ID: 1057207884

View in Genome Browser
Species Human (GRCh38)
Location 9:93184382-93184404
Sequence GGGGAGGCTCGGCACTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057207884_1057207893 13 Left 1057207884 9:93184382-93184404 CCCTGTGAGTGCCGAGCCTCCCC No data
Right 1057207893 9:93184418-93184440 CCGCCTTTGTGTGCGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057207884 Original CRISPR GGGGAGGCTCGGCACTCACA GGG (reversed) Intergenic
No off target data available for this crispr