATGG - Intronic
992977839 5:82138876-82138898 CATGAGAGGGAGAGGGAGAGGGG - Intronic
993005569 5:82425133-82425155 CAAGAGAGAGAGAGGGAGGGAGG + Intergenic
993089624 5:83409297-83409319 CATGAAAGAGACAGGGAGAATGG + Intergenic
993248003 5:85476756-85476778 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
993251121 5:85524350-85524372 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993430193 5:87823355-87823377 CAAGAGAGAGAGAAAGAGGAAGG + Intergenic
993481181 5:88426305-88426327 AAAGAGAGAGAGAGGGAGGTGGG + Intergenic
993592197 5:89808050-89808072 CATGAGACATAGAGGGAGGAGGG - Intergenic
993618443 5:90139951-90139973 CATGAGAGAAAGACGTAGGCTGG + Intergenic
993622386 5:90184016-90184038 CATGAAGGAAAGAAGGAGGAAGG + Intergenic
994084579 5:95744033-95744055 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
994088773 5:95789689-95789711 AAGGAGAGAGAGAGGGAGTAAGG + Intronic
994508899 5:100678207-100678229 AGTGAGAGAGAGAGGGAGGGAGG + Intergenic
994642926 5:102432879-102432901 CCTGAAAGAGATAGGGAGGATGG - Intronic
994836712 5:104864747-104864769 CATGAGAGAAAGATGTAGGCTGG - Intergenic
995470598 5:112498058-112498080 GAAAAGAGAGAGACGGAGGTAGG - Intergenic
995810169 5:116097803-116097825 AACAAGAGAGAGAGGGAGGAGGG + Intronic
996250917 5:121331006-121331028 CATGAGAGAGACACAGTGGGAGG + Intergenic
997183262 5:131855522-131855544 CAAAAGAGAGAGAGGGAGGAAGG + Intronic
997259356 5:132454266-132454288 CAGGAGAGAGACAGGCAGGAGGG - Intronic
997577660 5:134995002-134995024 AAAGAGAGAGAGAGGGATGAAGG - Intronic
997723306 5:136098199-136098221 CAAGAGAGAAAGAGGGGGGATGG + Intergenic
997952773 5:138255012-138255034 AAGGAGAGAGAGAGGAAGGAAGG + Intronic
998128376 5:139638933-139638955 CATGGATTAGAGACGGAGGAGGG - Intergenic
998258186 5:140606145-140606167 AAAGAAAGAGAGAGGGAGGAAGG - Intergenic
998484715 5:142491562-142491584 TATTAGAGAGAGAGGGAGGAAGG + Intergenic
998498107 5:142608434-142608456 CATTAGAGAAAGACAGAGAAGGG + Intronic
998511131 5:142714858-142714880 CAGGAGAGAGACAGGAAGGATGG - Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
998875812 5:146597945-146597967 CATTAGAGAGAGACCGCTGAAGG - Intronic
998978271 5:147672179-147672201 CATGAAAGAGTGAAGGATGAAGG - Intronic
999030426 5:148284314-148284336 AAAGAGGGAGAGAGGGAGGAAGG - Intronic
999048845 5:148499869-148499891 CAAGAGAGAGAAAGAGAGGAGGG - Intronic
999298584 5:150476108-150476130 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
999454102 5:151700302-151700324 AAAGAGAGAGAGACAGAGGTGGG + Intergenic
999792094 5:154950143-154950165 CAGGAGAGAGAGACAGTGCAGGG + Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000372896 5:160554273-160554295 TATGAGAGGGAGACAGAAGAAGG - Intergenic
1000687474 5:164270208-164270230 CAGGAGAGAGGGAGGGAGGGAGG - Intergenic
1000847564 5:166300423-166300445 GATGAGAGAGAAGCGGAGGCAGG + Intergenic
1001176130 5:169470584-169470606 CAAGAGAGAGAGAGAGAGGGAGG - Intergenic
1001319558 5:170669028-170669050 GATGAGAAAGAGAAGCAGGAGGG - Intronic
1001321521 5:170686347-170686369 AATGAGAGAGAGGGGGAGGGAGG + Intronic
1001445542 5:171779852-171779874 AAGGAGAGAGAGAGGGAGAAGGG + Intergenic
1001511071 5:172322374-172322396 AAGGAGAGAGATAGGGAGGAAGG - Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002317703 5:178354610-178354632 CAGGAGAGAGAGACAGCGAAGGG - Intronic
1002639043 5:180621987-180622009 CAGGAGAGAGGGAGGGAGGGAGG - Intronic
1002910081 6:1483414-1483436 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1003263768 6:4549170-4549192 GAAGAGGGAGAGAGGGAGGAAGG + Intergenic
1003297665 6:4847280-4847302 CATGAGACAGGGACGGATGGGGG - Intronic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003457198 6:6293772-6293794 AGTGAGAGAGAGAGGGAGGGAGG + Intronic
1003691788 6:8362026-8362048 CACGAGAGAAAGACGAAGGCTGG + Intergenic
1003926888 6:10884529-10884551 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1004076186 6:12346155-12346177 CCTGGGAGAGGGATGGAGGAAGG + Intergenic
1004184356 6:13409212-13409234 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1004583860 6:16980380-16980402 AAGGAGAGAGACACGGAGGGAGG - Intergenic
1004602385 6:17162831-17162853 CGAGAGAGAGAAAGGGAGGAAGG + Intergenic
1004725633 6:18308847-18308869 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1004725647 6:18308913-18308935 GAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1004778863 6:18882342-18882364 CAAGAGAGAGAGAGTGAGGGAGG - Intergenic
1005089534 6:22042303-22042325 CATGAGGGAGGGAGGGAGGAAGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006187708 6:32190175-32190197 TGTGTGAGAGAGAGGGAGGAGGG + Exonic
1006485303 6:34334987-34335009 GAAGAGAGAGAGAGGAAGGAAGG + Intronic
1006562985 6:34929796-34929818 AGAGAGAGAGAGAAGGAGGAAGG - Intronic
