ID: 1057214621

View in Genome Browser
Species Human (GRCh38)
Location 9:93220954-93220976
Sequence GGATGGGTGGGCAGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 1, 2: 5, 3: 51, 4: 616}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057214621_1057214632 16 Left 1057214621 9:93220954-93220976 CCTCCTGGGCTGCCCACCCATCC 0: 1
1: 1
2: 5
3: 51
4: 616
Right 1057214632 9:93220993-93221015 GCTCCACTAGCATCCCATGGTGG No data
1057214621_1057214631 13 Left 1057214621 9:93220954-93220976 CCTCCTGGGCTGCCCACCCATCC 0: 1
1: 1
2: 5
3: 51
4: 616
Right 1057214631 9:93220990-93221012 ACAGCTCCACTAGCATCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057214621 Original CRISPR GGATGGGTGGGCAGCCCAGG AGG (reversed) Intronic
900163969 1:1237372-1237394 GGATGGGTGGGGAGCGCCTGGGG - Intergenic
900207821 1:1439133-1439155 GCAGGGGTGGCCAGGCCAGGCGG - Exonic
900221089 1:1509574-1509596 AGAGGGGTGGGCTGCACAGGAGG + Intergenic
900495934 1:2976256-2976278 AGCTGGGTGGGCAGCCCTGCTGG - Intergenic
900526190 1:3129995-3130017 GGCTGGGAGGGCAGTGCAGGCGG + Intronic
900547626 1:3237348-3237370 GTGGGGGTGGGGAGCCCAGGAGG - Intronic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
901390456 1:8942536-8942558 GGAGGCATGGCCAGCCCAGGTGG - Intergenic
901633021 1:10657022-10657044 AGACAGGTGGGCAGCCGAGGGGG - Intronic
902198781 1:14818515-14818537 GGATGTGGGGACAGCCCAGCAGG + Intronic
902246483 1:15124319-15124341 GGCTGGGTGGACAAACCAGGAGG + Intergenic
902447493 1:16476355-16476377 GGACGGGTGGGCAAGGCAGGTGG + Intergenic
902466530 1:16621975-16621997 GGAGCAGTGGGCAGCCCAGGAGG - Intergenic
902507233 1:16946427-16946449 GGATGGGTGGGCAAGGCAGGTGG - Intronic
902650736 1:17835867-17835889 GGATGGATGGGAAGATCAGGTGG - Intergenic
902792312 1:18777703-18777725 GGAAGGGTGGTCAGGCCAAGGGG + Intergenic
903081640 1:20816241-20816263 GGATGGGGTGGCTGGCCAGGCGG - Intronic
903148211 1:21388224-21388246 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
903637762 1:24833506-24833528 GGATGGGGCGGCTGGCCAGGCGG + Intronic
903748498 1:25604114-25604136 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
904605801 1:31696942-31696964 AGGTGGGTGGGCAGGACAGGTGG - Exonic
905927338 1:41760826-41760848 GGAAGGCTGGGGAGACCAGGTGG - Intronic
906298142 1:44661768-44661790 GGATGGGGTGGCAGCACAGATGG - Intronic
906761655 1:48382929-48382951 GGATGGGGCGGCTGGCCAGGTGG + Intronic
906761709 1:48383056-48383078 GGATGGGGCGGCTGGCCAGGCGG + Intronic
907220565 1:52904555-52904577 GAATGGATGTGCAGCCCAAGGGG + Intronic
907299227 1:53476182-53476204 TGAAGGAGGGGCAGCCCAGGAGG - Intergenic
909977705 1:82064696-82064718 GGATGGGTGGGCAGCACTGGGGG - Intergenic
912533312 1:110341715-110341737 GGATGGGGGGACAGCCCCTGTGG + Exonic
912798079 1:112704939-112704961 GGAGGGGTGGGCAGGGCATGCGG - Intronic
912858057 1:113189451-113189473 GGATGGGTTCCCAGTCCAGGTGG - Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
914047063 1:144102043-144102065 GGCTGGTTTGGCTGCCCAGGTGG + Intergenic
914336005 1:146715486-146715508 GCAGGGGTGGGCAGCCCTGCAGG - Intergenic
915093679 1:153444295-153444317 GCATGAGTGGGCAGCACAGCAGG + Intergenic
915440916 1:155945010-155945032 GGAGGGCTGGGCAGAGCAGGCGG + Intergenic
915797436 1:158751996-158752018 GCATAGGAGGGAAGCCCAGGGGG - Intergenic
915916413 1:159943458-159943480 GGCTGGGTGAGCAGGCCAGCTGG - Exonic
916002079 1:160626779-160626801 GGATGGGTTGGCTGCTCAGAGGG - Intronic
917135662 1:171786052-171786074 TGCTGGGTGGGCATCCCAGCTGG - Exonic
917375920 1:174349882-174349904 GGATGGGGCGGCTGGCCAGGTGG + Intronic
917859951 1:179135664-179135686 GGATGGGGCGGCTGGCCAGGCGG - Intronic
918525125 1:185456529-185456551 GGATGGGGGCTCAGACCAGGGGG - Intergenic
920152261 1:203919423-203919445 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
920284326 1:204868761-204868783 GGAGGGGTGGGCAGACCCAGAGG - Intronic
920674443 1:208029497-208029519 GGCTGGGCGGGGAGCGCAGGTGG - Intronic
921097758 1:211901724-211901746 GCATGGGAGGGAAGCCTAGGTGG + Intergenic
921142595 1:212321165-212321187 GGATGGGGCGGCTGGCCAGGCGG + Intronic
921237842 1:213151192-213151214 GGATGGGGCGGCTGGCCAGGCGG + Intronic
921584741 1:216933874-216933896 AGATGGGGGAGCAGACCAGGAGG - Intronic
921638422 1:217524050-217524072 GGATGGGGCGGCTGGCCAGGCGG + Intronic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
923468222 1:234267607-234267629 GGATGGGGCGGCTGGCCAGGCGG + Intronic
924067365 1:240237740-240237762 GGAGGGGTGGGCAGGGTAGGGGG + Intronic
924448427 1:244155805-244155827 GGAGGAGTGGGCATCACAGGCGG + Intergenic
924772563 1:247089829-247089851 GGAAGGGCAGGCAGCCCAGTCGG - Intergenic
1063377697 10:5563899-5563921 GGGTGGGTGTGCAGGCCCGGCGG - Intergenic
1063459139 10:6204204-6204226 GGGCGGGTGGGCAGCGCAGAGGG + Intronic
1064108375 10:12519466-12519488 GGATGGGGTGGCTGGCCAGGCGG + Intronic
1064112342 10:12550066-12550088 GGAGCGAGGGGCAGCCCAGGAGG + Intronic
1065666742 10:28071285-28071307 AGTAGGGTGGGCATCCCAGGTGG + Intronic
1066085544 10:31970380-31970402 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1067088580 10:43255284-43255306 TGCTGAGTGGGCAGCCTAGGCGG - Intronic
1067142645 10:43669632-43669654 GGCTTGGTGAGCAGCCCAGAGGG + Intergenic
1067167893 10:43879832-43879854 GGGAGGGTGGTCAGCCCGGGAGG + Intergenic
1067323449 10:45244204-45244226 GGGTGGGGGGTCAGCCTAGGAGG + Intergenic
1069430828 10:68332523-68332545 GGAAGGGCGGGAAGCCGAGGTGG - Intronic
1069581969 10:69572553-69572575 GGGGAGCTGGGCAGCCCAGGCGG - Exonic
1069645392 10:69992933-69992955 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1069680016 10:70277694-70277716 GGATGGGTAGGCAGCTGTGGAGG + Intronic
1069882395 10:71601944-71601966 GGCTGGGTGGGCGGCGGAGGGGG + Intronic
1069905898 10:71731881-71731903 TGCTGGGTGGGCCACCCAGGGGG + Intronic
1070668553 10:78362347-78362369 GGAGGTGTGGGCTGCCCAGGTGG - Intergenic
1071602338 10:86964472-86964494 GGATTCAAGGGCAGCCCAGGAGG + Intronic
1072303716 10:94086737-94086759 GGAATGATGGGCAGCCCAGTGGG + Intronic
1073101784 10:101010389-101010411 GGATGGGGAGGCAGCCAAGGTGG - Intronic
1074096517 10:110318164-110318186 AGATGGATGGGGAGGCCAGGAGG - Intergenic
