ID: 1057208633

View in Genome Browser
Species Human (GRCh38)
Location 9:93187654-93187676
Sequence TCTCCTCACTGGTGACCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 201}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057208633_1057208646 8 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208646 9:93187685-93187707 CATTGTGGGATCAGGGGAGGAGG No data
1057208633_1057208645 5 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208645 9:93187682-93187704 GGGCATTGTGGGATCAGGGGAGG No data
1057208633_1057208642 0 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208642 9:93187677-93187699 TGGCAGGGCATTGTGGGATCAGG No data
1057208633_1057208641 -6 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208641 9:93187671-93187693 AGGAGATGGCAGGGCATTGTGGG No data
1057208633_1057208643 1 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208643 9:93187678-93187700 GGCAGGGCATTGTGGGATCAGGG No data
1057208633_1057208640 -7 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208640 9:93187670-93187692 GAGGAGATGGCAGGGCATTGTGG No data
1057208633_1057208644 2 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208644 9:93187679-93187701 GCAGGGCATTGTGGGATCAGGGG No data
1057208633_1057208647 9 Left 1057208633 9:93187654-93187676 CCCCAAGGTCACCAGTGAGGAGA 0: 1
1: 0
2: 1
3: 26
4: 201
Right 1057208647 9:93187686-93187708 ATTGTGGGATCAGGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057208633 Original CRISPR TCTCCTCACTGGTGACCTTG GGG (reversed) Intronic
901438161 1:9262153-9262175 CCTCCGCACTGCTGACATTGTGG - Exonic
902113460 1:14102224-14102246 TCTCAGCACTGGAGACCCTGTGG - Intergenic
906145286 1:43557007-43557029 TTTCCCCACTCGTGACCTGGGGG + Intronic
906380904 1:45331736-45331758 TCTCCTCCCTGGGGGGCTTGCGG + Exonic
908135297 1:61126056-61126078 TTTCCTCACTTGTAAACTTGAGG - Intronic
908452573 1:64270505-64270527 AGCCCTCACTGGTGACATTGAGG - Intergenic
908558801 1:65284550-65284572 ACTCCCCACTGGAGGCCTTGAGG - Intronic
911686049 1:100779034-100779056 TCTGCTTACTGCTGTCCTTGGGG + Intergenic
911906043 1:103569884-103569906 TCTTCTCTCTGTTGGCCTTGAGG - Intronic
917967704 1:180188900-180188922 CCTCCTCCCTGGAGTCCTTGTGG + Intronic
920387347 1:205578406-205578428 TCTCCTAACAGCTGGCCTTGAGG + Intronic
921049621 1:211501662-211501684 CCTGCCCACTGCTGACCTTGTGG + Intergenic
922252721 1:223864498-223864520 TCTTCTCACGGTTGGCCTTGGGG + Intergenic
922696281 1:227732604-227732626 TCTTCTCAGCGATGACCTTGAGG + Exonic
923864684 1:237927162-237927184 TCTTCTCTCTGTTGGCCTTGGGG - Intergenic
924406220 1:243749865-243749887 TAACCTCATTGGTGACTTTGTGG - Intronic
924738853 1:246782808-246782830 TATCCTCCCTGCTGACCGTGTGG - Intergenic
1063174776 10:3541556-3541578 TTTCCTTACTGGTGAGGTTGAGG + Intergenic
1065057230 10:21858761-21858783 TTTCCTCCCTGGTGACCTAGTGG - Intronic
1065846080 10:29744670-29744692 GCTCCTCAAAGGTGACCTTCAGG + Intergenic
