ID: 1057208017

View in Genome Browser
Species Human (GRCh38)
Location 9:93184785-93184807
Sequence CCCCCAGAGACGGCCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 134}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057208010_1057208017 -9 Left 1057208010 9:93184771-93184793 CCCCTTTCCCAGGGCCCCCAGAG 0: 1
1: 0
2: 5
3: 54
4: 487
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057207995_1057208017 30 Left 1057207995 9:93184732-93184754 CCTCCTCCCCAACCCAAGCCTCT 0: 1
1: 0
2: 8
3: 129
4: 1138
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208002_1057208017 17 Left 1057208002 9:93184745-93184767 CCAAGCCTCTGGTCCCGTCTGCA 0: 1
1: 0
2: 0
3: 13
4: 204
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208009_1057208017 -8 Left 1057208009 9:93184770-93184792 CCCCCTTTCCCAGGGCCCCCAGA 0: 1
1: 0
2: 1
3: 52
4: 524
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208000_1057208017 22 Left 1057208000 9:93184740-93184762 CCAACCCAAGCCTCTGGTCCCGT 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208005_1057208017 3 Left 1057208005 9:93184759-93184781 CCGTCTGCAGCCCCCCTTTCCCA 0: 1
1: 0
2: 3
3: 60
4: 599
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208011_1057208017 -10 Left 1057208011 9:93184772-93184794 CCCTTTCCCAGGGCCCCCAGAGA 0: 1
1: 0
2: 5
3: 47
4: 405
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208003_1057208017 12 Left 1057208003 9:93184750-93184772 CCTCTGGTCCCGTCTGCAGCCCC 0: 1
1: 0
2: 1
3: 28
4: 332
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057207997_1057208017 27 Left 1057207997 9:93184735-93184757 CCTCCCCAACCCAAGCCTCTGGT 0: 1
1: 2
2: 11
3: 68
4: 550
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208001_1057208017 18 Left 1057208001 9:93184744-93184766 CCCAAGCCTCTGGTCCCGTCTGC 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057207999_1057208017 23 Left 1057207999 9:93184739-93184761 CCCAACCCAAGCCTCTGGTCCCG 0: 1
1: 0
2: 0
3: 15
4: 161
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057207998_1057208017 24 Left 1057207998 9:93184738-93184760 CCCCAACCCAAGCCTCTGGTCCC 0: 1
1: 0
2: 2
3: 47
4: 416
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208004_1057208017 4 Left 1057208004 9:93184758-93184780 CCCGTCTGCAGCCCCCCTTTCCC 0: 1
1: 0
2: 4
3: 57
4: 555
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134
1057208008_1057208017 -7 Left 1057208008 9:93184769-93184791 CCCCCCTTTCCCAGGGCCCCCAG 0: 1
1: 0
2: 6
3: 86
4: 794
Right 1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG 0: 1
1: 0
2: 1
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057208017 Original CRISPR CCCCCAGAGACGGCCCCCGC AGG Intergenic
900131873 1:1090687-1090709 CCCCAGGAGGCGGCACCCGCAGG + Intronic
900283864 1:1890363-1890385 CCCCGATAGGCGGCCCGCGCGGG + Intronic
900410596 1:2510866-2510888 CCCCCAGTCTCGGCCCCTGCAGG - Intronic
900473047 1:2863875-2863897 CCCCCAGAGCCGGCCCTGCCCGG - Intergenic
900730855 1:4258651-4258673 CCCCCACAGACAGCCGCCACCGG + Intergenic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
902292352 1:15443535-15443557 ACTCCAGAGGCGGCCCCAGCCGG - Exonic
905033954 1:34905133-34905155 CCCCCAACCCCGGCCCCCGCTGG + Exonic