1074125816 10:110528115-110528137 GGAAGAGTGGGCAGCACGGGAGG + Intergenic
1074445377 10:113517336-113517358 CGATGGGTGGGGAACCCAGCTGG - Intergenic
1074858199 10:117489099-117489121 GGATGTGTGGACAGCCAGGGAGG + Intergenic
1075007200 10:118839592-118839614 GGATGGTTGGTCACCCCAGCTGG - Intergenic
1075409064 10:122214076-122214098 GGATCTGTGGGCAGCTCGGGGGG + Intronic
1076427892 10:130380522-130380544 GGATGGATGGGCTGCCCTGGTGG + Intergenic
1076782180 10:132730395-132730417 GGCTGCGTGGGCAGCGCGGGAGG + Intronic
1077430194 11:2512478-2512500 GGAGGGGTTGTCATCCCAGGTGG - Intronic
1077484948 11:2834347-2834369 GGGAGGGTGGGCAGAGCAGGAGG + Intronic
1077533352 11:3107510-3107532 CGAGGGGTGGGCAGCCCAGAGGG - Intronic
1078083970 11:8222876-8222898 GGATGGCTGGGCACTCCTGGGGG - Intergenic
1079279198 11:19072694-19072716 GGAGGGTTGGGCAGCCAGGGAGG + Intergenic
1079371902 11:19859969-19859991 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1079371925 11:19860015-19860037 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1082997128 11:59263357-59263379 GGAAGGGTGGGGACCCCAGTGGG - Intergenic
1083203364 11:61132996-61133018 GGATGGTAGGGCAGCACAGCAGG - Intronic
1083302386 11:61745787-61745809 GGTAGGGTGGGCAGCCCCAGAGG - Exonic
1083307362 11:61768363-61768385 GGACGGAGTGGCAGCCCAGGGGG + Intronic
1083612133 11:64009391-64009413 GGATGGACGGGCCCCCCAGGGGG - Intronic
1083891962 11:65599955-65599977 GGAGGGGAGGGCAGTGCAGGTGG + Intronic
1084392992 11:68890802-68890824 GGAGGGCTGGGCAGGACAGGAGG - Intergenic
1084575052 11:69983614-69983636 GGAAGGCTGGGCTGCCCATGTGG - Intergenic
1084939869 11:72606784-72606806 GGAGGGGTGGGTAGTCCATGGGG + Intronic
1085016850 11:73179307-73179329 TGGGGGGTAGGCAGCCCAGGTGG - Intergenic
1085403213 11:76246712-76246734 TGGGGGGTGGGAAGCCCAGGTGG + Intergenic
1085414735 11:76312494-76312516 GGCTGGGTGTAAAGCCCAGGGGG + Intergenic
1085507873 11:77070365-77070387 GGCTGGCTGGGCAGGGCAGGTGG - Intronic
1086122279 11:83316209-83316231 GGACGGGTCGGCTGGCCAGGCGG + Intergenic
1087215293 11:95487058-95487080 GGATGGGTGGGCAACGCCAGCGG - Intergenic
1088034804 11:105298511-105298533 GGATTTGTAGGCTGCCCAGGTGG + Intergenic
1088818323 11:113436141-113436163 GGAGGGGTGGGCAGGCAAGATGG + Intronic
1089126090 11:116177652-116177674 GGATGGGAGGGCAGGACAGATGG + Intergenic
1089213781 11:116823354-116823376 GGAGGGGAGGGCAGCCAGGGGGG - Intergenic
1089462338 11:118660522-118660544 GGCTGGGTGAGCACCCCAGTAGG - Exonic
1089591842 11:119546745-119546767 GCATGGGAGGGAAGCCAAGGGGG + Intergenic
1089777431 11:120848150-120848172 GGATGGCTGGGCAGCCGTTGAGG + Intronic
1090423682 11:126592689-126592711 GCCAGGGTGGGGAGCCCAGGAGG + Intronic
1091446063 12:544798-544820 GGATTGGCGGGAAGACCAGGAGG - Intronic
1092453882 12:8625936-8625958 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1092827621 12:12414181-12414203 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1096314700 12:50554232-50554254 GCATGGGTGGGTAGCTAAGGTGG - Intronic
1096500554 12:52061862-52061884 GGATGGGAGGGCAAACAAGGGGG + Intergenic
1096599969 12:52722223-52722245 GGATGGGTGCACAGCCCCAGTGG + Intergenic
1096648951 12:53052676-53052698 GGAGGGCTGGCCAGCCCAGGCGG + Intronic
1096714878 12:53485268-53485290 GAGTGGGTGGCCAGCCCTGGGGG - Intronic
1097043694 12:56171778-56171800 GGATGGGTTGGTAGGCCAGGGGG + Exonic
1097228589 12:57495190-57495212 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1097699761 12:62808117-62808139 GGATGGGTGGCCAGACACGGTGG - Intronic
1097853154 12:64434103-64434125 AGATGGGAGGATAGCCCAGGAGG - Intronic
1098412810 12:70202404-70202426 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1098412864 12:70202531-70202553 GGATGGGGCGGCTGGCCAGGTGG - Intergenic
1099210041 12:79773254-79773276 GCATGGTTGGGAGGCCCAGGCGG - Intergenic
1100416749 12:94385647-94385669 AAATGACTGGGCAGCCCAGGTGG - Intronic
1100444850 12:94650675-94650697 GGGTGGGTGGGGGGTCCAGGCGG - Intergenic
1100570545 12:95841066-95841088 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1100994978 12:100294229-100294251 GGATGGGGTGGCTGGCCAGGTGG + Intronic
1100995084 12:100294483-100294505 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1101751569 12:107586491-107586513 GAAGGGGTTGGCAGCCCAGCCGG - Intronic
1102768371 12:115452193-115452215 GGATGGGTGGGCAGCTGGAGCGG + Intergenic
1103457171 12:121076438-121076460 GGATGGGGTGGCTGGCCAGGCGG - Intergenic
1103591394 12:121994041-121994063 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1104021312 12:124994087-124994109 GGCCGGGCGGGCAGCCCCGGAGG - Intronic
1104057142 12:125239228-125239250 GGATGAGTAGCCAGGCCAGGGGG + Intronic
1104712703 12:130996983-130997005 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1104778650 12:131405563-131405585 GGATGGGTGGGCAGGGTGGGTGG - Intergenic
1104857111 12:131907549-131907571 GGACCGGCTGGCAGCCCAGGTGG - Intronic
1104902141 12:132195227-132195249 TGGTGGGTGGGCACCCCAGCAGG + Intergenic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1105250964 13:18698142-18698164 GTAGGGGGGTGCAGCCCAGGGGG - Intergenic
1105932765 13:25068080-25068102 GGATGGGTAGGCAGCGCTGGTGG + Intergenic
1106114575 13:26806272-26806294 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1106413273 13:29525483-29525505 GGTTGGCTGGGCAGCCCATTTGG + Intronic
1106560099 13:30839575-30839597 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1106800872 13:33254823-33254845 GGATGGATGGGGAGCCAAAGAGG - Intronic
1106918769 13:34541082-34541104 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1107477617 13:40754739-40754761 GGATGGCTGGCCAGGCGAGGTGG + Intronic
1107864504 13:44690607-44690629 AGATGGGTGGGAAGTCAAGGAGG + Intergenic
1108274276 13:48791749-48791771 GGCTGGGTGGGCATCCAGGGAGG + Intergenic
1108351488 13:49593341-49593363 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1108525308 13:51281039-51281061 GAAAGGGAGGGAAGCCCAGGAGG - Exonic
1110617257 13:77554868-77554890 GGATGGCTGGTCACCCTAGGTGG - Intronic
1111418165 13:87976262-87976284 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1111418293 13:87976564-87976586 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1113127886 13:107000334-107000356 GGAAGGGTGAGCATTCCAGGTGG - Intergenic