1066166962 10:32798767-32798789 TCTCTTCACTGCTGTCCTTCAGG + Intronic
1069628929 10:69885860-69885882 TCTCCTCCCTCGTGCCCTTTTGG + Intronic
1070801503 10:79246879-79246901 TCTCCTGCCATGTGACCTTGGGG - Intronic
1071569415 10:86688481-86688503 TCTGCTCCCTGGTGGCCTAGAGG - Intronic
1073703652 10:105958255-105958277 TCTCCTCACTGCTGCCTTTTAGG + Intergenic
1074467074 10:113692697-113692719 CTACCTCACAGGTGACCTTGTGG - Intronic
1075316144 10:121455171-121455193 TCTCCTTCCTGGTGGCCTTGTGG + Intergenic
1076368538 10:129937065-129937087 CCTCCTCACTGCAGCCCTTGGGG - Intronic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1076733733 10:132450027-132450049 TCTCCCCACTGGCAGCCTTGGGG + Intergenic
1076831035 10:132994362-132994384 TTTCCTCATTGGTGAAATTGGGG + Intergenic
1077294303 11:1817651-1817673 TGTCTTTACTGGTGACCATGTGG - Intergenic
1079765764 11:24390039-24390061 TCTCCTCAGTGAGTACCTTGAGG - Intergenic
1081553303 11:44134069-44134091 ACTGCTCACTGGTGGCCTTCAGG - Intronic
1083006385 11:59350784-59350806 TATCCTATTTGGTGACCTTGAGG + Intergenic
1083757856 11:64801172-64801194 TCTCCCCACAGCTGACTTTGGGG - Exonic
1084657752 11:70528947-70528969 TCCCCCCACTGGTGGCCTTGTGG + Intronic
1087025268 11:93643436-93643458 TCTCCACACTGATCACCCTGGGG - Intergenic
1088510371 11:110567289-110567311 TCTCCTCACTGGTCACCAGATGG - Intergenic
1089515060 11:119027015-119027037 GCTCTCCACTGGTTACCTTGTGG - Exonic
1090178475 11:124673217-124673239 CCCCCTCAGTGGTGCCCTTGGGG - Intronic
1091150436 11:133323649-133323671 TCTCCTGCCTGGTGGCCTAGTGG - Intronic
1092085828 12:5758731-5758753 TCTCCTCACTACTGACCTGATGG + Intronic
1092761117 12:11812354-11812376 TTTCCTCACAGGTTCCCTTGGGG + Intronic
1092782780 12:12002830-12002852 ACTCCTCTCTGGAGCCCTTGGGG - Intergenic
1093202030 12:16199371-16199393 TCACCACATTGGTGACCTGGGGG - Intronic
1095603914 12:44044762-44044784 TCCCTTCACTGTTGACCTTCAGG - Intronic
1095923157 12:47551451-47551473 TCTCCTCACTTGTCAAATTGTGG + Intergenic
1097347138 12:58505959-58505981 CCTCCACCCTGGTGACCTTGGGG + Intergenic
1098733350 12:74066068-74066090 TCCCTTCACTGCTGTCCTTGAGG - Intergenic
1099623402 12:85033649-85033671 TCTCCTCATTGATGATATTGGGG - Intronic
1102183738 12:110932100-110932122 TCTCCTGGCTGGGGACTTTGGGG + Intergenic
1102870575 12:116410980-116411002 ACTGCACACTGGTGACCCTGGGG - Intergenic
1103561567 12:121795636-121795658 GCTCCTCCCTGGTCACCCTGAGG - Intronic
1103691809 12:122781309-122781331 TCTTCTCTCTGAAGACCTTGAGG + Exonic
1104901471 12:132191700-132191722 TCTCCTCACTGGGCAGCTTTGGG - Intergenic
1114058613 14:18999200-18999222 TCTTCTCACGGTTGGCCTTGGGG - Intergenic
1114103934 14:19402554-19402576 TCTTCTCACGGTTGGCCTTGGGG + Exonic
1115881776 14:37927416-37927438 TCTCCTCACTGCTGCTTTTGGGG + Intronic
1118845408 14:69544260-69544282 TCTCCTAAGTGGTCTCCTTGTGG + Intergenic
1118988096 14:70774239-70774261 CCTCCTGGCTGGTGATCTTGAGG - Intronic