1006694538 6:35920532-35920554 CAGGAGAGAGGGATGGATGAAGG + Intronic
1006815537 6:36847367-36847389 CATGAGGGAGAGAGAGAAGAGGG + Intergenic
1006970851 6:38043503-38043525 AAGGAGAGAGGGAGGGAGGAAGG - Intronic
1007054967 6:38874112-38874134 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007054972 6:38874155-38874177 AAAGAAAGAGAGAAGGAGGAAGG - Intronic
1007070007 6:39029537-39029559 TATGAGAGAGACACTGGGGAGGG + Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007342705 6:41201546-41201568 CCTGGGAGAGAGAGAGAGGAAGG - Intergenic
1007404424 6:41625838-41625860 CAAGAGAGGGGGACAGAGGAAGG - Intergenic
1007522841 6:42465689-42465711 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1007616647 6:43183729-43183751 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1007623943 6:43231946-43231968 GAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1007927824 6:45663902-45663924 CGTGAGAGAGCGGAGGAGGAGGG - Intronic
1008161151 6:48077759-48077781 GATGAGAGAGAGAGAGATGAAGG + Intergenic
1008231563 6:48989974-48989996 CATGAGAGAGAGGCTGAAGTGGG + Intergenic
1008265143 6:49415691-49415713 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1008326419 6:50187521-50187543 CAGGAGAGAGAAAAGGAGGGAGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008869879 6:56260614-56260636 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1009243410 6:61205162-61205184 CATGGGAGGGAGACTGAGGGGGG - Intergenic
1009295630 6:61942958-61942980 GAGGAGAGAGAGAGGGAGGGAGG + Intronic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1009730031 6:67590019-67590041 CATGAGAGAAAGATGTAGGTTGG - Intergenic
1009828334 6:68897395-68897417 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1010059273 6:71603926-71603948 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
1010087476 6:71937654-71937676 CATGAGACAGAGAGGGAAAATGG + Intronic
1010138230 6:72581169-72581191 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1010196881 6:73248435-73248457 CAGGAGGGAGAGAGGAAGGAGGG - Intronic
1010580491 6:77591673-77591695 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1010772330 6:79845892-79845914 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1010974406 6:82296238-82296260 CAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1011752339 6:90465757-90465779 CATGAGAGAAAGGTGAAGGATGG + Intergenic
1011773563 6:90702443-90702465 CATGAGAGATCTACTGAGGATGG + Intergenic
1011824092 6:91286364-91286386 CAGGAGAGAGAGGCTGAGTATGG + Intergenic
1012064266 6:94529488-94529510 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1012261363 6:97091308-97091330 CATGACACAGACACGGAGGCAGG - Intronic
1012306887 6:97669443-97669465 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1012519986 6:100109876-100109898 AAGGAGAGAGAAAGGGAGGATGG - Intergenic
1012921235 6:105222960-105222982 CATGAGAGAAAGACGTAGGTGGG + Intergenic
1013362132 6:109403861-109403883 CATGAGAGAAATGTGGAGGAAGG + Intronic
1013496681 6:110704818-110704840 AATGAGAGGGAGATGGAGGGAGG + Intronic
1013691773 6:112653131-112653153 AAAGAGGGAGAGAGGGAGGAAGG - Intergenic
1013724735 6:113080104-113080126 AAAGAGAGAGAGAAGAAGGAAGG + Intergenic
1013910913 6:115274839-115274861 CATGAGAGAGAGAGAGAGTTAGG - Intergenic
1014008919 6:116454167-116454189 AGAGAGAGAGACACGGAGGATGG + Intergenic
1014164474 6:118208055-118208077 TGTGAGAGAGAGAGAGAGGAGGG - Intronic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1014769211 6:125442276-125442298 TGTGAAAGAGAGAGGGAGGAGGG - Intergenic
1014856783 6:126411949-126411971 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1015027495 6:128554069-128554091 GAAGAGAGGGAGAAGGAGGATGG - Intergenic
1015310496 6:131761980-131762002 AATGAAAGAGAGAGAGAGGAAGG - Intergenic
1015347141 6:132174004-132174026 CAGGAGAGAGAGACGGAAGGGGG + Intergenic
1015680258 6:135799595-135799617 CAAGAGAGAGAGAGAGAGGAGGG - Intergenic
1015845174 6:137512982-137513004 CAAGAGAGAGAAAAGGAGTAGGG - Intergenic
1015848357 6:137546049-137546071 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1016199625 6:141392837-141392859 GAAGAAAGAGAGAAGGAGGAAGG - Intergenic
1016268680 6:142261956-142261978 CAGGAGTGAGAGAGGGAGCAAGG - Intergenic
1016385170 6:143523827-143523849 CATGGGAGAGAGCCGGTGGGAGG + Intergenic
1016844040 6:148553711-148553733 TGTGAGAGAGAAAGGGAGGAGGG + Intergenic
1016917093 6:149254044-149254066 AAAGAGGGAGAGAGGGAGGAAGG + Intronic
1017385385 6:153876709-153876731 AGAGAGAGAGAGATGGAGGAAGG + Intergenic
1017443197 6:154483711-154483733 AATGAGAGAGAGAGGGAGAGAGG - Intronic
1017447267 6:154518127-154518149 AAAGAGAGAGAGAGGAAGGAGGG + Intergenic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1017708211 6:157144108-157144130 CATGAGTGAGAGATGGAGGTAGG + Intronic
