ID: 1057206678

View in Genome Browser
Species Human (GRCh38)
Location 9:93177766-93177788
Sequence ATGGGGGTCTGGAGTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206678_1057206690 17 Left 1057206678 9:93177766-93177788 CCCTCTGCACTCCAGACCCCCAT No data
Right 1057206690 9:93177806-93177828 AGATGTCCCTAGCAGCAGCAGGG No data
1057206678_1057206683 -8 Left 1057206678 9:93177766-93177788 CCCTCTGCACTCCAGACCCCCAT No data
Right 1057206683 9:93177781-93177803 ACCCCCATCTCTGGCTCTGGCGG No data
1057206678_1057206689 16 Left 1057206678 9:93177766-93177788 CCCTCTGCACTCCAGACCCCCAT No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206678_1057206693 24 Left 1057206678 9:93177766-93177788 CCCTCTGCACTCCAGACCCCCAT No data
Right 1057206693 9:93177813-93177835 CCTAGCAGCAGCAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206678 Original CRISPR ATGGGGGTCTGGAGTGCAGA GGG (reversed) Intergenic
No off target data available for this crispr