ID: 1057197000

View in Genome Browser
Species Human (GRCh38)
Location 9:93120903-93120925
Sequence GGGGAGAACAGAATGGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057196984_1057197000 19 Left 1057196984 9:93120861-93120883 CCACATCCAGGGAGATGAGGGGC No data
Right 1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG No data
1057196988_1057197000 13 Left 1057196988 9:93120867-93120889 CCAGGGAGATGAGGGGCTGGGGC No data
Right 1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG No data
1057196980_1057197000 28 Left 1057196980 9:93120852-93120874 CCAGATGCTCCACATCCAGGGAG No data
Right 1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057197000 Original CRISPR GGGGAGAACAGAATGGGTAG TGG Intergenic
No off target data available for this crispr