1119271079 14:73305473-73305495 TTATCTCACTGGTGATCTTGGGG - Intronic
1120036474 14:79704055-79704077 TCTCCTGATTGATGAGCTTGGGG - Intronic
1122375687 14:101255536-101255558 TCCCCACACTGCTGGCCTTGAGG + Intergenic
1202864813 14_GL000225v1_random:109271-109293 TCTCTGCACTGATGACCCTGGGG - Intergenic
1124077898 15:26462794-26462816 TATCCTATCTGGTGACCTTGAGG - Intergenic
1124397268 15:29313946-29313968 AATCCTCACAGGTGACCTTGAGG + Intronic
1124781948 15:32644201-32644223 TCTCCTCACTGCTGATCTTCAGG + Intronic
1130307914 15:82727080-82727102 TCTTCTCTCTGTTGGCCTTGGGG + Intergenic
1130969073 15:88718297-88718319 TTTCCTCCCTGGTGACTTTCAGG + Intergenic
1131249050 15:90819038-90819060 TCTTCCCAGTGGTGACCCTGTGG - Intergenic
1137675824 16:50303504-50303526 GCTCATCTCTGGTGGCCTTGTGG + Intronic
1138264692 16:55652115-55652137 TCTCCTCATTGGTGCCATGGAGG + Intergenic
1140542449 16:75770035-75770057 TCTCATCTCTGCTTACCTTGAGG - Intergenic
1141071174 16:80955632-80955654 TATCCTATCTGATGACCTTGAGG - Intergenic
1144688352 17:17242115-17242137 TCTTCTCTCTGTTGACCTTGGGG - Intergenic
1144997363 17:19279368-19279390 TCCCCCATCTGGTGACCTTGTGG - Intronic
1146984720 17:37204395-37204417 TCTTCTAGCTGGTGACCTAGGGG + Intronic
1148068106 17:44888385-44888407 TCTCAGCACTGTTGACATTGGGG - Intronic
1149429204 17:56583480-56583502 ACTTCTCAGTGGTGACCTTAGGG + Intergenic
1149479565 17:56991770-56991792 TCTCAGCACTGTTGACATTGTGG + Intronic
1151519002 17:74615159-74615181 TTTCCTCACTGCTGGCCTGGGGG - Intronic
1152654052 17:81511911-81511933 TCTTCTCTCTGTTGGCCTTGGGG + Exonic
1154041969 18:10865013-10865035 TCTCCTCACTCTTGTCCTTCTGG - Intronic
1155199429 18:23503894-23503916 TGTCCTCGCAGGTGACCTCGGGG + Intronic
1155903433 18:31419617-31419639 TCACCTCAGTGGTGACCTAAAGG - Intergenic
1157572398 18:48721634-48721656 TCTGCACAATGGTGTCCTTGGGG - Intronic
1157975231 18:52319528-52319550 TCTCCTCACGGCTGACATTTTGG + Intergenic
1160295772 18:77635473-77635495 TCTCCTTCCTGGTGTCTTTGTGG - Intergenic
1160964696 19:1741953-1741975 TCTCCCAGCTGGTGTCCTTGGGG - Intergenic
1161318794 19:3631640-3631662 TGTCCTCGCTGGGGACCTCGGGG + Exonic
1162327097 19:10005942-10005964 TCTCCTTGCTGATCACCTTGCGG - Exonic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1164802871 19:31092204-31092226 TCTCCTGCCTCTTGACCTTGGGG - Intergenic
1165374198 19:35430060-35430082 TCTCCACTCTGGTCACCTAGGGG - Intergenic
1166118669 19:40671636-40671658 TCTGCTCACCGGTTACCTTTTGG + Intronic
925235955 2:2277353-2277375 TTTGCTCAAGGGTGACCTTGTGG + Intronic
927473808 2:23396968-23396990 CCACCTCACTTGTGACCTTGAGG + Intronic
928221727 2:29408835-29408857 TCTCAAGCCTGGTGACCTTGAGG - Intronic
929357123 2:41039087-41039109 TCACGTTCCTGGTGACCTTGTGG - Intergenic
929573896 2:43040275-43040297 TCTCCCCACTGGTGGCGTGGTGG - Intergenic
930030956 2:47057695-47057717 TCTCCTCTCTCGTGACCCTGGGG + Intronic
931859252 2:66336566-66336588 TCTGCTCAAAGGTGACCCTGAGG + Intergenic
