ID: 1057197850

View in Genome Browser
Species Human (GRCh38)
Location 9:93124928-93124950
Sequence CGGGGTCCAGAAGCCCTTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057197850_1057197856 22 Left 1057197850 9:93124928-93124950 CCATCAAGGGCTTCTGGACCCCG 0: 1
1: 0
2: 2
3: 7
4: 95
Right 1057197856 9:93124973-93124995 CTACCACGATGATGAACACCAGG 0: 1
1: 0
2: 0
3: 1
4: 68
1057197850_1057197858 29 Left 1057197850 9:93124928-93124950 CCATCAAGGGCTTCTGGACCCCG 0: 1
1: 0
2: 2
3: 7
4: 95
Right 1057197858 9:93124980-93125002 GATGATGAACACCAGGCCCGTGG 0: 1
1: 0
2: 0
3: 30
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057197850 Original CRISPR CGGGGTCCAGAAGCCCTTGA TGG (reversed) Exonic
900541136 1:3203501-3203523 CGGAGGCCAGAAGCCCCTGATGG + Intronic
904366529 1:30014378-30014400 ATGGCTCCAGGAGCCCTTGAGGG + Intergenic
905166352 1:36085350-36085372 CTAGGTTGAGAAGCCCTTGATGG + Intronic
905235338 1:36542528-36542550 CGGTGTCCACAACCCCCTGAGGG - Intergenic
906209305 1:44003218-44003240 TGGCCTCCAGGAGCCCTTGAAGG - Intronic
907796964 1:57727561-57727583 CAGGATCCAGAAGCCATTTATGG - Intronic
908315419 1:62927721-62927743 CCAGGTCAGGAAGCCCTTGAAGG - Intergenic
913193167 1:116430785-116430807 TGGGATCCAGAAGATCTTGAAGG + Intergenic
915171513 1:153981407-153981429 TGGGGTCCGGATGCCCTTGTGGG - Intergenic
918048909 1:180957468-180957490 CGGGCTCCAGAAGCCAGTGTGGG - Intergenic
920279070 1:204829471-204829493 GGGGGTCCAGAGGCCACTGAGGG - Intronic
922580403 1:226693096-226693118 GGTGGTCCAGAAGCCCTTGAAGG + Intronic
1063616405 10:7604067-7604089 CCTGGTCCAGAAGCCCTTGATGG + Intronic
1067698909 10:48554735-48554757 CTGTGTCCAGAAGCCCCTGTGGG + Intronic
1069668086 10:70177878-70177900 CAGGGTCCAAAAGCCTCTGAGGG - Intergenic
1069989993 10:72309322-72309344 CCAGGTCCAGATGCCCTTGCAGG + Intergenic
1072459586 10:95606883-95606905 CGGGGACCAGTAGGACTTGAGGG - Exonic
1077035235 11:491268-491290 CGGGTTCCAGGCCCCCTTGAGGG - Exonic
1077199500 11:1298420-1298442 TGGGGTCCAGAGGCCTCTGAGGG + Intronic
1078101970 11:8335227-8335249 CGGGGTCCCCAGGCCCTTTATGG + Intergenic
1081493078 11:43581936-43581958 GGGGGTGGGGAAGCCCTTGAGGG + Intronic
1081582135 11:44359696-44359718 CTGGGGCCAGAAACTCTTGACGG + Intergenic
1084208533 11:67610296-67610318 AGGAGTCATGAAGCCCTTGAAGG - Intronic
1085554962 11:77411671-77411693 CGGGGTCCAGTAGATTTTGAGGG - Intronic
1089443543 11:118534306-118534328 CCGGGTCCAGAAGCTCTGGCCGG - Exonic
1089818391 11:121197964-121197986 GGTGGGCCAGATGCCCTTGAAGG + Intergenic
1091655713 12:2345345-2345367 AGAGGTCCAGGAGCCCTGGAAGG + Intronic
1104757927 12:131280464-131280486 CGGGGAGCAGAAGCCAATGAGGG + Intergenic