1113404615 13:110026724-110026746 GGCTGGGGGTGCAGCCCTGGAGG - Intergenic
1113421165 13:110172576-110172598 GGATGGGTGCTGAGCCCAGAGGG - Intronic
1113611166 13:111645874-111645896 GGCTGGGTGGGGATCCCACGGGG - Intronic
1113784308 13:112994426-112994448 GGCTGGCAGGGCTGCCCAGGAGG + Intronic
1114266249 14:21074355-21074377 GGAGGGCTGGGAAGCCCTGGAGG - Exonic
1114427829 14:22637600-22637622 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1114428026 14:22638044-22638066 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1115484965 14:33901609-33901631 GCATGGGAGGGAAGCCTAGGGGG + Intergenic
1115609702 14:35039095-35039117 GGATGGGGCGGCTGGCCAGGTGG - Intergenic
1115703567 14:35977435-35977457 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1115739427 14:36372588-36372610 GGAGGGGTGGGGAGACCAGAAGG - Intergenic
1115939097 14:38589155-38589177 GGAGGGGTGGGCAGTACAGAGGG + Intergenic
1116435086 14:44887352-44887374 GTGTGGATGGGCAGGCCAGGAGG + Intergenic
1116734410 14:48671018-48671040 AGGTGGGTGGGAAGCCCTGGAGG - Intergenic
1116787355 14:49302292-49302314 GCAAGGATGGGCAACCCAGGTGG + Intergenic
1117317936 14:54592061-54592083 GGATGGGTGGGATGCACATGGGG - Intronic
1117553489 14:56859997-56860019 GGATTTGTGGGGAGCACAGGAGG - Intergenic
1118148665 14:63165809-63165831 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1118341040 14:64895372-64895394 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1118604042 14:67490070-67490092 GGATGGATGGACAGGCAAGGTGG + Intronic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1121450145 14:94001793-94001815 GGAGGGATGGGCACTCCAGGTGG + Intergenic
1122292562 14:100687497-100687519 GGGTGGGTGGAGAGGCCAGGAGG + Intergenic
1122540535 14:102495550-102495572 GGCTGGGTGGGGAGGCCGGGCGG + Intronic
1122815232 14:104308964-104308986 CCTTGGGTGGGCAGCCAAGGGGG - Intergenic
1122843057 14:104476090-104476112 GGAGGGGTTGGGAGTCCAGGGGG - Intronic
1122883813 14:104701767-104701789 GTGTGGGAGGGCCGCCCAGGCGG + Intronic
1122941518 14:104983496-104983518 GGAGGTGGGGGCAGCCCAGGTGG - Intergenic
1124270297 15:28274495-28274517 TGAGGGGTGGGAAGCCCAGCGGG - Intronic
1124438622 15:29671212-29671234 GGAAGGGTCCGGAGCCCAGGAGG - Intergenic
1124605047 15:31163394-31163416 GGATGGGTGGTCAGGGCAGGAGG - Intergenic
1125386389 15:39141387-39141409 GGGTGGGTGGGCAGAGCGGGGGG + Intergenic
1125721403 15:41846840-41846862 GGAAGGGTGGGCAGCCCACCAGG + Intronic
1125861630 15:43005343-43005365 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1127497079 15:59523414-59523436 GTTTGGGTGTGCAGCCGAGGTGG + Exonic
1127584461 15:60367085-60367107 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1127994783 15:64147169-64147191 GGAGGGGTGGACTGGCCAGGAGG - Intergenic
1128234768 15:66059935-66059957 GGAAGGTTGGGCAGCACAGAAGG + Intronic
1128587027 15:68859981-68860003 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1128666951 15:69545309-69545331 GGATGGGTGGAGGGCACAGGAGG - Intergenic
1128678064 15:69626313-69626335 GGTTGGGTGAGGAGCCCTGGAGG - Intergenic
1129260580 15:74365138-74365160 GGCTGGGAGGGGAGACCAGGAGG - Intronic
1129522858 15:76196707-76196729 GTGGGGGAGGGCAGCCCAGGAGG + Intronic
1129664730 15:77573224-77573246 GGAAGGGCAGGCGGCCCAGGTGG + Intergenic
1129721828 15:77881741-77881763 GGACGGGTGGGCAGGGGAGGGGG + Intergenic
1131832123 15:96360721-96360743 GCGTGGGTGGGCGGGCCAGGTGG - Intergenic
1132553329 16:562120-562142 GGGGCGGTGGACAGCCCAGGTGG + Intronic
1132678451 16:1130267-1130289 GGGAGGGTGCACAGCCCAGGAGG - Intergenic
1132858660 16:2058921-2058943 GGATGGGTGGGCAGGCGTGAGGG - Intronic
1132870997 16:2115734-2115756 GGCTGGGAGTGCTGCCCAGGTGG - Intronic
1132890058 16:2199389-2199411 GGATGGGGGGGCAGGGCAGGTGG + Intergenic
1132934578 16:2474207-2474229 GGACGGGGCGGCGGCCCAGGTGG - Intergenic
1132976009 16:2711562-2711584 GGGTGGGTGGGCAGGTCTGGGGG - Intergenic
1133281518 16:4668177-4668199 GGCAGGGTGGCCAACCCAGGCGG + Intronic
1133972886 16:10580109-10580131 AGAGGGGTACGCAGCCCAGGAGG + Intronic
1134136251 16:11678173-11678195 GGCTGGGTGGGCAGGACACGTGG + Exonic
1134219760 16:12344732-12344754 TGCTGGGCAGGCAGCCCAGGAGG - Intronic
1134438931 16:14286042-14286064 GGCTGGGTCTGCAGTCCAGGGGG - Intergenic
1135639543 16:24108955-24108977 GGATGGGGGGGCTGGCCGGGCGG + Intronic
1136083375 16:27867642-27867664 GGTTGGGTGGGGAACCCAGCAGG - Intronic
1136247129 16:28982476-28982498 GGAAGGGTGCAGAGCCCAGGAGG - Exonic
1136295259 16:29297987-29298009 GAATGGGTGGACAGACCAGATGG + Intergenic
1136777379 16:32879146-32879168 GGAGGGGAGGGCAGGCCGGGAGG + Intergenic
1136893246 16:33982367-33982389 GGAGGGGAGGGCAGGCCGGGAGG - Intergenic
1137408282 16:48207191-48207213 GGAAGAGATGGCAGCCCAGGAGG + Intronic
1137673208 16:50291327-50291349 GGATGGTGGGGCAGCTCTGGGGG + Intronic
1137811619 16:51358145-51358167 GGAAATGTGGGCAGCCCAGCAGG - Intergenic
1138085248 16:54127501-54127523 GGCTGAGCGGGGAGCCCAGGAGG - Intergenic
1138249797 16:55493073-55493095 GGTTGGGTGGGCACCCCTGGGGG + Intronic
1138270937 16:55695401-55695423 AGGTGGGTGGGCAGCCCACCTGG + Exonic
1139472913 16:67187721-67187743 GGATACGTGGGCACCCCTGGGGG - Exonic
1139504802 16:67393489-67393511 GGGTGGGACTGCAGCCCAGGCGG + Intronic
1139579158 16:67861945-67861967 GGAAGGGTGGGGATCGCAGGAGG + Intronic
1139678266 16:68539845-68539867 AGATGGATGGGATGCCCAGGAGG - Intronic
1139997619 16:70995737-70995759 GGAGGGGTGGGCAGCCCTGCAGG + Intronic
1140171955 16:72614730-72614752 ATATGGGTGAGCAGACCAGGAGG - Intergenic
1140994389 16:80244023-80244045 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1140994465 16:80244200-80244222 GGATGGGGGGGCTGGCCGGGCGG - Intergenic
1141623723 16:85250426-85250448 GGATGGCTGGTGAGCCCAGCTGG + Intergenic
1141673886 16:85507398-85507420 GGTGGGGAGGGCAGCCCAGAAGG + Intergenic
1142245037 16:88966469-88966491 GGTTTGGTGGTCACCCCAGGTGG - Intronic
1203079792 16_KI270728v1_random:1141255-1141277 GGAGGGGAGGGCAGGCCGGGAGG + Intergenic
1142472880 17:172894-172916 GGCTGGGTGCCCAGCTCAGGTGG - Intronic