932384979 2:71323783-71323805 TCGCCTCACAGGGGTCCTTGAGG - Intronic
932897072 2:75650651-75650673 TCTCCTAACTGGAGACCCTTGGG - Intronic
935072601 2:99708602-99708624 TCTCCTCAGTGCTCACTTTGGGG + Intronic
935581041 2:104756046-104756068 TATCCTCCCTGCTGACCCTGTGG + Intergenic
937984724 2:127633345-127633367 TCACCTCACTGGTGTCATTGGGG - Exonic
938477079 2:131626471-131626493 TCTTCTCACGGTTGGCCTTGGGG - Intergenic
939434517 2:142156741-142156763 TCTCATCCCTGGTTAACTTGAGG - Intergenic
939909036 2:147957393-147957415 TCTGGTTACTGGTGACCATGCGG - Intronic
941111216 2:161420452-161420474 CCTTCTCTCTGGTGACCTTGTGG + Intronic
943025206 2:182619431-182619453 TCTCCTCTCTGGTCATTTTGAGG - Intergenic
944440545 2:199739237-199739259 TCTCCTCTCCAGTGGCCTTGAGG - Intergenic
946284404 2:218692287-218692309 TCTCCACTCTGGTTACCTTGGGG - Exonic
947760419 2:232599971-232599993 TCCCCTAACAGGTGACCTTCCGG - Intergenic
948531117 2:238606289-238606311 TTTTCTCACAGGTGTCCTTGGGG + Intergenic
1168915200 20:1479787-1479809 TGTGCTCCCTGGTGACATTGTGG + Exonic
1170158034 20:13286266-13286288 GCACCTCTCTGGTGCCCTTGGGG + Intronic
1170789672 20:19497350-19497372 GCTCCTCACTGCAGGCCTTGCGG - Intronic
1173215454 20:41077757-41077779 TCTTCTCACTGCTGAGCTTCTGG - Intronic
1173734170 20:45347996-45348018 TCCCTTCCCTGGTGACCCTGGGG - Intronic
1174276411 20:49407761-49407783 CCTCCGCACTGGTGACATTTGGG - Intronic
1174332609 20:49831963-49831985 GCTCCTCACTAATGACCCTGAGG - Intronic
1174402188 20:50282125-50282147 CCTCCTCCCTGCTGACCTTGGGG + Intergenic
1177190486 21:17845893-17845915 ACTTCTCACGGGTGACCTTAAGG + Intergenic
1177493791 21:21862825-21862847 TCTCCTAACTTGTTACATTGGGG - Intergenic
1179923662 21:44521095-44521117 TCACCTCCCTGGTGTCCTTCTGG - Intronic
1180477098 22:15721819-15721841 TCTTCTCACGGTTGGCCTTGGGG - Intergenic
1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG + Intronic
1181808697 22:25390728-25390750 TCTCCACACTGGAGCCCTTGTGG - Intronic
1184955321 22:47882123-47882145 CCTCATCACTGGTCACCGTGAGG + Intergenic
949607412 3:5669248-5669270 TCTCCTCAATGGTAAAATTGAGG - Intergenic
950322590 3:12070568-12070590 TCTTCTCTCTGTTGGCCTTGGGG - Intronic
950626268 3:14249456-14249478 TCTCCTCTCTGGGGACAATGGGG - Intergenic
950922973 3:16714707-16714729 TATCCTATTTGGTGACCTTGAGG + Intergenic
952012762 3:28919843-28919865 CCTTCTCACTGGTGAACTTCAGG - Intergenic
953876286 3:46668595-46668617 TCTCTTCAGTGGTGATCTTGAGG - Intergenic
954398066 3:50303450-50303472 GCTCGTCCCTGCTGACCTTGGGG + Exonic
956557608 3:70540286-70540308 TCTCCTGTCTGATGACCATGAGG - Intergenic
957367535 3:79245721-79245743 TCCTTTCACTGGAGACCTTGGGG + Intronic
958258948 3:91356298-91356320 TCTCTTCACTGCTGTCCTTCAGG + Intergenic
958531057 3:95330494-95330516 TCTACTCACAGGTGACCTTGTGG - Intergenic
960688190 3:120314538-120314560 TATCCTATTTGGTGACCTTGGGG - Intergenic
961455514 3:127022013-127022035 GCCCCTCACTGGTCAGCTTGGGG + Intronic
