ID: 1057206057

View in Genome Browser
Species Human (GRCh38)
Location 9:93173316-93173338
Sequence ACAGAGCAGAAAGAAGGAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206057_1057206059 -4 Left 1057206057 9:93173316-93173338 CCGGTTCCTTCTTTCTGCTCTGT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data
1057206057_1057206061 4 Left 1057206057 9:93173316-93173338 CCGGTTCCTTCTTTCTGCTCTGT No data
Right 1057206061 9:93173343-93173365 ACAGACCCCCGCTGGCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206057 Original CRISPR ACAGAGCAGAAAGAAGGAAC CGG (reversed) Intergenic