1142634236 17:1247126-1247148 GGATGGGGGGGCTGGCCGGGCGG + Intergenic
1142672944 17:1495796-1495818 GGATGGGAGTGAATCCCAGGCGG - Exonic
1142704963 17:1689178-1689200 GGATGGGGGGGCTGGCCGGGCGG + Intergenic
1142805012 17:2366956-2366978 GGATGGGCTGGCAGCCCAGGAGG - Intronic
1142818748 17:2447818-2447840 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1143172002 17:4935764-4935786 TGGTGGGTGGCCAGCCCTGGAGG - Intergenic
1143210037 17:5179237-5179259 GGATGTGAGCGCATCCCAGGGGG - Intergenic
1143363981 17:6393666-6393688 GTGTGGGTGGTCAGCCCAGATGG - Intergenic
1143872303 17:9965816-9965838 GGATGGGTGGGCACAGGAGGTGG - Intronic
1144166280 17:12614022-12614044 AGAGGAGTGGGTAGCCCAGGTGG - Intergenic
1144495443 17:15742363-15742385 GGATTTCAGGGCAGCCCAGGGGG + Intronic
1145165960 17:20613729-20613751 CGGTGAGTGAGCAGCCCAGGTGG - Intergenic
1145208143 17:20995436-20995458 GGATTGCAGGGCAGCTCAGGAGG + Intergenic
1145240118 17:21236134-21236156 GGATGGGTGGGCAGATGAGTGGG - Intergenic
1145252433 17:21303975-21303997 GCATGGGAGAGCAGCCCAGCAGG - Intronic
1146216125 17:30979831-30979853 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1146444256 17:32922453-32922475 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1147339937 17:39747175-39747197 AGAAGTGGGGGCAGCCCAGGCGG + Exonic
1147491060 17:40866867-40866889 GGATTTGGGGGCAGCCCAGGAGG - Exonic
1147605542 17:41771998-41772020 GGATGGGGGGACTGCCCAGAAGG + Intronic
1147852458 17:43452583-43452605 GGATGGGGAGGCTGGCCAGGCGG - Intergenic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1147997957 17:44371608-44371630 GGATGGGAGGGCAGGTGAGGGGG - Intergenic
1148124056 17:45227979-45228001 GGAGGGGCTGGCAGTCCAGGTGG - Intronic
1148190909 17:45678061-45678083 GAGTGGGTAGGCAGCCCCGGGGG + Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148456008 17:47811744-47811766 GGAGGAGTGGGCAGCCTGGGGGG - Intronic
1148748576 17:49931839-49931861 GGAGGGGAGGGCAGCCCATCTGG - Intergenic
1149540122 17:57462364-57462386 GCAGGGGCTGGCAGCCCAGGAGG - Intronic
1149633076 17:58142721-58142743 GGATGGGGCGGCCGGCCAGGCGG - Intergenic
1149665245 17:58360704-58360726 GGAGGGGTGGGCAGGCCTAGGGG - Intronic
1150249627 17:63698753-63698775 GGCTGGGTTGGCAGGCGAGGCGG + Intronic
1150510916 17:65752309-65752331 GGATGGGTGGGCATCACTGCAGG + Intronic
1150767277 17:68012148-68012170 AGATGGGAGGTAAGCCCAGGAGG + Intergenic
1151202014 17:72475667-72475689 GGAGGGTTGAGCAACCCAGGAGG - Intergenic
1151245355 17:72790233-72790255 GGCTGGGGGGTCATCCCAGGGGG + Intronic
1151305973 17:73262829-73262851 GGAGAGGTGGGCAGCCCCGCAGG + Intergenic
1151684022 17:75636405-75636427 GGAAGGCAGGGAAGCCCAGGAGG - Intronic
1151715843 17:75830686-75830708 GGTTGGGCGTGCAGTCCAGGTGG - Intronic
1152696084 17:81797749-81797771 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1152699391 17:81811591-81811613 GGGTGGGTGGGCAGCCAGGCAGG + Intronic
1153525483 18:5991079-5991101 AGAGGGGTGGGCATTCCAGGAGG - Intronic
1154115237 18:11608721-11608743 GGATGGGGTGGCTGGCCAGGCGG - Intergenic
1154495907 18:14960885-14960907 GGATGGGTTGGGAGGCCATGTGG + Intergenic
1155785811 18:29898348-29898370 GCATGGATGGGGAGCCCAGCAGG + Intergenic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1157335355 18:46733714-46733736 TGATGAGGGGCCAGCCCAGGTGG + Intronic
1157572704 18:48723575-48723597 GGAGTGGTGGGCAGCTCAGGGGG + Intronic
1157639876 18:49202919-49202941 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1157677247 18:49577768-49577790 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1158091900 18:53724590-53724612 GGCTGGGTGGGCACCTCTGGAGG + Intergenic
1159794377 18:72823591-72823613 GGAGGTGTGGGCAGGGCAGGTGG + Intronic
1159844215 18:73439645-73439667 GTATGGGTGGGAAGCTCAGCAGG + Intergenic
1160416929 18:78718104-78718126 GGTGGGGTGGCCAGCCCAGCAGG - Intergenic
1161013016 19:1969216-1969238 GGGTGGGTGGGTGGCACAGGTGG - Intronic
1161730641 19:5958666-5958688 GGAGTGGGTGGCAGCCCAGGAGG + Intronic
1162647077 19:12057629-12057651 GGAGGGATGTGCAGCCCAGGAGG + Intergenic
1162806492 19:13140267-13140289 GGGTGGGGTGGCAGGCCAGGAGG - Exonic
1163158516 19:15451780-15451802 GGCAGGATGGGCAGCTCAGGTGG + Exonic
1163366802 19:16880025-16880047 GCGGGGGTGGGGAGCCCAGGAGG - Exonic
1163582992 19:18149357-18149379 AGATGGGCGGGCAGGCCAGCGGG - Exonic
1164066649 19:21721654-21721676 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1164106063 19:22107794-22107816 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1164526010 19:29014331-29014353 GGGAGGGTGGGTGGCCCAGGGGG - Intergenic
1164589065 19:29496164-29496186 GGAGGGGTGGGCAGGACTGGAGG + Intergenic
1164670443 19:30069286-30069308 GGCTGGGTGGGCAGGGTAGGGGG + Intergenic
1164845025 19:31424630-31424652 AAATGGGTGGGGAGCCCTGGTGG - Intergenic
1165434212 19:35787724-35787746 GGAAGGATGGGGGGCCCAGGGGG - Exonic
1165742539 19:38212251-38212273 GGAGAGGTGGGCATCCCATGGGG - Intronic
1165845177 19:38813275-38813297 GGACAGGTGGGCAGCGGAGGAGG + Exonic
1165902374 19:39174790-39174812 GTAGGGGAGGGCAGTCCAGGTGG + Intronic
1166197813 19:41218582-41218604 GGCTGGGTGGGCATCCATGGGGG - Intergenic
1166207399 19:41280509-41280531 GGATGGGGAAACAGCCCAGGAGG + Intronic
1166893396 19:46008311-46008333 GGAGGGGTGGGCAGCTGGGGCGG + Intronic
1167019443 19:46862499-46862521 GGATGGGTGACCAGCCCGGGAGG - Intergenic
1167970848 19:53187301-53187323 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1202686909 1_KI270712v1_random:56762-56784 GGCTGGTTTGGCTGCCCAGGTGG + Intergenic
925115177 2:1372528-1372550 GGATGGATGGGCAGCTTGGGTGG + Intergenic
925300970 2:2812240-2812262 GGGTGGCAGGGCAGCCCATGGGG - Intergenic
925361473 2:3283378-3283400 GGAGGGGTGGTCAGGGCAGGAGG - Intronic
925403318 2:3590732-3590754 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
926215322 2:10902601-10902623 GGATGGGGGGGCTGGCCGGGCGG + Intergenic
926222647 2:10946421-10946443 GGCATGGTGGGCACCCCAGGGGG - Intergenic
926739232 2:16097328-16097350 AGCTTGCTGGGCAGCCCAGGTGG + Intergenic
929492407 2:42408118-42408140 GCATGGGTGGGAAGCCAAGTGGG + Intronic
929739962 2:44589276-44589298 GGATGGGGCGGCTGGCCAGGCGG - Intronic