963993559 3:151681023-151681045 TTTCCTCACTGGATACCTTTAGG + Intergenic
964464436 3:156974931-156974953 TCTCATCACTTCTCACCTTGAGG - Intronic
966290018 3:178344108-178344130 TATCCTGTTTGGTGACCTTGAGG - Intergenic
968442303 4:630091-630113 TCTCCTCTCTGGTGCCCTCTGGG - Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
971531548 4:27695035-27695057 TCTCCTTTCTGGAGGCCTTGTGG + Intergenic
973673756 4:53242440-53242462 TATCCTATTTGGTGACCTTGGGG - Intronic
978021080 4:103813489-103813511 TCTGCTAACTGGAGACCCTGGGG + Intergenic
978966908 4:114751377-114751399 TCTCTTCACTGCTGTCCTTCAGG - Intergenic
983369327 4:166839235-166839257 TTTCATCACTGTTGACCCTGAGG + Intronic
984694983 4:182770351-182770373 TCTCCTCACTGGAGAACATGAGG - Intronic
986941672 5:12958362-12958384 AATCCTCACAGGTGACTTTGAGG + Intergenic
987730398 5:21763921-21763943 TTCCCTCTCTGGTGGCCTTGAGG - Intronic
988611880 5:32734583-32734605 GAAGCTCACTGGTGACCTTGAGG - Intronic
988816765 5:34841859-34841881 TCTCTGCACTGTTGACATTGGGG + Intronic
993606360 5:89995015-89995037 TCTCCTCTCTGGTGTGATTGAGG + Intergenic
996753498 5:126912906-126912928 TTTCATCACTGGTGACCGTTTGG + Intronic
997106069 5:131020183-131020205 TCGCCTCACAGGTGTCCTTGAGG - Intergenic
997263065 5:132478420-132478442 TCTGCTCATTTGTGAGCTTGTGG + Intergenic
997365271 5:133321505-133321527 ACTCCTCCCTGGTGCCCCTGTGG + Intronic
997566156 5:134888107-134888129 TCTCCTCACAGTTCACCTTTGGG - Exonic
1001435953 5:171699573-171699595 TCTCCTCACTAGTGACATTTGGG + Intergenic
1002101844 5:176861706-176861728 TCATCTTAGTGGTGACCTTGGGG - Intronic
1002878568 6:1232771-1232793 TGTCCACACTGGTGACATCGGGG - Intergenic
1005505955 6:26468961-26468983 TCTCCTCTCTGGTGGTCCTGTGG - Exonic
1005807426 6:29487791-29487813 TCTCCACAGTGGTGACCAGGAGG - Exonic
1006418759 6:33920531-33920553 TCTCCTCAATAATGAGCTTGGGG + Intergenic
1009481513 6:64164078-64164100 ACTCCTAAATGGTGATCTTGAGG + Intronic
1010021512 6:71165126-71165148 TCACCTCAGTGGTGGCCTTCCGG - Intergenic
1010818686 6:80388841-80388863 TCTCTTCACTGCTGTCCTTCAGG - Intergenic
1011798044 6:90979369-90979391 TATGCTTACTGGTCACCTTGTGG + Intergenic
1014213182 6:118728120-118728142 TCTCCTTCCTTCTGACCTTGAGG + Intergenic
1018952432 6:168387809-168387831 TCTCCTCCCTGGGGACCTCCAGG - Intergenic
1020373620 7:7461271-7461293 TCACATCACTGGGGTCCTTGAGG + Intronic
1020710413 7:11598061-11598083 TCCCTTCACTGCTGTCCTTGAGG - Intronic
1021239221 7:18179971-18179993 TCTCCACACTGATGAGATTGAGG + Intronic
1021351056 7:19595170-19595192 TATCCTATCTGATGACCTTGAGG + Intergenic
1023203632 7:37724800-37724822 GCTCCCAACTGGTGTCCTTGAGG + Intronic
1023518499 7:41027375-41027397 TCTTCTCCTTGGTGACATTGTGG + Intergenic
1023811961 7:43918791-43918813 ACTCCTCCATGGTGCCCTTGGGG - Intronic
1024482796 7:49882655-49882677 TCTCATCCCTGGTGAGCTTTTGG + Intronic
1026378273 7:69773849-69773871 TCTCCTCCCTGGTGGCAGTGGGG + Intronic