906960935 1:50419173-50419195 CCCCCAGATAAGGCCGCCGTGGG - Exonic
918038616 1:180898569-180898591 CGCCCAGAGAAGGCTCCCTCAGG - Intergenic
921067563 1:211633368-211633390 CCCCCAGAGACAGCTTCCCCTGG - Intergenic
921171973 1:212558538-212558560 CCCCCATAGTCGGTCCCCGAGGG + Intergenic
921390493 1:214608957-214608979 CCCCCAGCTACGGCCCCAGACGG + Intronic
1063452964 10:6163697-6163719 CCCCCAGGCCCCGCCCCCGCCGG - Intronic
1064230765 10:13528396-13528418 CCCCCAGCGTGGACCCCCGCGGG + Intronic
1067654087 10:48177893-48177915 CCCCCAGTGCAGGCCCCCACTGG + Intronic
1069874064 10:71550919-71550941 CCACCAGAGCCAGCCCCCACCGG + Intronic
1073032217 10:100535931-100535953 CCGCCAGGGACGGCCCCCACCGG - Exonic
1073083662 10:100874987-100875009 CCCCCAGAGACCACCCCCCCAGG - Intergenic
1073446582 10:103584585-103584607 GCCGCAGCGACGGCCGCCGCAGG - Exonic
1076362056 10:129896504-129896526 CCCCCACACCCGGCCCACGCCGG - Intronic
1077231107 11:1458559-1458581 CCCCCAGAGACTGCGGCCGAGGG + Intronic
1077234241 11:1472257-1472279 CCCACAGCGGCCGCCCCCGCAGG + Intronic
1080946294 11:36978877-36978899 CCCCCATAGACTGTCCCCACTGG - Intergenic
1084083890 11:66845939-66845961 CCCACAGAGGCGGCCCCTGCTGG + Exonic
1084143420 11:67249934-67249956 CCCTCAGAGTCGGCCCAGGCTGG - Intronic
1089646865 11:119886291-119886313 TCCCCAGAGACCTCCCCTGCTGG + Intergenic
1097040353 12:56152609-56152631 GCCCCAGACACGGACCCCGCAGG + Exonic
1100733408 12:97499030-97499052 ACCCCATAGACAGCCCCAGCGGG - Intergenic
1102341698 12:112126487-112126509 CCCCCAGAGGGGGACCCTGCAGG + Intronic
1105503096 13:20989111-20989133 TCCCCGGAGTCGGCCCCCACGGG - Exonic
1113885649 13:113657208-113657230 CCCCCAGAGCCGGGCACCGTGGG + Intronic
1115065671 14:29256927-29256949 CCCCCACAGACAGTCCCCACTGG - Intergenic
1116800510 14:49438887-49438909 CCCCAAGAGACTGGCCCCTCAGG + Intergenic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118992501 14:70809266-70809288 CCCCCAACGACGGCGGCCGCAGG + Exonic
1120190583 14:81436260-81436282 CCCCCCAAGAGGGGCCCCGCAGG - Intronic
1122919974 14:104876005-104876027 TCCCCAGAGATGCTCCCCGCTGG - Intronic
1125444201 15:39736309-39736331 CTCCTAGACACAGCCCCCGCTGG + Intronic
1125508845 15:40282237-40282259 CCCGCAGAGTCGGCCGCCTCGGG + Exonic
1128622289 15:69160835-69160857 CCCCCAGAGCCGCCCCCGTCAGG - Intronic
1129661591 15:77555911-77555933 ACCCCAGAGAGGGCCCACTCAGG + Intergenic
1129791500 15:78343649-78343671 CCCCCAGAGGGGGCCCCAGATGG + Intronic
1132873799 16:2126998-2127020 TCCACAGAGACGGCTCCAGCAGG + Intronic
1132976911 16:2715602-2715624 CCCCCAGGGAGGTCACCCGCAGG + Intronic
1133188364 16:4116063-4116085 CCCCCAGCGCCCGCCGCCGCGGG - Exonic
1134061657 16:11202911-11202933 GCCCCAGTGACGGCCACCACTGG - Intergenic
1137604207 16:49776401-49776423 CCCCCAGAGGCCGCCCAGGCAGG + Intronic
1138516310 16:57536888-57536910 CCAGCAGAAACGGCCACCGCGGG + Intergenic
1138651666 16:58464400-58464422 CACCCAGAGCCGGGCCGCGCCGG + Exonic
1141034637 16:80616628-80616650 CCCCCAGAGAGGTCCCTGGCAGG + Intronic
1141671225 16:85492728-85492750 CCCCCAGGGACGGCTCCCTCTGG - Intergenic
1142184349 16:88687331-88687353 AGCCCAGAGACGGCCCCACCTGG - Intergenic
1143544705 17:7589230-7589252 CCCCCAGAGCGGGCCGCCGCTGG + Exonic
1146955308 17:36933710-36933732 CCCCCGGATACGGCCCCAGAGGG - Intergenic