930691926 2:54373315-54373337 GAAGGCCTGGGCAGCCCAGGCGG - Intronic
932399029 2:71466824-71466846 GCATGGCTGGGCAGCCCCGGCGG - Exonic
932417916 2:71584776-71584798 TGAAGGCTGGGCAGCCAAGGAGG + Intronic
932794016 2:74679789-74679811 GGAGGGTGGGGCAGCCCATGTGG + Exonic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
934560304 2:95309842-95309864 GGCTGGGTGGTGACCCCAGGAGG - Intronic
936163911 2:110103872-110103894 GGATGCGGGGCCAGGCCAGGTGG + Intronic
936458364 2:112692873-112692895 GGCTGGGAGGACAGCACAGGAGG - Intergenic
937919505 2:127119857-127119879 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
938088877 2:128418750-128418772 GGACGGGTTGGCTGGCCAGGCGG + Intergenic
938692044 2:133800619-133800641 GCATGGCTGGGCAGCCCAAGAGG + Intergenic
939552356 2:143630984-143631006 GGATGGGAGTGCAGAGCAGGTGG - Intronic
940299312 2:152160889-152160911 GGATGGGGCGGCTGGCCAGGCGG - Intronic
940643571 2:156369071-156369093 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
940841430 2:158586308-158586330 GGATGGGTGGACAGGCCAAGGGG - Intronic
941768815 2:169327198-169327220 GGATGGGGCGGCTGGCCAGGCGG - Intronic
941769021 2:169327673-169327695 GGATGGGTCGGCTGGCCGGGAGG - Intronic
942754093 2:179319606-179319628 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
943043031 2:182825554-182825576 GGATGGTTGGGAGGCCAAGGTGG + Intergenic
945233036 2:207610807-207610829 GGATGGGGCGGCTGGCCAGGCGG - Exonic
945330159 2:208530040-208530062 GCATGGGCGGGAAGCCAAGGGGG - Intronic
945970305 2:216226420-216226442 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
946318204 2:218931738-218931760 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
946422559 2:219572695-219572717 GCATGGGTTTGCAGGCCAGGCGG + Intronic
947367989 2:229416435-229416457 GGATGGATGGGCAGCCAATGGGG + Intronic
948375292 2:237516967-237516989 GGATGGATGGGCAGCTAAGGTGG + Intronic
948375378 2:237517373-237517395 GGATGGATGGGCAGATAAGGTGG + Intronic
948809815 2:240468790-240468812 GGGTGGGTGGGCACCCCAGGAGG + Intergenic
948878239 2:240841489-240841511 AGATCTGGGGGCAGCCCAGGAGG + Intergenic
1169013797 20:2274524-2274546 AGCTGGCTGGCCAGCCCAGGAGG - Intergenic
1169085875 20:2824380-2824402 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1169247060 20:4033065-4033087 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1169303936 20:4471849-4471871 GGATTGGGGAGCAGCCCAGCAGG - Intergenic
1169844124 20:9971218-9971240 AGCTGGGTTGGCAGTCCAGGTGG + Intergenic
1170568165 20:17618203-17618225 CGATGGGTGGCCAGGCCAGGAGG + Intronic
1171366006 20:24625966-24625988 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1171861359 20:30405324-30405346 GGATGGGGTGGCTGGCCAGGTGG - Intergenic
1171899804 20:30846947-30846969 GGATGGGGTGGCTGGCCAGGTGG + Intergenic
1172028430 20:31965562-31965584 GGCTGGGTGGGAAAGCCAGGAGG + Intergenic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1172793578 20:37522561-37522583 GGATGGGCGGGCGGGGCAGGGGG + Intronic
1172870031 20:38130095-38130117 GGCAGGGTGGGCAGCCTATGGGG - Exonic
1173847260 20:46196054-46196076 GGCTGGGTGGGCAGACCCGATGG + Intronic
1173864614 20:46306348-46306370 GGAAAAGAGGGCAGCCCAGGTGG + Intronic
1174096297 20:48092361-48092383 CCAAGGATGGGCAGCCCAGGAGG + Intergenic
1174878424 20:54250762-54250784 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1175224899 20:57439276-57439298 GGGTGGGAGGGCAGGGCAGGGGG - Intergenic
1175437201 20:58961828-58961850 GGATGGATGTGCAGCCCAATCGG - Intergenic
1175739499 20:61410824-61410846 GGATGGATGGACAGACCAGTGGG - Intronic
1176009454 20:62884854-62884876 GGCTGGGTGGGCAGAGGAGGAGG + Intronic
1176348412 21:5770958-5770980 GGATGGGGTGGCTGGCCAGGCGG + Intergenic
1176355226 21:5891542-5891564 GGATGGGGTGGCTGGCCAGGCGG + Intergenic
1176496415 21:7553497-7553519 GGATGGGGTGGCTGGCCAGGCGG - Intergenic
1176512420 21:7758869-7758891 GTATGGGAGGGCAGCCTATGAGG - Intronic
1176542733 21:8169028-8169050 GGATGGGGTGGCTGGCCAGGCGG + Intergenic
1176561684 21:8352073-8352095 GGATGGGGTGGCTGGCCAGGCGG + Intergenic
1177178465 21:17720512-17720534 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1178075710 21:29011907-29011929 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1178409296 21:32350433-32350455 GAATGGGTTGGCAGCCCTGCCGG - Intronic
1178422768 21:32455555-32455577 GGATGGATGGCCAGGGCAGGTGG - Intronic
1178646532 21:34389393-34389415 GTATGGGAGGGCAGCCTATGAGG - Intronic
1178947343 21:36959356-36959378 GGATGGGAGGGAGGCCGAGGAGG + Intronic
1179177784 21:39021508-39021530 GGGTGGGTGGGCAGGGCTGGTGG + Intergenic
1179651442 21:42811797-42811819 GGAGGGGTGGGCAGCACGGAGGG - Intergenic
1179713118 21:43274380-43274402 GGAGGGGAGGGGAGCCCGGGAGG - Intergenic
1179779484 21:43690218-43690240 GTGTGTGTGGGCAGCACAGGAGG + Intronic
1180036385 21:45252500-45252522 GGAGCGGGGGGCAGCCCAAGCGG - Intergenic
1180119701 21:45738703-45738725 AGATGGGGGGGCTACCCAGGGGG - Intronic
1180553904 22:16560902-16560924 GGCTGGTTTGGCTGCCCAGGTGG - Intergenic
1180554938 22:16565744-16565766 GGTTGGTTTGGCTGCCCAGGTGG - Intergenic
1180555430 22:16567826-16567848 GGCTGGTTTGGCTGCCCAGGTGG - Intergenic
1180794196 22:18593986-18594008 GGGGGGATGGGCAGCCCAGCCGG - Intergenic
1180949138 22:19713443-19713465 GGACGGGTGGGGAGCAGAGGCGG + Intergenic
1181301501 22:21883892-21883914 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1181405303 22:22680303-22680325 GGATGCATGGGCAGCTCTGGGGG - Intergenic
1181485060 22:23225383-23225405 GGCAGGCTGGCCAGCCCAGGTGG + Intronic
1181586243 22:23854922-23854944 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1181586297 22:23855049-23855071 GGATGGGGCGGCTGGCCAGGTGG - Intergenic
1182069883 22:27456074-27456096 GGATGGGCTGGCAGCACAGGTGG + Intergenic
1182476752 22:30580729-30580751 GTGGGGGTGGGCAGCCCTGGTGG - Intronic
1183024998 22:35058371-35058393 GCATGGGAGGGAAGCCGAGGAGG - Intergenic
1183346665 22:37311958-37311980 GGCTGGGTGGGCCCTCCAGGAGG - Intronic
1183386770 22:37519453-37519475 GGAGGCCCGGGCAGCCCAGGAGG - Exonic
1183476092 22:38036580-38036602 GGAGGGGTGGGCAACCGGGGAGG + Intronic
1183648191 22:39138812-39138834 GGATTGGTGGGCAGGCCTGTGGG - Intronic