1026977769 7:74508809-74508831 TCTCCTAGCAGGTGACCTGGGGG + Intronic
1027263609 7:76481747-76481769 TTTCCTCACTGGTGACACTGTGG - Intronic
1027314981 7:76979859-76979881 TTTCCTCACTGGTGACACTGTGG - Intergenic
1028894743 7:96028558-96028580 TCTCTTCACTGGTGGCCTTTGGG - Intronic
1033598242 7:142871357-142871379 TCTCCCCACTTATGACCCTGGGG + Exonic
1036380908 8:8235939-8235961 TTCACTCACAGGTGACCTTGGGG + Intergenic
1036653000 8:10657484-10657506 TCTCATCACTGCTGACATTTGGG - Intronic
1037469341 8:19191978-19192000 GCTCCTCACTGGGGATCTCGTGG - Intergenic
1038387578 8:27163814-27163836 TCTCAGCACTGTTGACTTTGGGG + Intergenic
1044893014 8:96857201-96857223 TTTCTTCTCTAGTGACCTTGAGG - Intronic
1044907168 8:97017293-97017315 TCACCTCACAGGGGTCCTTGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045390000 8:101705727-101705749 TCTCCTCCATGGTGGCTTTGGGG - Intronic
1046218878 8:111186428-111186450 TCTGCTCAATGGTTACCATGTGG + Intergenic
1047251446 8:123184377-123184399 TCTGCCCACAGATGACCTTGTGG + Intronic
1048555640 8:135473244-135473266 TCTCTTCATTGGTGACCACGTGG + Intronic
1048595874 8:135865283-135865305 TCCCCTCACGGGAGACCATGAGG + Intergenic
1051178330 9:14383760-14383782 TCTCTTCTCTGGCCACCTTGTGG + Intronic
1051421766 9:16896134-16896156 TCTCCAAGCTGGTTACCTTGAGG + Intergenic
1051483094 9:17579652-17579674 CCTCTTCACGGGTGACCTTGCGG + Intronic
1052804292 9:32999220-32999242 AATAGTCACTGGTGACCTTGGGG + Intronic
1054351091 9:64017198-64017220 TCTCCTCACAACAGACCTTGGGG + Intergenic
1055977733 9:81971155-81971177 TATCCTCACTGGAGACATTCAGG - Intergenic
1056280298 9:85035217-85035239 TCTACTCACAGATGCCCTTGTGG - Intergenic
1057208633 9:93187654-93187676 TCTCCTCACTGGTGACCTTGGGG - Intronic
1057868736 9:98702095-98702117 TCACCTGCTTGGTGACCTTGGGG - Intronic
1060399303 9:123338839-123338861 TCTCCTCAGTGTGGCCCTTGAGG - Intergenic
1203739535 Un_GL000216v2:166951-166973 TCTCTGCACTGATGACCCTGGGG + Intergenic
1186394690 X:9195802-9195824 TCTCCACCTTGGTGACTTTGAGG - Intergenic
1188592744 X:31859082-31859104 TCTCTACCCTGCTGACCTTGTGG - Intronic
1188790750 X:34405340-34405362 GTTCCTCACAGTTGACCTTGCGG - Intergenic
1190733556 X:53240383-53240405 TCTCATCACTGTTGACATTTGGG - Intronic
1191823744 X:65340665-65340687 TATCCTAATTGGTGACCTTGAGG - Intergenic
1191913301 X:66174579-66174601 TCTCCACACTGTTTTCCTTGTGG + Intronic
1192559493 X:72116689-72116711 TCTCCTCCCTTCTAACCTTGAGG - Intergenic
1193579989 X:83252429-83252451 TCTCATCACTGGACCCCTTGTGG + Intergenic
1194491888 X:94560987-94561009 TTACCTCACAGGGGACCTTGTGG - Intergenic
1195499348 X:105576541-105576563 TCCCCATACTGGTCACCTTGTGG + Intronic
1195751150 X:108162916-108162938 TGGCCTCACTGGGGACCCTGGGG - Exonic
1195782293 X:108479432-108479454 TCCCTTCACTGGTGTCCTTCAGG + Intronic
1197409272 X:126096016-126096038 TCCCTTCACTGCTGTCCTTGAGG + Intergenic
1199679265 X:150214301-150214323 TCTCCTCACTGGTCTCCAGGTGG + Intergenic