1105870039 13:24496510-24496532 CGGGTTCCAGATGCCCTCAAGGG - Intronic
1106420046 13:29578566-29578588 CGTGGTTCAAAAGCCCTGGAAGG + Intronic
1106814073 13:33387817-33387839 TGGGGTCCAGATGTCCTTCATGG + Intergenic
1108997667 13:56755305-56755327 CAGGGTTGAGAAGCCCTTCATGG - Intergenic
1112337933 13:98529705-98529727 GGGGGTCCAGAGGCCCCTGTAGG + Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1117077328 14:52117601-52117623 CTGGGTGCAGAAGGCCTCGAGGG - Intergenic
1117957253 14:61132114-61132136 CAGGCTACAGAAGCCCATGAAGG - Intergenic
1117995712 14:61476322-61476344 GGGGGACCGGAAACCCTTGAAGG - Intronic
1122555923 14:102579966-102579988 CGGGGCCCAGCAGCCCAAGAAGG - Intergenic
1125174856 15:36808998-36809020 AGAGCTCCAGAAGACCTTGATGG + Exonic
1125715723 15:41818932-41818954 TTGGGTCCAGAAGCCCTTTGGGG - Exonic
1126099917 15:45112828-45112850 CGGGGCCAAGAGACCCTTGAGGG - Intronic
1129465663 15:75722879-75722901 GGGTGTCCAGAAGCCCCTGAGGG - Intergenic
1130251656 15:82303970-82303992 AGAGGACCAGAAGCCCCTGAGGG - Intergenic
1132537544 16:490281-490303 AGTGGCCCAGAAGCCCTTGGAGG + Intronic
1132694163 16:1194683-1194705 CGGGGTGCAGGAGCCCTCGGTGG - Intronic
1132909919 16:2304201-2304223 CAGGGACCCGAAGCCCCTGATGG + Intronic
1141875475 16:86821125-86821147 CAGGTTACAGAAGCCCTGGATGG - Intergenic
1142685830 17:1576504-1576526 CGGGGCCCTGAAGCCCCCGAGGG + Intronic
1145803997 17:27713461-27713483 CAGGGTCCAGAAACCATTGTGGG + Intergenic
1148895478 17:50836800-50836822 TGGGGTCCAGAAGCCAGAGATGG + Intronic
1150007805 17:61480330-61480352 CCTGGTCTAGAAGCCCTAGAGGG + Intronic
1150485446 17:65540109-65540131 CTGGCTCCTGAAGCCCTGGAGGG - Intronic
1151434916 17:74089207-74089229 CTTGGCCCAGAAGCCCTGGAGGG - Intergenic
1152782235 17:82231513-82231535 CGGGGTCCAGGAGGCCTCGGAGG + Intronic
1153816216 18:8792656-8792678 CGGCGTCCAGAAGCCACTGTGGG + Intronic
1158565767 18:58553085-58553107 TGGTGGCCAGAAGCCCTTGGGGG - Intronic
1167301391 19:48680025-48680047 GGTGGCCCAGAATCCCTTGACGG - Intergenic
1167792870 19:51691831-51691853 CGGGGTCCAGAAGCTGGAGAAGG + Intergenic
1168064426 19:53910884-53910906 CGGGGTCCAGAACCTCTGGTAGG + Intronic
925793602 2:7519090-7519112 CGGGGACCAGATGTCCTTGGTGG + Intergenic
926299541 2:11592777-11592799 CGCGGACCAGGTGCCCTTGATGG + Exonic
928649786 2:33391985-33392007 CAGGCTCCAAAAGCCCTTGCTGG - Intronic
929027999 2:37623823-37623845 GGGAGACCAGAAGCACTTGATGG + Intergenic
937749237 2:125454755-125454777 AGGGGTTCAGCAGCCCTTTAAGG - Intergenic
940600333 2:155850620-155850642 TGGGGGCCAGAATCCTTTGAAGG + Intergenic
946452170 2:219789870-219789892 CTGGCTCCAGAATCTCTTGAAGG + Intergenic
1180108178 21:45633538-45633560 CGGGGACCGGAAGCGCTTCACGG - Intergenic
