ID: 1057206051

View in Genome Browser
Species Human (GRCh38)
Location 9:93173284-93173306
Sequence AGTTTCGGCCCCCACCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206051_1057206054 -10 Left 1057206051 9:93173284-93173306 CCCATTGGGTGGGGGCCGAAACT No data
Right 1057206054 9:93173297-93173319 GGCCGAAACTTGTGGCTTCCCGG No data
1057206051_1057206059 28 Left 1057206051 9:93173284-93173306 CCCATTGGGTGGGGGCCGAAACT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206051 Original CRISPR AGTTTCGGCCCCCACCCAAT GGG (reversed) Intergenic