ID: 1057212150

View in Genome Browser
Species Human (GRCh38)
Location 9:93206218-93206240
Sequence ATGTAGGGCCCCATTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057212144_1057212150 24 Left 1057212144 9:93206171-93206193 CCATGTGGACAGTGTGATCTGTC 0: 1
1: 0
2: 0
3: 19
4: 194
Right 1057212150 9:93206218-93206240 ATGTAGGGCCCCATTTCTTTGGG No data
1057212143_1057212150 25 Left 1057212143 9:93206170-93206192 CCCATGTGGACAGTGTGATCTGT 0: 1
1: 0
2: 1
3: 8
4: 144
Right 1057212150 9:93206218-93206240 ATGTAGGGCCCCATTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057212150 Original CRISPR ATGTAGGGCCCCATTTCTTT GGG Intronic
No off target data available for this crispr