ID: 1057206683

View in Genome Browser
Species Human (GRCh38)
Location 9:93177781-93177803
Sequence ACCCCCATCTCTGGCTCTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206679_1057206683 -9 Left 1057206679 9:93177767-93177789 CCTCTGCACTCCAGACCCCCATC No data
Right 1057206683 9:93177781-93177803 ACCCCCATCTCTGGCTCTGGCGG No data
1057206678_1057206683 -8 Left 1057206678 9:93177766-93177788 CCCTCTGCACTCCAGACCCCCAT No data
Right 1057206683 9:93177781-93177803 ACCCCCATCTCTGGCTCTGGCGG No data
1057206676_1057206683 -2 Left 1057206676 9:93177760-93177782 CCTCCTCCCTCTGCACTCCAGAC No data
Right 1057206683 9:93177781-93177803 ACCCCCATCTCTGGCTCTGGCGG No data
1057206677_1057206683 -5 Left 1057206677 9:93177763-93177785 CCTCCCTCTGCACTCCAGACCCC No data
Right 1057206683 9:93177781-93177803 ACCCCCATCTCTGGCTCTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206683 Original CRISPR ACCCCCATCTCTGGCTCTGG CGG Intergenic
No off target data available for this crispr