1017979241 6:159385048-159385070 CAAGAGAGAGAGAGCGAAGAGGG + Intergenic
1017988856 6:159469090-159469112 GAAGAGAGAGAGAGGCAGGAGGG + Intergenic
1018285729 6:162235819-162235841 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1018332592 6:162747226-162747248 CATGGGAGAAAGACGTAGGCTGG - Intronic
1018367471 6:163136232-163136254 CATCAGAGAGAGGCAGAGCAGGG - Intronic
1018760760 6:166892386-166892408 GGAGAGAGAGAGACAGAGGAGGG + Intronic
1018838559 6:167502967-167502989 CAGGAGGGAGAGCCAGAGGATGG + Intergenic
1019273973 7:166275-166297 AAAGAGGGAGAGAGGGAGGAAGG - Intergenic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019404754 7:877496-877518 GAAGAGAGAGAGACGGGGGGTGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019667685 7:2260023-2260045 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019809281 7:3152706-3152728 AGAGAGAGAGAGAGGGAGGAAGG + Intronic
1019972114 7:4549634-4549656 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1020025774 7:4898908-4898930 AAAGAAAGAGAGACAGAGGAAGG + Intergenic
1020073489 7:5242552-5242574 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1020091429 7:5344460-5344482 CATGAGAGCGAGGAGGGGGAAGG + Intronic
1020942043 7:14552524-14552546 CATGAGACAGGGAGGGAGGAGGG - Intronic
1021128278 7:16880123-16880145 AAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021225633 7:18022617-18022639 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1021385803 7:20028296-20028318 CAGGAGAGAGAGAGGGAAAAGGG - Intergenic
1021447490 7:20749144-20749166 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1021887337 7:25152690-25152712 GAAGAGAGAGAGAAAGAGGAAGG - Intronic
1021918347 7:25457585-25457607 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022532436 7:31075477-31075499 CAGGAGAGAGTGGCAGAGGATGG - Intronic
1022629509 7:32071501-32071523 CAAGAGAGAGAGATGGGGGTGGG - Intronic
1022662516 7:32380213-32380235 AAAGAGAGAGAGAGAGAGGATGG - Intergenic
1022783443 7:33610512-33610534 CAAGAGAGAAAGAGGGAGTAGGG + Intergenic
1023198952 7:37672790-37672812 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1023217720 7:37882524-37882546 AAGGAGGGAGAGAGGGAGGAAGG + Intronic
1023334319 7:39152394-39152416 CTGGAGAGAGATACGAAGGAAGG + Intronic
1023427093 7:40049213-40049235 GAGGAGAGAGGGAAGGAGGAAGG + Intronic
1023616167 7:42022498-42022520 AAAGAGAGAGAGCAGGAGGAGGG + Intronic
1023942537 7:44779083-44779105 CATGGGAGAAAGATGAAGGAGGG + Intergenic
1024049142 7:45607589-45607611 GAGGAGAGAGGGACGGAGGGAGG - Intronic
1024135665 7:46405546-46405568 AGAGAGAGAGAGACGAAGGATGG - Intergenic
1024217246 7:47257731-47257753 CGAGAGAGAGAGACAGAGAAAGG - Intergenic
1024413653 7:49078178-49078200 CATGGGAGAGAGCCGGTGGAAGG - Intergenic
1024471360 7:49771011-49771033 AAAAGGAGAGAGACGGAGGAGGG + Intergenic
1024826922 7:53401114-53401136 CATGAGAGGGACTCGGTGGAAGG - Intergenic
1025160380 7:56654222-56654244 CATGAAAGAGGGACTGAGGAGGG + Intergenic
1025216163 7:57058396-57058418 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1025655217 7:63512308-63512330 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1025737730 7:64166647-64166669 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1025847830 7:65216726-65216748 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026080611 7:67215805-67215827 CATGGGAGAGAGATGTAGGCTGG + Intronic
1026123247 7:67556120-67556142 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1026494091 7:70887941-70887963 GAAGAGAGAGAGAAGGAGGGTGG + Intergenic
1026508546 7:71007690-71007712 AATGAAAGAGACACTGAGGAGGG - Intergenic
1026589134 7:71680635-71680657 AAGGAGGGAGAGAGGGAGGAAGG - Intronic
1026591724 7:71702128-71702150 GAGTAGAGAGAGAGGGAGGAGGG + Intronic
1026608823 7:71839122-71839144 CTTGAGAGAGAGAGAGAGAAAGG + Intronic
1026615379 7:71897990-71898012 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1026677154 7:72437686-72437708 AAAGAGAGAGGGAGGGAGGAAGG - Intronic
1026696478 7:72598224-72598246 CATGGGAGAGAGATGTAGGGTGG - Intronic
1026737248 7:72956811-72956833 TATAAGAGAGAGGCAGAGGAAGG + Intergenic
1026787446 7:73310793-73310815 TATAAGAGAGAGGCAGAGGAAGG + Intergenic
1027106484 7:75408257-75408279 TATAAGAGAGAGGCAGAGGAAGG - Intronic
1027611009 7:80360523-80360545 CAAGAGAGAGAGAGAGAGAAAGG - Intergenic
1028134284 7:87210030-87210052 GGTGACAGAGAGACAGAGGAGGG + Intronic
1028262803 7:88685787-88685809 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1028297715 7:89155955-89155977 AAAGAGAGAGAGACAGAGGAGGG - Intronic
1028369764 7:90077917-90077939 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1028380953 7:90197877-90197899 AGTGAGAGAGAGAAGGAGTAAGG - Intronic