1183871566 22:40745206-40745228 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1184408589 22:44313791-44313813 GGATGGGTGGGAGGCAGAGGAGG - Intergenic
1184956243 22:47888537-47888559 GGTAGGGCGGGCAGCCCCGGGGG + Intergenic
1184980060 22:48089588-48089610 GGATGGGAGGGCAGCAGGGGTGG + Intergenic
1185046736 22:48532231-48532253 TGCTGGCTGGGCAGCCCTGGAGG - Intronic
1185128621 22:49025248-49025270 GGAGGGTTGGGCAGCCAATGGGG + Intergenic
1185320268 22:50197475-50197497 GGATGGGTCGGTCACCCAGGTGG - Exonic
1203247558 22_KI270733v1_random:85174-85196 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
950054376 3:10012857-10012879 GGACAGGTGGGAACCCCAGGAGG - Intergenic
950305563 3:11913304-11913326 GGACAGGTGGGAACCCCAGGAGG - Intergenic
950414025 3:12858142-12858164 GGATAGGTGGAAACCCCAGGAGG - Intronic
950414293 3:12859862-12859884 GGATAGGTGGGGACCTCAGGAGG - Intronic
950414574 3:12861605-12861627 GGACAGGTGGGGACCCCAGGAGG - Intronic
950414902 3:12863595-12863617 GGATAGGTGGGAACGCCAGGAGG - Intronic
950566437 3:13772378-13772400 GCAGGGCAGGGCAGCCCAGGGGG + Intergenic
951234483 3:20218591-20218613 GGATGGGTGGGCAGGCAACTTGG - Intergenic
952880882 3:37985709-37985731 GAATGGGCAGGAAGCCCAGGAGG + Intergenic
953406054 3:42660350-42660372 GGAGGAGGGGGCAGCCCAGCAGG + Intronic
953540137 3:43810916-43810938 GGATGGGCAGGCATTCCAGGTGG - Intergenic
953652644 3:44821052-44821074 GGATGGGGCGGCAGGCCGGGTGG + Intronic
953800310 3:46017882-46017904 GGAGGGAGGGGAAGCCCAGGAGG + Exonic
953882410 3:46697458-46697480 GGCTGGGTGGCATGCCCAGGAGG + Intergenic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
953931811 3:47009401-47009423 CCCGGGGTGGGCAGCCCAGGGGG + Exonic
954297625 3:49682965-49682987 GGATGGATGGGCAGCACACAGGG - Intronic
954399278 3:50311416-50311438 GGATGGGGCGGCTGGCCAGGCGG + Intronic
954399453 3:50311819-50311841 GGATGGGGCGGCTGGCCAGGCGG + Intronic
954409671 3:50364975-50364997 GCATGGGTGGGGAGTCAAGGAGG + Intronic
954637220 3:52077584-52077606 GGCTGGCTGGCCAGCACAGGGGG - Intronic
954716405 3:52528987-52529009 GGCTGGGTGGCCACCCCAGGGGG + Intronic
955427386 3:58806574-58806596 GGGTGGGAGGGCAGCCAAGACGG + Intronic
956792984 3:72694341-72694363 GGCAGGGTGGGCAGCCCAGCTGG + Intergenic
957316760 3:78583408-78583430 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
957383651 3:79467614-79467636 GGATGGGTGGTGAGCCCAAAAGG - Intronic
957730312 3:84125666-84125688 GGATGACAGGTCAGCCCAGGAGG + Intergenic
957892899 3:86382632-86382654 GTATGGGTGACTAGCCCAGGTGG + Intergenic
960534522 3:118802039-118802061 AGATGGGTGTGCAGCCAAGCAGG - Intergenic
961182320 3:124886842-124886864 GGAGGGGCGGGGAGCGCAGGCGG - Intronic
961434132 3:126904909-126904931 GGAAGGGTGGGGTGCCCTGGTGG + Intronic
961734030 3:128989398-128989420 GGTGGGGTGGGCCTCCCAGGGGG + Intronic
962754058 3:138455041-138455063 AGATGGGTGGGCAGGCAAGCAGG + Intronic
963244429 3:143047020-143047042 GGATGGGGCGGCTGGCCAGGCGG + Intronic
963736277 3:149020864-149020886 GGAGGGGTGGGCGTCCGAGGAGG + Intronic
963911475 3:150820721-150820743 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
964339831 3:155696963-155696985 GGATGTATGGGAAGCCCAGGTGG - Intronic
965342903 3:167512070-167512092 GAATGGGTGTGCTGCCCTGGCGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967137057 3:186521500-186521522 GTCTGTGTGGGCAGCCCTGGGGG + Intergenic
967177656 3:186874405-186874427 GGATGGGGCGGCTGGCCAGGTGG - Intergenic
967200185 3:187066064-187066086 GGATGGGTTGGCAGGGCGGGTGG + Intronic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
968411682 4:395839-395861 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
968460226 4:721067-721089 TCATGGGTGCCCAGCCCAGGTGG - Intronic
968581986 4:1399448-1399470 GCATGGGTGGGGAGCACAGGGGG + Intergenic
968737574 4:2305198-2305220 GGAGCGGAGGGCAGCCCAGGCGG - Exonic
968995236 4:3941233-3941255 GGGTGCGAGGGGAGCCCAGGTGG + Intergenic
969354706 4:6618636-6618658 GGGAGCGTGGGCAGGCCAGGTGG - Intronic
969374799 4:6756001-6756023 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
969404215 4:6978083-6978105 GGATGGGGCGGCTGGCCAGGCGG - Intronic
969690679 4:8702480-8702502 GGACAGGTGGGGACCCCAGGAGG + Intergenic
970291837 4:14581583-14581605 GAATGGGTGGGTGGGCCAGGTGG - Intergenic
970472584 4:16393183-16393205 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
971514672 4:27471390-27471412 GGATAGATGGGCAGCTCATGAGG + Intergenic
972939816 4:44182181-44182203 GGACGGGTCGGCCGGCCAGGCGG - Intronic
974076668 4:57173479-57173501 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
974596281 4:64017361-64017383 AGATGGATGGGCAGGCCAGAAGG + Intergenic
975042536 4:69762331-69762353 GGATGGGGCGGCTGGCCAGGCGG - Intronic
975321944 4:73018748-73018770 AGATTGATGGGCAGCCCTGGTGG + Intergenic
975608715 4:76182572-76182594 GGAGGTGTGGGTAGCCCAGCTGG - Intronic
975655735 4:76639508-76639530 GGAGAGGAGGGCAGCCCAGAGGG - Intronic
975685996 4:76917812-76917834 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
976858242 4:89629929-89629951 GGAGGGGTGGGCAGCCATGTGGG + Intergenic
977060755 4:92254749-92254771 GGAGGGATGGCCTGCCCAGGAGG + Intergenic
980982945 4:139669640-139669662 GGCTGGGTGGGCATCACAGGGGG + Intronic
982055598 4:151546040-151546062 GGGTGGGTGGGCAGACTAGTGGG + Intronic
982784487 4:159523947-159523969 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
983835689 4:172380467-172380489 AGATGGCTGGGCTGCCCAGCAGG - Intronic
984004870 4:174295003-174295025 GGATGGGACGGCTGGCCAGGCGG + Intronic
984562233 4:181284142-181284164 AGATGGGTGGGCAGATGAGGAGG + Intergenic
984804028 4:183736481-183736503 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
984825907 4:183924418-183924440 GGAGGGGCAGGCAGCCCAGCAGG + Intronic
985547113 5:515291-515313 GGAGGGGCGGGCAGAGCAGGAGG - Intronic
985575895 5:673402-673424 GGAGGTGGGGGCAGCCCTGGGGG + Intronic
985576377 5:675258-675280 GGCCGGGGGTGCAGCCCAGGGGG + Intronic
985736544 5:1586472-1586494 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
986064466 5:4222287-4222309 GGGAGGGTGGGCACACCAGGCGG - Intergenic
986536468 5:8793388-8793410 GGATGGCTGGGCAGTGCAAGAGG + Intergenic