1147044791 17:37744417-37744439 CCACCAGAGAAGTCCCCCGGGGG - Intronic
1147150141 17:38509749-38509771 CGTCCAGAGACTACCCCCGCTGG - Intronic
1148119253 17:45197977-45197999 CCCGCAGAGAGGGCCCCAGCCGG - Intergenic
1151306140 17:73263660-73263682 CCCCCAAAGCTGGCCCCAGCAGG - Intergenic
1151555246 17:74843261-74843283 CCCCCAGAGCCGAGCCCCACGGG - Exonic
1152635798 17:81430048-81430070 GCCCCAGAGAGGCCCACCGCTGG - Intronic
1155053260 18:22165800-22165822 CCCCCAGCGCCGGCTCCCGCCGG - Intergenic
1157452496 18:47799268-47799290 CCCCCAGACACTACCCCAGCTGG - Intergenic
1160577910 18:79867509-79867531 CCCCCAGACACGACACACGCCGG - Intronic
1161063597 19:2227152-2227174 CCCCCCGCCCCGGCCCCCGCCGG + Intronic
1161175962 19:2842100-2842122 CCCCCAGAGACCGCGGCCGGAGG - Intronic
1161453026 19:4357270-4357292 CCACCAGGGACAGGCCCCGCAGG - Exonic
1161703017 19:5805223-5805245 CCCCCAGCCCCAGCCCCCGCCGG + Intergenic
1161809704 19:6464757-6464779 CCCCCAGGCTCGGCCCCAGCGGG - Exonic
1162398746 19:10432285-10432307 CCCCCAGGGACAGCCCCGGGCGG - Intronic
1162951134 19:14072721-14072743 CCTCCAGGAACGGCCCCCGGGGG - Intronic
1163334307 19:16661078-16661100 ACCCCAGGCCCGGCCCCCGCGGG - Intergenic
1166106386 19:40600144-40600166 CCCCCACAGCGTGCCCCCGCTGG + Exonic
1166798142 19:45440243-45440265 CCCCCAGCGATGTCCCCCACTGG + Intronic
1167079873 19:47271436-47271458 GCCCCAGAGGCTGCCCCCACCGG + Exonic
927638838 2:24834338-24834360 CCCACTGGGACGGCCCCCACAGG - Intronic
930659679 2:54041245-54041267 CCCCTAGAAAAGGCCACCGCTGG - Intronic
936166780 2:110127682-110127704 CCCGCAGGGACAGCCCCGGCTGG + Intronic
938234620 2:129695813-129695835 CCCCCAAACACGGTCCCCACTGG + Intergenic
938319861 2:130355725-130355747 CACCCAGAGCCGGCACCCGGAGG + Intergenic
940017101 2:149118216-149118238 TCCCCAGAGACTGCACCCCCTGG - Intronic
948570114 2:238912562-238912584 CCCGGAGAGGCGGCCGCCGCAGG - Intergenic
1172073737 20:32277963-32277985 CCCCCAGACACGGCCACCTTGGG + Intronic
1172301366 20:33852783-33852805 CCCCTAGAGACAGCCCCTGGGGG + Intronic
1172628356 20:36361612-36361634 CCCCCAGAGTCGCCCCCGTCCGG - Intronic
1176190795 20:63808621-63808643 CCCCCAGAGAAGGCCCTCCTCGG + Intronic
1176217312 20:63954323-63954345 CCCCCAGAGCTGGCCCGTGCTGG - Intronic
1178535131 21:33404108-33404130 CCAGCAAAGGCGGCCCCCGCCGG - Intronic
1180214280 21:46314780-46314802 CCCCCAGAGCTGCCCCCCACGGG - Exonic
1180875059 22:19171352-19171374 CCTCCAGCGTGGGCCCCCGCTGG + Intergenic
1181469893 22:23131824-23131846 CCCCCAGAGACTGCTCCTGGTGG + Intronic
1183484333 22:38081318-38081340 CCCCCAGGGTCCGGCCCCGCCGG - Exonic
1183650913 22:39152771-39152793 CCCCCGGGGCCCGCCCCCGCGGG + Intergenic
953485077 3:43286921-43286943 GCCGCAGTGACGGCTCCCGCCGG - Intronic
954156251 3:48686305-48686327 CACCGAGAGCCGGGCCCCGCGGG - Intronic
962318746 3:134374471-134374493 GCCCCAGGGTCGGCCCGCGCCGG + Intronic
962770871 3:138609069-138609091 CGCCCAGAGATGGCCGCCGCCGG - Intronic
966762051 3:183427717-183427739 GCCCCAGGGATGCCCCCCGCTGG + Intronic
968079991 3:195839442-195839464 CCTCCAGGGCCGGCTCCCGCTGG - Intergenic
968093015 3:195909694-195909716 CGCCCCGCGCCGGCCCCCGCAGG + Intronic
968618453 4:1592860-1592882 CCCCCAGACACGGGCCCCGCAGG + Intergenic