1028519302 7:91712108-91712130 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1028636791 7:92998010-92998032 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1029027759 7:97435480-97435502 GATGAGAGAGGGAGGGAGGAAGG + Intergenic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029141579 7:98414619-98414641 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029401690 7:100351194-100351216 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1029607798 7:101609509-101609531 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1029748732 7:102531164-102531186 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1029766679 7:102630248-102630270 AAGGAGAGAGAGAGGAAGGAAGG - Intronic
1029885933 7:103871730-103871752 GATGAGAGAGAGAAGGAGAATGG + Intronic
1030174409 7:106636433-106636455 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1030396736 7:108995453-108995475 CAAGAGAGAGAGATGGGAGAAGG + Intergenic
1030509918 7:110471390-110471412 AGAGAGAGAGAGATGGAGGATGG + Intergenic
1030677976 7:112404836-112404858 CATGAAAGATAAAGGGAGGAGGG + Intergenic
1030802479 7:113869165-113869187 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1030811946 7:113983379-113983401 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1030882909 7:114903643-114903665 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1030930970 7:115523098-115523120 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1030942489 7:115671296-115671318 AAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1031077636 7:117228128-117228150 CAAAAGAGAGAGATGGAGTAAGG - Intronic
1031201521 7:118693858-118693880 AAGGAGAGAGGGAGGGAGGAAGG - Intergenic
1031561372 7:123242840-123242862 AAAGAAAGAGAGACAGAGGAGGG + Intergenic
1031682890 7:124695897-124695919 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1032089559 7:128904423-128904445 CAGGAGAGAGAGAAAGAGGGAGG - Intronic
1032347941 7:131134266-131134288 CATGAGAGTGGGACAGAGGGAGG - Intronic
1032364124 7:131283392-131283414 AAAGAGAGAGAGAGGAAGGAAGG - Intronic
1032449997 7:132022444-132022466 AAAGAAAGAGAGAGGGAGGAAGG - Intergenic
1032533907 7:132644860-132644882 TATGAGAGAGAGAGGGAGGTGGG - Intronic
1033026700 7:137781477-137781499 GTTGAGAGAGAGGAGGAGGAAGG - Intronic
1033031307 7:137829978-137830000 AATGAGAGAGAGAGGGAAGGAGG + Intronic
1033115150 7:138618707-138618729 CGCGAGAGAGAGAGAGAGGAAGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033432319 7:141300424-141300446 AATGAGAAAGTGAGGGAGGATGG + Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033519362 7:142145411-142145433 GATCAGAGAGAGAGGGAGGAAGG - Intronic
1033593679 7:142837682-142837704 AAAGAGAGAGAGAAGAAGGAAGG + Intergenic
1034003326 7:147441872-147441894 GAACAGAGAGAGACGGAGGGAGG - Intronic
1034397994 7:150841973-150841995 CCTGAGAGAGGCACTGAGGAGGG + Intronic
1034461786 7:151201688-151201710 CTTGAGAGAGAGAGGAAGGCGGG + Intronic
1034689142 7:153000030-153000052 CAGGAGAGAGAGAGAGAGGGAGG + Intergenic
1034744032 7:153505324-153505346 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1034754956 7:153607559-153607581 CATGAGGGAGTGACGGAGGTAGG + Intergenic
1034869244 7:154668863-154668885 GTCGAGAGAGAGAGGGAGGAAGG - Intronic
1034947644 7:155273679-155273701 CATAAGAGAGAGATGGAGAGAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035150138 7:156863291-156863313 CATGAGAGAAAGATGTAGGCTGG + Intronic
1035764050 8:2091556-2091578 CACGACAGAGAGAGGGTGGAGGG - Intronic
1035931420 8:3784131-3784153 CATGAGAGAGAGAAAGAGAGAGG - Intronic
1036017720 8:4804526-4804548 CGTGAGAGAGAGAGAGAGGGAGG + Intronic
1036129686 8:6097584-6097606 GAGGAGAGAGAGACCGAGGGGGG + Intergenic
1036385887 8:8281347-8281369 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1037992601 8:23331335-23331357 GATAAGAGAGAGCCAGAGGAGGG - Intronic
1038115009 8:24543898-24543920 CGTGAGAGAGAGAGGAAGGGAGG - Intergenic
1038317810 8:26502432-26502454 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038720471 8:30030914-30030936 AATAAGAGAGAGAGGGAGGGAGG + Intergenic
1038723494 8:30058975-30058997 CAAGAGAGAGCGAGGGAGGGAGG - Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1038975880 8:32695370-32695392 GGTGAGAGAGAGAGAGAGGAAGG + Intronic
1038980364 8:32752690-32752712 AATGACAGAGAGACCGAGGAAGG - Intronic
1039187163 8:34930401-34930423 AAAGAGAGAGAGAAGAAGGAGGG + Intergenic
1039428585 8:37506822-37506844 GAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1039455358 8:37702365-37702387 TAGGAGAAAGAGGCGGAGGAGGG - Intergenic
1039455942 8:37706682-37706704 AAGGAGAGAGAGAGGAAGGAGGG + Intergenic
