ID: 1057206059

View in Genome Browser
Species Human (GRCh38)
Location 9:93173335-93173357
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206051_1057206059 28 Left 1057206051 9:93173284-93173306 CCCATTGGGTGGGGGCCGAAACT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data
1057206057_1057206059 -4 Left 1057206057 9:93173316-93173338 CCGGTTCCTTCTTTCTGCTCTGT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data
1057206052_1057206059 27 Left 1057206052 9:93173285-93173307 CCATTGGGTGGGGGCCGAAACTT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data
1057206058_1057206059 -10 Left 1057206058 9:93173322-93173344 CCTTCTTTCTGCTCTGTCCACAC No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data
1057206055_1057206059 13 Left 1057206055 9:93173299-93173321 CCGAAACTTGTGGCTTCCCGGTT No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data
1057206056_1057206059 -3 Left 1057206056 9:93173315-93173337 CCCGGTTCCTTCTTTCTGCTCTG No data
Right 1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206059 Original CRISPR CTGTCCACACAGACCCCCGC TGG Intergenic