972872151 4:43313269-43313291 CCCCCAGACATGGTCCCCACTGG + Intergenic
976146118 4:82044166-82044188 CCCCGAGCCACGGCCCCGGCTGG - Intronic
976389265 4:84492928-84492950 CCCCCAGATTTTGCCCCCGCGGG - Exonic
979087229 4:116428485-116428507 CCCCCACAAATGGCCCCCACTGG + Intergenic
984938605 4:184911831-184911853 CCACCAGAGAGGGTCCCCACAGG - Intergenic
985806182 5:2045053-2045075 CCCCCAGTGACAGCATCCGCAGG - Intergenic
986619693 5:9659504-9659526 CCCCTGGAGATGGCCCACGCTGG + Intronic
996665058 5:126049633-126049655 CCCCCAGAGAAGCCCCACACTGG + Intergenic
997470877 5:134116012-134116034 CCCCCAGCCGCAGCCCCCGCTGG + Exonic
1002317227 5:178350995-178351017 CCCCAGGAGACCACCCCCGCTGG - Intronic
1002560449 5:180078265-180078287 CCCCCAGAGCAGGCACTCGCAGG + Intergenic
1003052549 6:2793060-2793082 CCCCCAGAGCCGGCCCTGCCCGG + Intergenic
1006594754 6:35184921-35184943 CCCCCAGGGAAGGCCCCTGGTGG - Intergenic
1013423067 6:109983841-109983863 CCCCCAGAGCCAGCACCAGCAGG + Intergenic
1017644493 6:156526593-156526615 AGCCCAGAGAAGGCCCACGCTGG + Intergenic
1019538555 7:1541203-1541225 CCCCCAGACACCGACCCCACAGG + Exonic
1019689656 7:2403581-2403603 CCCCCAGAGGCAGCCCTCGCCGG - Exonic
1019706560 7:2499794-2499816 CCCCCAGCGACGCCCCACCCTGG + Intergenic
1026965282 7:74435425-74435447 CCCTCAGACAGGGCCCCTGCTGG + Intergenic
1029168959 7:98617558-98617580 CCCCCAGAGGCGGTGCACGCCGG + Exonic
1029713757 7:102314529-102314551 CCCCCAGAGACGACAGCCGTGGG + Exonic
1032391039 7:131555770-131555792 CCTCCAGCCACGGCCCACGCGGG - Intronic
1033794952 7:144835816-144835838 CCCCCGGAGACCGGCCGCGCGGG + Intronic
1035720281 8:1786067-1786089 CCCCGATAGAGAGCCCCCGCAGG - Exonic
1036508619 8:9379734-9379756 CACCCAGAGATGGCCCTCGGTGG + Intergenic
1037540094 8:19862582-19862604 CCCCCACAGACAGCCCCCCCAGG + Intergenic
1038039708 8:23714465-23714487 CCCCCGGAGTCAGCCCCCGACGG - Intergenic
1042360914 8:67882222-67882244 CCCCCAGAGTGTGCCCCAGCAGG - Intergenic
1042799780 8:72706080-72706102 CTCCCAGAGAAGGCCCCTCCAGG + Intronic
1043526980 8:81107792-81107814 CCCGCAGAGACAGCCCCTGAGGG - Intronic
1049392801 8:142380766-142380788 CCACCAGGGACGGCCCACGGCGG + Intronic
1053461983 9:38278329-38278351 CACCCAGAGACAGCCCTCTCAGG + Intergenic
1054842556 9:69759547-69759569 ACTCCAGAGACGTCCCCCGTAGG - Intronic
1057198437 9:93127789-93127811 CTCCCAGAGAGGGCCCCAGGAGG - Intronic
1057208017 9:93184785-93184807 CCCCCAGAGACGGCCCCCGCAGG + Intergenic
1057573216 9:96219424-96219446 GCCCCAGGCACGGCCCCCGCAGG - Intergenic
1057636934 9:96777859-96777881 CCCCCGGAGCCCGCCCCCACCGG + Exonic
1060106496 9:120876474-120876496 CTCCCGGAGCGGGCCCCCGCGGG + Intronic
1061089967 9:128420919-128420941 CCTCCAGCCACGGCCCCAGCAGG - Exonic
1061416093 9:130447640-130447662 CCCCCAGAAAGGGCCACGGCAGG - Intronic
1062003890 9:134229864-134229886 CCCCCAGGGGCTGCCCCCGACGG + Intergenic
1062109608 9:134774711-134774733 CCTCCAGAGAGGCCCCCCGTGGG - Intronic
1062562113 9:137146306-137146328 CCCCCACATACCGCCCCTGCAGG + Intronic
1062566999 9:137167932-137167954 GCCCCAGAGACTGCCCACCCTGG + Exonic
1190301450 X:49059732-49059754 CACCCAGAGGCGGGCCCGGCAGG - Intronic
1200068781 X:153517817-153517839 CCCGCAGCGACAGCGCCCGCCGG + Intronic
1200169950 X:154065230-154065252 CCTTCAGAGACAGACCCCGCAGG + Intronic