1039459246 8:37729517-37729539 CAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1039708518 8:40032033-40032055 GAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1039750367 8:40473175-40473197 AAGGAGGGAGAGACGGAGGGAGG + Intergenic
1039820656 8:41131311-41131333 CATGAAAGAGACAGGGAGAATGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041023036 8:53657602-53657624 GATGAGAGAGAGAGGGATGACGG - Intergenic
1041343982 8:56876501-56876523 CGTGAGAGACAGAAGGAGGGAGG + Intergenic
1041447672 8:57970675-57970697 AAAAATAGAGAGACGGAGGAAGG - Intergenic
1041896214 8:62927180-62927202 CATGAGAGTGAGTGGGAGGGGGG - Intronic
1041965510 8:63670346-63670368 CATGAGACAGAGGCTGAAGAGGG - Intergenic
1042014466 8:64292749-64292771 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1042399826 8:68332012-68332034 CAGGAGAAAGGGACGGAGAAAGG + Intronic
1042460914 8:69067296-69067318 AGAGAGAGAGAGAGGGAGGAGGG - Intergenic
1042553689 8:70016279-70016301 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043147230 8:76673836-76673858 CAGGAGAGAGAAATGGGGGAGGG + Intergenic
1043248974 8:78045273-78045295 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1043267695 8:78286993-78287015 AAAGAGAGAGGGAGGGAGGAAGG + Intergenic
1043278374 8:78430877-78430899 CAGTAGAGAGACACGGTGGATGG + Intergenic
1043400867 8:79882947-79882969 AAAGAGAGAGAGAGGGAAGAGGG - Intergenic
1043438679 8:80258030-80258052 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1043451261 8:80369328-80369350 AATGAGGGAGACACAGAGGAAGG + Intergenic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043917593 8:85940538-85940560 CAACAGAGAGAGAATGAGGAAGG + Intergenic
1044186398 8:89256884-89256906 GAGGTGAGAGAGAGGGAGGAGGG + Intergenic
1044203747 8:89467412-89467434 AGAGAGAGAGAGACGGAGGGAGG + Intergenic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1044492882 8:92841412-92841434 TATGAGAGAGAGATGGTGCAAGG - Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044945726 8:97387116-97387138 CATGTGAGAGAGACAGTGGTAGG + Intergenic
1045099331 8:98828603-98828625 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045258878 8:100554101-100554123 CATGAGAGAGAGCCAGAGACAGG + Intronic
1045316687 8:101049468-101049490 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1045397856 8:101778960-101778982 CATGGGAGAGGGATGGGGGATGG + Intronic
1045958043 8:107932799-107932821 AATGAGAGAGAGAGAGAGCAAGG + Intronic
1046089790 8:109487875-109487897 AAAGAGAGAGAGAGAGAGGAAGG + Intronic
1046315374 8:112494272-112494294 AGTGAGAGAGAGAGGAAGGAAGG - Intronic
1046330233 8:112704646-112704668 CTTGAGAGAGAGAGAGAGGATGG - Intronic
1046400285 8:113696567-113696589 CATGGGAGAAAGATGTAGGATGG - Intergenic
1046630373 8:116617476-116617498 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046724367 8:117658393-117658415 CAGGATAGAGAGAGCGAGGAGGG + Intergenic
1046839412 8:118840747-118840769 CAGGAGAGAGAGACCGAGAGTGG + Intergenic
1047509118 8:125502885-125502907 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1047629568 8:126692231-126692253 CAAGAGAGAGGGAAGGAGGGAGG - Intergenic
1048037157 8:130688242-130688264 CCTGAGACATAGATGGAGGAAGG + Intergenic
1048326028 8:133440118-133440140 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1048369880 8:133768028-133768050 CAGGAGGAAGAGATGGAGGAAGG - Intergenic
1048383116 8:133885843-133885865 CAAGAGAGAGAGACTGGAGAAGG + Intergenic
1048634817 8:136284455-136284477 CATACGAGAAAGACGGAGGCTGG + Intergenic
1048758766 8:137768034-137768056 CAGGAGAGAGAGACAGAGTGAGG - Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048846751 8:138609676-138609698 GATTAGAGAAAGAAGGAGGAGGG - Intronic
1048908816 8:139114735-139114757 CATGGGAGAAAGACGTAGGCTGG + Intergenic
1049271874 8:141700441-141700463 TCAGAGAGAGAGAGGGAGGAGGG + Intergenic
1049465802 8:142750790-142750812 CATGAGGGAGAGAGGAAGGAAGG + Intronic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1049834782 8:144728203-144728225 TAGGAGAGAGAGAGGGAGGTAGG + Intronic
1050120336 9:2301204-2301226 CAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1050406042 9:5309557-5309579 AAAGAAAGAGAGGCGGAGGAGGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050629475 9:7543461-7543483 CATGGGAGAGAGGGGGAGAAAGG - Intergenic
1050648067 9:7743649-7743671 AATGAGGGAGAAAGGGAGGAAGG - Intergenic
1050707192 9:8414868-8414890 CAGGAGAGAGGGAGGGAGGGAGG + Intronic
1050890235 9:10816037-10816059 GATGGGGGAGAGACGGAGGAGGG + Intergenic
1050967921 9:11832443-11832465 TGTGAGAGAGAGAGAGAGGAAGG + Intergenic
1051160025 9:14197266-14197288 CAGGAGAGTGAGACTGAGAAAGG - Intronic
1051453608 9:17226867-17226889 CAAGAGAGAGAGACAGGGCATGG + Intronic
1051861845 9:21633993-21634015 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1051862255 9:21639384-21639406 AAAGAAAGAGAGACGGAGGGAGG + Intergenic
