ID: 1057206052

View in Genome Browser
Species Human (GRCh38)
Location 9:93173285-93173307
Sequence AAGTTTCGGCCCCCACCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206052_1057206059 27 Left 1057206052 9:93173285-93173307 CCATTGGGTGGGGGCCGAAACTT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206052 Original CRISPR AAGTTTCGGCCCCCACCCAA TGG (reversed) Intergenic