989021456 5:37013270-37013292 GGATGGGGCGGCTGGCCAGGCGG + Intronic
989667633 5:43874613-43874635 GGATGGGTGGGGACCAGAGGCGG + Intergenic
991907100 5:71525237-71525259 GGATGGGGTGGCTGGCCAGGCGG + Intronic
992076739 5:73198789-73198811 GACTGGGTGGGGAGCCCAGAAGG + Intergenic
992100340 5:73401588-73401610 GGACTAGTGGGAAGCCCAGGTGG - Intergenic
992978126 5:82139905-82139927 GGATGGGGCGGCTGGCCAGGCGG - Intronic
993447087 5:88026883-88026905 GGATGGTTGAGCAGCCCAATGGG - Intergenic
993904109 5:93604273-93604295 GGAGGGGCGGCCAGCCCGGGGGG + Intergenic
995742378 5:115368685-115368707 GCATGGGAGGGAAGCCGAGGAGG + Intergenic
997228396 5:132226693-132226715 GTATTGCTGGACAGCCCAGGTGG - Exonic
997303737 5:132824189-132824211 GGATTGGTGGTCAGTCCAGTGGG + Exonic
997787779 5:136729182-136729204 CAATGTGTGGGAAGCCCAGGAGG + Intergenic
997813318 5:136993282-136993304 GGATGGGTGGGCAGGTGAGTAGG + Intronic
997850961 5:137332178-137332200 GGAAGGGTGGGGATCCCAGGAGG - Intronic
997872401 5:137517111-137517133 TGATGGGAGGCCAGCTCAGGAGG + Intronic
998130822 5:139650293-139650315 GGATGGGGGGGGAGCTAAGGGGG + Intronic
998432156 5:142076413-142076435 GGATGGGGCGGCTGGCCAGGGGG + Intergenic
999770321 5:154770577-154770599 GGTTGGGAGGGCAGTCCAGGAGG + Intronic
1000159279 5:158582903-158582925 GGATGGGGTGGCTGGCCAGGAGG - Intergenic
1001066203 5:168536811-168536833 GGATGGGTGGACAGGCAAAGGGG - Intergenic
1001131974 5:169071842-169071864 GGATGAGTGGGCAGGGCAGAGGG + Intronic
1002070623 5:176677148-176677170 GGAAGTGGGGGCAGCCCTGGGGG - Intergenic
1002542058 5:179912973-179912995 GGATGGGTGGGGAACTGAGGAGG + Intronic
1002607055 5:180389736-180389758 GGACGGCTGTGCAGCCCAGGAGG + Intergenic
1002633626 5:180596553-180596575 GGACCGGTGGGCAGCCCTGGTGG + Intergenic
1002875005 6:1202748-1202770 GGAAGGGTGAGCAGCCCATCTGG - Intergenic
1002950907 6:1810240-1810262 GGATAGGTGGGCAGGACAAGTGG + Intronic
1004727823 6:18327680-18327702 GGGAGAGTGGGGAGCCCAGGGGG + Intergenic
1004850498 6:19693699-19693721 GGATGGGTGGGGAGACAAAGAGG + Intergenic
1005069623 6:21851598-21851620 GGATGGGGCGGCTGGCCAGGTGG + Intergenic
1005158808 6:22836667-22836689 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1005158860 6:22836795-22836817 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1005159059 6:22837271-22837293 GGATGGGGTGGCTGGCCAGGTGG - Intergenic
1006010753 6:31041114-31041136 GGAAGGGCCGGGAGCCCAGGTGG - Intergenic
1006093495 6:31641982-31642004 TTGTGGGTGGGCAGGCCAGGTGG - Intronic
1006165590 6:32062499-32062521 GAATGGGTGGGCATGCCTGGTGG + Intronic
1006415660 6:33902390-33902412 GGAGTGGTGGGAAGCCAAGGCGG + Intergenic
1006438004 6:34036381-34036403 GGATGGGCCGGCAGCCCGTGCGG + Exonic
1006516266 6:34547248-34547270 GGATGAATGGGCAGGGCAGGTGG + Intronic
1006742610 6:36320277-36320299 GAATGGGAAGGCGGCCCAGGGGG + Intronic
1006946127 6:37785514-37785536 GGCTGGGTGGGCTGCCAAGCCGG + Intergenic
1007229561 6:40338815-40338837 GGAAGAGTGGGCAGAGCAGGAGG - Intergenic
1007553518 6:42747172-42747194 GTGTGGGTGGGCAGCCAAGACGG + Intronic
1008389799 6:50936808-50936830 GGATGGGAGGGGAGCACAGAAGG + Intergenic
1008926460 6:56894828-56894850 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1010198478 6:73263119-73263141 GGTCGGGTGCGCGGCCCAGGAGG - Exonic
1013286823 6:108689272-108689294 GGATGGGAGGGAGGCTCAGGAGG + Intergenic
1015476698 6:133664897-133664919 GGATGGGGCGGCTGGCCAGGTGG - Intergenic
1015796054 6:137012445-137012467 GGATGGGGAGGCAGAGCAGGAGG + Intronic
1016942313 6:149492934-149492956 GGATGGGTTGGCAGGCCATGGGG + Intergenic
1017043276 6:150324791-150324813 AGAGGTGTGGGCAGGCCAGGAGG + Intergenic
1018185783 6:161264543-161264565 GGATGCGCGGGCACGCCAGGGGG - Intronic
1018754549 6:166837697-166837719 TGAAGGGTGGGGAGCCCGGGAGG - Intronic
1018914458 6:168124615-168124637 GGATGGGGGGGCAGGTGAGGGGG - Intergenic
1019064239 6:169282512-169282534 GAATGGCTGGGTAGCTCAGGAGG - Intergenic
1019458929 7:1146683-1146705 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1019487431 7:1295868-1295890 GGCTGGGTGGGTGGCCCAGGGGG - Intergenic
1019635379 7:2072807-2072829 GGATGGCTGGGCAGCCTTGAAGG + Intronic
1019669038 7:2268130-2268152 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1019706618 7:2500014-2500036 GGGTGGGTGGGGTGGCCAGGGGG - Intergenic
1019714874 7:2534173-2534195 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1019828296 7:3301529-3301551 GGACGGGCGGGCAGGACAGGCGG - Exonic
1022663478 7:32387603-32387625 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1023594513 7:41814939-41814961 AGAAAGGAGGGCAGCCCAGGGGG + Intergenic
1023677528 7:42646183-42646205 TGCTGGGTGGACAGCCCAGCAGG + Intergenic
1025103256 7:56151469-56151491 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1025103432 7:56151871-56151893 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1025850372 7:65239260-65239282 TGATGGGTGTGCACCCCATGGGG + Intergenic
1025853030 7:65258660-65258682 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1025853214 7:65259061-65259083 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1025979335 7:66393851-66393873 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1026783279 7:73284119-73284141 GGACGGGGCGGCTGCCCAGGCGG + Intergenic
1026839108 7:73659006-73659028 GGCTGGGTGGGCAGGCTTGGGGG + Intergenic
1026868509 7:73836674-73836696 GGATGGGGGGGCTGGCCGGGCGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1031124398 7:117756875-117756897 AGGTAGGTGGGCATCCCAGGGGG - Intronic
1031484439 7:122310710-122310732 GGATGGGTTGCCAGACCAGCTGG - Intergenic
1032085950 7:128884047-128884069 GGCTGGGGGGGCAGCCCACCAGG + Exonic
1032824260 7:135553876-135553898 GGAAGGAAGGGCAGTCCAGGAGG + Intergenic
1033621160 7:143063032-143063054 TGATGGTTGGGTAGCGCAGGGGG + Intergenic
1034265300 7:149777792-149777814 TGTTAGGTGGACAGCCCAGGTGG - Intergenic
1034330687 7:150279673-150279695 GGGTGGGTGGACAGGCCAGGTGG - Intronic
1034638646 7:152585955-152585977 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1034667356 7:152830176-152830198 GGGTGGGTGGACAGGCCAGGTGG + Intronic