1051910417 9:22148726-22148748 CAGGAGTGAGAGACAGAAGAGGG - Intergenic
1052141090 9:24984917-24984939 CAAGAGAGAGACATGGAGAAGGG + Intergenic
1052353289 9:27479226-27479248 CAAGAGAGAGAGAGGGAAGGAGG + Intronic
1052492252 9:29184732-29184754 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1052674177 9:31597574-31597596 AAAGAGAGAGAGACAGAGAAAGG + Intergenic
1052809810 9:33047511-33047533 CATAGGAGAAAGATGGAGGAGGG + Intronic
1053003343 9:34589786-34589808 CATGGGCGAGAGAAGGAGGGAGG - Intronic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053519597 9:38764348-38764370 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
1053580422 9:39398417-39398439 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1053580537 9:39399438-39399460 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1053922769 9:43014646-43014668 TGTGAGAGAGAGAGGGAGGGAGG - Intergenic
1054102009 9:60957222-60957244 AGAGAGAGAGAGAGGGAGGAAGG - Intergenic
1054102124 9:60958243-60958265 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1054584235 9:66948620-66948642 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1054584346 9:66949637-66949659 AGAGAGAGAGAGAGGGAGGAAGG + Intergenic
1054926840 9:70598093-70598115 GATGGGAGAGAGAGGGAGGGAGG - Intronic
1055066605 9:72125343-72125365 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1055371181 9:75601352-75601374 AAGGAGAGAGAGAAGGAAGAAGG - Intergenic
1055916347 9:81404553-81404575 CATGAGAGAGAGACAGCGACGGG - Intergenic
1056047701 9:82736258-82736280 AATGAGATAGAGACAGAGGAGGG - Intergenic
1056252790 9:84767720-84767742 GAGGAGAGAGAGACGTAGTATGG - Intronic
1056540232 9:87564621-87564643 CAAGAGGGAGGGAGGGAGGAAGG + Intronic
1056545124 9:87606706-87606728 AGGGAGAGAGAGAGGGAGGAAGG - Intronic
1056597672 9:88021038-88021060 AAGGAGAGAGAGAAGAAGGAAGG - Intergenic
1056635572 9:88328646-88328668 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1056775825 9:89511974-89511996 CATGGCAGAGAGATGGAAGAGGG - Intergenic
1056833659 9:89936428-89936450 CATGAGAGAAAGAAGGGGGTGGG + Intergenic
1056970104 9:91194582-91194604 AAAGAGAGAGAGAGGAAGGAGGG - Intergenic
1057011060 9:91601635-91601657 GAAGAGAGAGAGAGGAAGGAAGG - Intronic
1057194797 9:93110951-93110973 CATGAGAGAGAGACGGAGGAAGG - Intronic
1057519744 9:95751657-95751679 CATGAGGGAGGGAGGGAGGGAGG + Intergenic
1057565052 9:96160100-96160122 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1057761265 9:97876497-97876519 CTTAAGAGGGAGATGGAGGAAGG + Intergenic
1057851936 9:98572668-98572690 CCTGAGAGTGAGAAGGAGGCAGG + Intronic
1058060225 9:100487462-100487484 CTTTAGAGAGAGAAGGAGGCTGG - Intronic
1058309393 9:103483160-103483182 CAGGAGAGAGAGAGAGAGGTTGG - Intergenic
1058386698 9:104444809-104444831 CATAGGAGAGAGATGGAGGCTGG - Intergenic
1058634071 9:107019440-107019462 CTTGAGAGAGAGAGGGTTGAGGG + Intergenic
1058909340 9:109506567-109506589 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1059262892 9:112995505-112995527 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1059336473 9:113572291-113572313 CATGACAGAGGGAGGCAGGAGGG + Intronic
1059550865 9:115227564-115227586 CATGAGAGAAAGATGAAGGCTGG + Intronic
1059688925 9:116665030-116665052 CAAGAAAGAGAGAGGGAGGGAGG - Intronic
1059701923 9:116783341-116783363 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1059733263 9:117077117-117077139 CAGGGGAGAGAGACAGAGGTTGG + Intronic
1059750734 9:117244793-117244815 AAGGAGAGAGGGAGGGAGGAAGG + Intronic
1059929861 9:119249951-119249973 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059929886 9:119250039-119250061 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059965502 9:119609773-119609795 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1059965515 9:119609847-119609869 AAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1059986727 9:119827650-119827672 CATCAGAGAGAGAAGGGGCAGGG + Intergenic
1060499738 9:124144117-124144139 GAAGAGAGAGAGAGGGAGAAAGG - Intergenic
1060541463 9:124433350-124433372 AAAGAGAGAGAGATGGAGGAAGG + Intergenic
1060571287 9:124642809-124642831 CATGAGAGAGGGAGGTAGCAGGG + Intronic
1060592701 9:124828960-124828982 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060592713 9:124829028-124829050 AAGGAGAGAGAGAGGAAGGAAGG - Intergenic
1060707317 9:125815987-125816009 AGAGAGAGAGAGACGGAGGGAGG - Intronic
1060755723 9:126211887-126211909 TCTGAGAGAGAGAGAGAGGATGG + Intergenic
1060834714 9:126746371-126746393 AGTGAGACAGAGACGGACGAAGG - Intergenic
1061401346 9:130370073-130370095 CAAGAGGGAGAGAGGGAGGGAGG - Intronic
1061495371 9:130970967-130970989 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1061958447 9:133975826-133975848 CAGGAGAGAGGGACCCAGGAAGG + Intronic
