ID: 1057207474

View in Genome Browser
Species Human (GRCh38)
Location 9:93182364-93182386
Sequence GTCCCATCCTGGTTTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057207472_1057207474 17 Left 1057207472 9:93182324-93182346 CCAGATAGGTGTGTGCTGGTCTC No data
Right 1057207474 9:93182364-93182386 GTCCCATCCTGGTTTTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057207474 Original CRISPR GTCCCATCCTGGTTTTCCCT TGG Intergenic
No off target data available for this crispr