ID: 1057195638

View in Genome Browser
Species Human (GRCh38)
Location 9:93114561-93114583
Sequence GGGTGCACACAGATGGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057195638_1057195650 9 Left 1057195638 9:93114561-93114583 CCCCTGTCCATCTGTGTGCACCC No data
Right 1057195650 9:93114593-93114615 CCCCGAGGCCCATGTCAGCCAGG No data
1057195638_1057195642 -6 Left 1057195638 9:93114561-93114583 CCCCTGTCCATCTGTGTGCACCC No data
Right 1057195642 9:93114578-93114600 GCACCCACCGCCCTCCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057195638 Original CRISPR GGGTGCACACAGATGGACAG GGG (reversed) Intergenic
No off target data available for this crispr