1061964830 9:134007310-134007332 GAGGAGAGACAGACGGAAGAGGG + Intergenic
1062144046 9:134979062-134979084 GAGGAAAGAGAGAAGGAGGAAGG + Intergenic
1062144060 9:134979105-134979127 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1062169063 9:135124458-135124480 CAAGCGAGAGAGAGAGAGGAAGG + Intergenic
1062169064 9:135124462-135124484 CGAGAGAGAGAGAGGAAGGAAGG + Intergenic
1062275196 9:135727168-135727190 AAAGAGAGAGAGAGGGAGAAAGG - Intronic
1203654449 Un_KI270752v1:9595-9617 AAAGAGAGAGAGAGGGAGGAAGG - Intergenic
1185453446 X:295298-295320 CCTGAGGGAGGGAGGGAGGAAGG + Intronic
1185495498 X:551264-551286 AAGGAGAGAGAGAGAGAGGAAGG - Intergenic
1185545940 X:944309-944331 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1185569083 X:1119052-1119074 GAGGAGAGAGAGAGAGAGGAGGG - Intergenic
1185622507 X:1461264-1461286 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1185637176 X:1561315-1561337 AGAGAGAGAGAGACGGAGGGAGG - Intergenic
1185747569 X:2584491-2584513 CATGGGGGAGAGCTGGAGGAAGG + Intergenic
1185766903 X:2732922-2732944 AAGGAGAGAGGGAAGGAGGAAGG - Intronic
1185766910 X:2732946-2732968 AATGAGGGAGGGAGGGAGGAAGG - Intronic
1185829730 X:3289221-3289243 GATGAGAGAGGGAGGGAGGGAGG - Intergenic
1185836158 X:3347021-3347043 CAGGAGAGAGAGAAGGAGCAGGG + Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186017822 X:5218030-5218052 AATGAGAGAGAGAAAAAGGAAGG + Intergenic
1186053462 X:5624583-5624605 CAGGAGAGAGAGAGAGAGAAGGG - Intergenic
1186149746 X:6661661-6661683 CATCAGAAAGAGATGGAAGAAGG - Intergenic
1186173930 X:6905497-6905519 CAGGAGAGAGAGAGAGAAGAGGG + Intergenic
1186185961 X:7020019-7020041 AATGAGAGAGAGAGAGAGAAAGG + Intergenic
1186369031 X:8927698-8927720 GAGGAGAGAGAGAGGGAGAAAGG - Intergenic
1186834340 X:13422499-13422521 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1186834363 X:13422631-13422653 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1186958354 X:14708001-14708023 CATGAAAGAAAGAAGGAGGGAGG - Intronic
1187083342 X:16015032-16015054 AACAAGAGAGAGACTGAGGAGGG + Intergenic
1187561814 X:20410594-20410616 AATGAGGGAGGGAGGGAGGAAGG - Intergenic
1187591353 X:20720728-20720750 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1187772394 X:22714662-22714684 AAAGAGAGAGAGAGGAAGGAAGG + Intergenic
1187793157 X:22972820-22972842 CATGAGACTGAGAGGGAGAACGG - Intergenic
1187866970 X:23731745-23731767 CAGGAAAGAGAGACAGAGGAGGG + Intronic
1188177065 X:27003866-27003888 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188606865 X:32041996-32042018 AGAGAGAGAGAGAGGGAGGAAGG - Intronic
1189073894 X:37895465-37895487 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1189143771 X:38635117-38635139 AAAGAGAGAGAGAGAGAGGAAGG - Intronic
1189197148 X:39162259-39162281 GATGAAAGAGAGAAGAAGGAAGG - Intergenic
1189257532 X:39652143-39652165 CATGAAAGAGGGAATGAGGAAGG - Intergenic
1189561201 X:42193031-42193053 CATATAAGAGAGAGGGAGGACGG + Intergenic
1189633627 X:42981166-42981188 CATGGGAGAGAGATGTAGGCTGG - Intergenic
1189675518 X:43456933-43456955 AAGGAGAGAGAGAGGAAGGAAGG + Intergenic
1189712796 X:43831549-43831571 GATGACTGAGAGAGGGAGGAAGG + Intronic
1189775147 X:44463945-44463967 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1189775839 X:44469710-44469732 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190065879 X:47241499-47241521 CATCAGAGAGAGAGGGAGTTAGG - Intronic
1190357157 X:49616662-49616684 AGAGAGAGAGAGAAGGAGGAAGG - Intergenic
1190432064 X:50387731-50387753 AAAGAGAGAGAGGAGGAGGATGG - Intronic
1190713745 X:53087569-53087591 AATGAGAGGGAGATGGAGGGAGG - Intronic
1190762454 X:53447895-53447917 AATGTGAGAGAGACTGAGGAAGG - Intergenic
1190764346 X:53463734-53463756 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1191742506 X:64450915-64450937 CATGAGAGAGTGATGTAGGTTGG + Intergenic
1191770167 X:64747042-64747064 CAAGAGAGAGTGAAGGGGGAGGG + Intergenic
1191826570 X:65372465-65372487 CAGGAGAGAGGAAGGGAGGAAGG + Intronic
1191826597 X:65372607-65372629 CAGGAGAGAGGGAGAGAGGAAGG + Intronic
1191941636 X:66487296-66487318 CACGAGAGAAAGATGTAGGATGG + Intergenic
1192079925 X:68037884-68037906 CAAGAGAGAGAGAGGAGGGAGGG + Intergenic
1192138485 X:68629081-68629103 CATGGGAGAGAGATGAAGGCTGG - Intergenic
1192592367 X:72370791-72370813 CATGAGAGAAAGATGTAGGCTGG + Intronic
1192659093 X:73022788-73022810 AAAGAGAGAGAGAGAGAGGAAGG + Intergenic
1192766807 X:74148014-74148036 CCTGAAAGAGATACGGAGAATGG + Intergenic
1192855413 X:75005015-75005037 CAAGAGAGAGAGAGAGAGGGAGG + Intergenic
1193224428 X:78965502-78965524 AAAGAGAGAGGGAGGGAGGAAGG - Intergenic
1193301924 X:79899452-79899474 AAAGAGAGAGAGACTGAGGCAGG + Intergenic
