ID: 1057206689

View in Genome Browser
Species Human (GRCh38)
Location 9:93177805-93177827
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057206685_1057206689 -1 Left 1057206685 9:93177783-93177805 CCCCATCTCTGGCTCTGGCGGCC No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206677_1057206689 19 Left 1057206677 9:93177763-93177785 CCTCCCTCTGCACTCCAGACCCC No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206681_1057206689 5 Left 1057206681 9:93177777-93177799 CCAGACCCCCATCTCTGGCTCTG No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206679_1057206689 15 Left 1057206679 9:93177767-93177789 CCTCTGCACTCCAGACCCCCATC No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206676_1057206689 22 Left 1057206676 9:93177760-93177782 CCTCCTCCCTCTGCACTCCAGAC No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206687_1057206689 -3 Left 1057206687 9:93177785-93177807 CCATCTCTGGCTCTGGCGGCCAG No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206686_1057206689 -2 Left 1057206686 9:93177784-93177806 CCCATCTCTGGCTCTGGCGGCCA No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206684_1057206689 0 Left 1057206684 9:93177782-93177804 CCCCCATCTCTGGCTCTGGCGGC No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data
1057206678_1057206689 16 Left 1057206678 9:93177766-93177788 CCCTCTGCACTCCAGACCCCCAT No data
Right 1057206689 9:93177805-93177827 CAGATGTCCCTAGCAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057206689 Original CRISPR CAGATGTCCCTAGCAGCAGC AGG Intergenic
No off target data available for this crispr