1034949435 7:155287152-155287174 GGAGGGGTAGGCAGGGCAGGGGG - Intergenic
1035354993 7:158271088-158271110 GGTGGAGGGGGCAGCCCAGGTGG - Intronic
1035465137 7:159070051-159070073 TGCTGAGTGGGCAGCCCTGGAGG - Intronic
1035663948 8:1366461-1366483 GAAGTGGGGGGCAGCCCAGGAGG + Intergenic
1035781944 8:2234436-2234458 GGAAGCGTGGGAAGCTCAGGCGG + Intergenic
1035810175 8:2484979-2485001 GGAAGCGTGGGAAGCTCAGGCGG - Intergenic
1035920270 8:3668711-3668733 GGATGAGTTGGGAGCTCAGGAGG + Intronic
1036735926 8:11316665-11316687 GAATGGGTGACCAGCCTAGGGGG - Exonic
1037920517 8:22802294-22802316 GGATGGGTGGGAAGGCCCAGGGG - Intronic
1038239774 8:25797747-25797769 GGATGGGAGGGCATTGCAGGAGG + Intergenic
1038296022 8:26291647-26291669 GGAGGGGCGGGCAGACCAGCCGG - Intronic
1038481097 8:27902315-27902337 GGATGGGTGGGGAGGCGTGGGGG - Intronic
1039442851 8:37607552-37607574 GGGTGGGTTGCGAGCCCAGGGGG - Intergenic
1040069750 8:43179684-43179706 GGATGGGGCGGCTGGCCAGGTGG + Intronic
1040069804 8:43179811-43179833 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1041757974 8:61334709-61334731 GGAGGGGTGGGCAGCTGAGCTGG + Intronic
1042352698 8:67793902-67793924 GGCTGTGTGGGCAGCCCGGATGG + Intergenic
1042858990 8:73294851-73294873 GGAGGGGTGCGCAGCGGAGGCGG - Exonic
1042871143 8:73400810-73400832 GGTTGTGTGGAGAGCCCAGGAGG - Intergenic
1045647823 8:104316553-104316575 GCATGGGTGGGGAGCACAGGTGG + Intergenic
1047267083 8:123315975-123315997 GGATGGGGGGGCTGGCCGGGCGG - Intergenic
1047312367 8:123703340-123703362 GGGTGGGTGGGCTGCCTAGGGGG + Intronic
1048179233 8:132180108-132180130 AGGTGGGTGGGAAGCCCATGTGG + Intronic
1048282657 8:133116500-133116522 GGGTGGGTTGGGGGCCCAGGGGG + Intronic
1049236618 8:141515361-141515383 GGATGGGTGGGCAGATGAGTGGG - Intronic
1049244908 8:141557251-141557273 GGAAGGGAGGGCAGCCCATTGGG + Intergenic
1049248709 8:141576832-141576854 GGCTGGGTGGGCAGTCAGGGCGG + Intergenic
1049288745 8:141790699-141790721 GGCTGGGTGGGCAGGCCGAGTGG + Intergenic
1049358262 8:142199363-142199385 GGAAGTGTGGGCAGCCCAGGGGG - Intergenic
1049374300 8:142281714-142281736 GGGTGGGTGAGCAACCAAGGCGG + Intronic
1049400460 8:142424468-142424490 GGCTGGCTGGGCAGGACAGGTGG + Intergenic
1049471620 8:142777383-142777405 GGCTTGGTGAGTAGCCCAGGAGG - Intronic
1049531800 8:143158979-143159001 GGATGGGTGGGGGGCGCAGGGGG - Intronic
1049541083 8:143209324-143209346 GGGTGGGCGGGCCGGCCAGGGGG - Intergenic
1049660705 8:143818604-143818626 GGCTGGGTGGGTGGGCCAGGAGG - Intronic
1049675278 8:143886391-143886413 GGGTGGGTAGGCAGGCCGGGCGG + Intergenic
1050873985 9:10612922-10612944 GGCTGGGCGGGGAGCCGAGGCGG + Intergenic
1051396098 9:16622718-16622740 AGGTGGGTGGCCAGGCCAGGAGG + Intronic
1051524949 9:18032501-18032523 GGAGGGGTTGGCAGACAAGGGGG + Intergenic
1052492594 9:29188676-29188698 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1052840627 9:33289124-33289146 GGGTGGGGTGGCAGGCCAGGAGG - Intergenic
1053282021 9:36826651-36826673 GGATTGGTGGGCAGCCCCCTAGG - Intergenic
1055137408 9:72841256-72841278 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1055586160 9:77761289-77761311 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1055586407 9:77761865-77761887 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1055586508 9:77762089-77762111 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1055586660 9:77762440-77762462 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1056592021 9:87971589-87971611 GGCTGGGTGGGCGGACCAGATGG - Intronic
1057181144 9:93031139-93031161 GGATGGATGGGCAGGCAAGTGGG + Intronic
1057192728 9:93096395-93096417 GGATGGGTGGCCCGGCCCGGGGG + Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1057277747 9:93684969-93684991 GGAAGGGTGGGCTGCCAAAGGGG + Intergenic
1057440924 9:95082673-95082695 GGATAGGTCCTCAGCCCAGGTGG + Exonic
1057551254 9:96052552-96052574 GGGTGGGTGGGCAGACAAGTGGG - Intergenic
1059376730 9:113887720-113887742 AGGTGGGTGAGCGGCCCAGGCGG + Intronic
1059456220 9:114402007-114402029 GGAGGGGTGGGCAGGACAGGTGG - Intergenic
1060350287 9:122852773-122852795 GGATGGGGCGGCTGGCCAGGCGG - Intronic
1060531592 9:124350137-124350159 GGAGGGGTGGTCAGCCCCGCAGG - Intronic
1060941627 9:127545982-127546004 CGCTGGGAGGGCAGCCCAGGGGG + Intronic
1061396048 9:130343763-130343785 GGAGGCCGGGGCAGCCCAGGCGG - Intronic
1061399555 9:130360947-130360969 GGATGGGTGGGCAGACAGGTGGG - Intronic
1061521383 9:131120328-131120350 GGAAGGCTGGGGAGTCCAGGCGG - Exonic
1061810042 9:133156994-133157016 GAACTGGTGGCCAGCCCAGGTGG + Intronic
1061888068 9:133603006-133603028 GGAGGGGGGGCCAGCCCAAGAGG + Intergenic
1061937486 9:133866159-133866181 GGGTGGGTGGGGAGCCAAGCTGG + Intronic
1062446558 9:136597714-136597736 GGAAGGGTGGAGGGCCCAGGTGG + Intergenic
1203463964 Un_GL000220v1:68409-68431 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1188367573 X:29333555-29333577 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1189210461 X:39278275-39278297 GGATGGGGCGGCTGGCCAGGAGG - Intergenic
1189259874 X:39670688-39670710 GGAGGCTTGGGCAGCCCAGGTGG + Intergenic
1189837636 X:45040470-45040492 GGATGGGGCGGCTGGCCAGGCGG + Intronic
1191068949 X:56380217-56380239 GGATGGGGTGGCTGGCCAGGTGG + Intergenic
1191179168 X:57540932-57540954 GAATTGGTGGGAACCCCAGGAGG - Intergenic
1191894199 X:65975356-65975378 GGATGGGTTGGCTGGCCGGGCGG + Intergenic
1192149879 X:68705610-68705632 GGGAGGGTGGGCTGCCCAGAGGG + Intronic
1192352814 X:70371627-70371649 GGATGGGGCGGCTGGCCAGGTGG + Intronic
1192530198 X:71876892-71876914 GGATGGGGCGGCTGGCCAGGCGG + Intergenic
1192567780 X:72178926-72178948 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1192682523 X:73266918-73266940 GGCTAGATGGGCAGACCAGGAGG + Intergenic
1194991862 X:100555493-100555515 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1195888982 X:109671423-109671445 GGATGGGGTGGCTGGCCAGGCGG - Intronic
1197455788 X:126674278-126674300 GGATGGGGCGGCTGGCCAGGCGG - Intergenic
1198600768 X:138282696-138282718 GGATGGGGTGGCTGGCCAGGTGG + Intergenic
1199979932 X:152915279-152915301 GGAGGGGTGGGCAGTCCACAGGG + Intronic
1200138480 X:153886079-153886101 GGCTGGGCGGGCAGCCCGAGCGG - Exonic