ID: 1057197022

View in Genome Browser
Species Human (GRCh38)
Location 9:93120984-93121006
Sequence CCCGGGAGCCAGGTTTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057197019_1057197022 -9 Left 1057197019 9:93120970-93120992 CCAGACACTGGCGGCCCGGGAGC No data
Right 1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG No data
1057197014_1057197022 13 Left 1057197014 9:93120948-93120970 CCAAGGAGAAGAGAGTGAAACGC No data
Right 1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057197022 Original CRISPR CCCGGGAGCCAGGTTTCCAC TGG Intergenic
No off target data available for this crispr