1193498842 X:82247407-82247429 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1193713570 X:84908237-84908259 CATATGAGGGAGAGGGAGGAGGG + Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194277110 X:91899289-91899311 CATGGGAGAGAGATGTAGGCTGG + Intronic
1194372890 X:93096211-93096233 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1194490930 X:94548469-94548491 AAAGAGAGAGAGACAGAGAAGGG + Intergenic
1194573583 X:95583203-95583225 GATGAGTGAGAGACTGAGGCAGG - Intergenic
1194584188 X:95713308-95713330 CATGGGAGAAAGACGTAGGCTGG - Intergenic
1194590235 X:95791527-95791549 AAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1194767263 X:97856209-97856231 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1195022809 X:100846634-100846656 CAGGAGAGAGAGAGAGAGGGAGG - Intronic
1195288106 X:103404986-103405008 CATGAGAGAGAGAAAGAGCTGGG + Intergenic
1195478481 X:105315740-105315762 CATGAGAGAAAGATGTAGGCTGG + Intronic
1195565314 X:106333236-106333258 CAAGAGAGAGAGAAGAATGAAGG - Intergenic
1195749288 X:108148214-108148236 CATGGGAGAAAGACGTAGGCTGG + Intronic
1195870242 X:109478169-109478191 CATGAGAGTGAGATACAGGATGG + Intronic
1196288427 X:113910715-113910737 GAAGAGAGAGAGATGAAGGAAGG - Intergenic
1196318319 X:114256107-114256129 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1196365098 X:114915006-114915028 CATGAGAGAGAGACAGACAGAGG + Intergenic
1196720047 X:118845476-118845498 AAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1196740418 X:119020391-119020413 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1197062555 X:122198665-122198687 CATGAGAGAAAGATGTAGGCTGG + Intergenic
1197105042 X:122703485-122703507 CATGGGAGAAAGATGGAGGCTGG - Intergenic
1197244727 X:124156398-124156420 CATGGGAGAAAGACGTAGGTTGG + Intronic
1197253307 X:124236955-124236977 AAAGAGAGAGAGAGGGAGGGAGG - Intronic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1197982227 X:132228854-132228876 AGTGAGAGAGAGAGAGAGGAAGG - Intergenic
1198116491 X:133549740-133549762 AAAGAGAGAGAGAGGGAGGATGG - Intronic
1198455442 X:136812904-136812926 AATGAGGGAGGGAGGGAGGAAGG + Intergenic
1198457925 X:136835662-136835684 CTTGAGGGAGGGAGGGAGGAAGG + Intergenic
1198466898 X:136911390-136911412 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1198481912 X:137049326-137049348 AGAGAGAGAGAGATGGAGGAAGG - Intergenic
1198493153 X:137163952-137163974 AAAGAGAGAGAGAGAGAGGAAGG - Intergenic
1198655957 X:138913603-138913625 AAAGAGAGAGAGAGGGAGGGAGG + Intronic
1198716871 X:139566953-139566975 GAAGAGAGAGAGAGAGAGGAGGG + Intergenic
1198745417 X:139885152-139885174 TGTGTGAGAGAGACAGAGGAAGG - Intronic
1198995501 X:142569225-142569247 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1199005540 X:142692283-142692305 ACTGAAAGAGGGACGGAGGAAGG + Intergenic
1199026229 X:142942090-142942112 GAAGAGAGAGAGAGGAAGGAAGG - Intergenic
1199046688 X:143182619-143182641 CATGAGAGAAAGATGGAGGCCGG - Intergenic
1199132138 X:144202211-144202233 AAAAAGAGAGAGAGGGAGGACGG - Intergenic
1199396167 X:147341192-147341214 AAGGAGAGAGGGAAGGAGGAAGG - Intergenic
1199849899 X:151718099-151718121 AAAGAGAGAGAGAGGAAGGAAGG + Intronic
1199950984 X:152706145-152706167 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199953281 X:152722759-152722781 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199956401 X:152745691-152745713 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199958698 X:152762316-152762338 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1200338024 X:155372697-155372719 GAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1200348445 X:155467997-155468019 GAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1200594455 Y:5121390-5121412 CATGGGAGAGAGATGTAGGCTGG + Intronic
1200680928 Y:6210251-6210273 CAAGAGATAGAGAGAGAGGAGGG + Intergenic
1200878072 Y:8180528-8180550 AGAGAGAGAGAGAGGGAGGATGG + Intergenic
1200941034 Y:8782064-8782086 AAAGAGAGAGGGAGGGAGGAGGG + Intergenic
1200978216 Y:9236359-9236381 AAAGAGAGAGAGAGGGAGGGAGG - Intergenic
1201300169 Y:12498414-12498436 CAAGAGAGAAAGAGGAAGGAGGG - Intergenic
1201334887 Y:12869957-12869979 CAGGAGGGAGAGAAGGAGGAAGG - Intergenic
1201550330 Y:15211557-15211579 CAAGAGAGAGAGAGGGAGGGAGG + Intergenic
1201550439 Y:15212012-15212034 GGTGAGAGAGAGAGGGAGGGAGG + Intergenic
1201550491 Y:15212281-15212303 TGTGAGAGAGAGAGGGAGGGAGG + Intergenic
1201674311 Y:16562088-16562110 CATGAGAGAAAGATGTAGGCTGG - Intergenic
1201741219 Y:17326096-17326118 AAGGAGAGAGGGAGGGAGGAGGG + Intergenic
1201798652 Y:17928658-17928680 GAAAAGAGAGAGAGGGAGGAAGG + Intergenic
1201802901 Y:17977299-17977321 GAAAAGAGAGAGAGGGAGGAAGG - Intergenic
1202070196 Y:20984280-20984302 CATGAAAGAGACAGGGAGAATGG - Intergenic