1180108337 21:45634360-45634382 CGGGGACCGGAAGCGCTTCACGG - Intergenic
1183401907 22:37609586-37609608 AGGGGTGTAGAAGCCTTTGAAGG - Intronic
1184257667 22:43296351-43296373 CGGGGTCCAGAATCCCTGGGCGG + Intronic
1184422961 22:44392427-44392449 CAAGGTCCTGAAGTCCTTGAGGG - Intergenic
1185098357 22:48823924-48823946 CGGCTTCCAGCAGCCTTTGAGGG + Intronic
951822349 3:26827039-26827061 AGGGTTCCAGAGGCCCTTGGTGG - Intergenic
954773935 3:52999256-52999278 AGGGTTCCAGGAGCCCTTGGTGG - Intronic
968230472 3:197002546-197002568 CGGGCTCCCGAGGCCCCTGAAGG - Exonic
969556436 4:7914534-7914556 CGGTGTCCAGCAGCACATGATGG - Intronic
971203445 4:24535745-24535767 TGGGGTCCAGAAGTGCTAGAGGG - Intronic
980013520 4:127622985-127623007 CGGGGTCCGGAGGCGCTCGACGG + Intergenic
985579094 5:687378-687400 GGGGCTCCAGAGGCCCTTGGGGG + Intronic
985593936 5:779441-779463 GGGGCTCCAGAGGCCCTTGGGGG + Intergenic
985634896 5:1031092-1031114 GGGGGTCCAGGTGCCCTCGAGGG + Intronic
993161533 5:84297990-84298012 CGGGGTCTAAAACCCCTTGAGGG - Intronic
997229451 5:132232020-132232042 ATGGGTCCAGAAGCCTTTGAGGG - Intronic
1001085047 5:168694381-168694403 CATGGACCAGAAGCCCTTGTGGG + Intronic
1001644747 5:173271654-173271676 CTGCTTCCAGAAGCACTTGAGGG - Intergenic
1017407711 6:154138024-154138046 CTGGGCTCAGAAGTCCTTGAAGG - Intronic
1019564790 7:1673938-1673960 GGGGGTCCAGCAGGGCTTGAGGG + Intergenic
1019727521 7:2611295-2611317 AGGGGTCTAGATGCCCCTGAAGG - Exonic
1021584044 7:22188798-22188820 TAGAGTCCAGAAGCTCTTGATGG - Intronic
1022527950 7:31050399-31050421 CGGGTTCCAGATCCCCTGGAAGG - Intergenic
1034994370 7:155569016-155569038 CGGAGGCCAGGAGCCCCTGAGGG - Intergenic
1035040297 7:155921950-155921972 CGGTGGCCAGAAGCCGTGGAAGG + Intergenic
1039447132 8:37641979-37642001 TGGGGTCCAGGAGCACTTGAGGG - Intergenic
1043485362 8:80693773-80693795 CGGGGTCCAGTGGCCATGGAAGG + Intronic
1049545417 8:143228532-143228554 CGGGCTCCAGATGCCTTCGAGGG - Intergenic
1056990726 9:91407611-91407633 CAGGATCCAAAAGCCTTTGACGG - Intergenic
1057197850 9:93124928-93124950 CGGGGTCCAGAAGCCCTTGATGG - Exonic
1059310842 9:113388151-113388173 CGGGGCCCAGCAGCCCTGGGTGG - Exonic
1061364846 9:130167168-130167190 TGGTGTCCAGGAGCCCCTGAGGG - Intergenic
1062326703 9:136015844-136015866 CCGAGTCCAGAAGCCCGTGGGGG - Intronic
1187500721 X:19836334-19836356 TGAGGTCCAGTATCCCTTGAAGG + Intronic
1195907446 X:109858937-109858959 AGGGCTCCAAAAGCCCTTGAGGG - Intergenic
1198344082 X:135742005-135742027 CGGGGTCCAGAAATACTCGAAGG + Intergenic
1198360645 X:135892417-135892439 CGGGGTCCAGAAATGTTTGAAGG - Intronic
1201530419 Y:14985126-14985148 CAGGGTCCAGGGGCCATTGAGGG + Intergenic