ID: 1057216434

View in Genome Browser
Species Human (GRCh38)
Location 9:93231316-93231338
Sequence TATCCCAGCCCAAGTGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057216434_1057216444 28 Left 1057216434 9:93231316-93231338 CCCAGACCACTTGGGCTGGGATA 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1057216444 9:93231367-93231389 GCCCCTGCCTTGTCCGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057216434 Original CRISPR TATCCCAGCCCAAGTGGTCT GGG (reversed) Intronic
900340329 1:2185589-2185611 TGTCCCAGCCGCTGTGGTCTAGG + Intronic
905853308 1:41290303-41290325 AATCCCAGCCCCATGGGTCTAGG + Intergenic
906609155 1:47190166-47190188 AATGCCAGCCCAAGTGAGCTGGG - Intronic
907435251 1:54441643-54441665 TAACCCAGTCCAAGTGGAGTGGG + Intergenic
910420388 1:87055130-87055152 TATCCAAGCCTAACAGGTCTAGG - Intronic
911673046 1:100628872-100628894 TCTCCCAGCCCTAGTGAACTCGG + Intergenic
916520650 1:165560875-165560897 AATGCCAGGCCAAATGGTCTGGG + Intronic
917124032 1:171670387-171670409 TACCCCAGCCCATGTGGTTTTGG + Intergenic
920600263 1:207317917-207317939 TATCACAACCAAAGTGGTATGGG - Intergenic
922254965 1:223885786-223885808 TATTGCAGCACAAGTGGACTAGG - Intergenic
1063981700 10:11457727-11457749 GATCCCAGCCCAAGAGGTTCAGG - Intronic
1069460378 10:68589594-68589616 TAGCCCAGCCTTAGTGCTCTGGG + Intronic
1071398841 10:85249698-85249720 TATAGCAGCCCAAATGGGCTAGG - Intergenic
1073977500 10:109117804-109117826 TGTGCCAGCCAGAGTGGTCTTGG - Intergenic
1076152668 10:128175346-128175368 TATGCCAGCACATGTGGCCTGGG + Intergenic
1077336075 11:2005183-2005205 CATCCCCACCCAAGTGCTCTGGG - Intergenic
1084749229 11:71193255-71193277 AATCCCAGCCCATGGGTTCTGGG + Intronic
1085026750 11:73240774-73240796 GATAGCAGCCCAAGTGGTGTGGG + Intergenic
1085529588 11:77183592-77183614 TGTCCCAGCCCTTGTGCTCTGGG + Intronic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088362713 11:109007774-109007796 CATTCCAGCCCAGGTGGTCATGG - Intergenic
1088944994 11:114502990-114503012 TCTCCCAGATAAAGTGGTCTTGG + Intergenic
1089305788 11:117525276-117525298 AATCCCAGTCAAAGTTGTCTGGG - Intronic
1202819059 11_KI270721v1_random:60365-60387 CATCCCCACCCAAGTGCTCTGGG - Intergenic
1093770651 12:23013840-23013862 TATAGCAGCCCAAATGGACTAGG - Intergenic
1096958105 12:55547257-55547279 CATCACAGGCCAAGAGGTCTAGG - Intergenic
1097057248 12:56257629-56257651 ATTCCCAGCCCAAGTGATCTGGG + Intronic
1098576655 12:72050417-72050439 TATGACAGCCCAGTTGGTCTCGG - Intronic
1100148394 12:91705798-91705820 TATGCCAGCCCAAAGTGTCTGGG - Intergenic
1103393645 12:120591658-120591680 TAACTCAGCCCAGGTGGTCAGGG + Intergenic
1104487021 12:129160274-129160296 TATTCCAGCCCACTTGGCCTGGG - Intronic
1107338192 13:39378479-39378501 TGTCCCAGCCCAAGGGGTAGAGG + Exonic
1114658325 14:24329366-24329388 TAGGCCAGCCCATGGGGTCTGGG + Intronic
1115068469 14:29294393-29294415 CATCACAGCCCAAGAGGCCTAGG + Intergenic
1115889626 14:38012202-38012224 TATCACAGGCCTAGTGGCCTAGG + Intronic
1116664220 14:47754343-47754365 TGTCCCAACCCAGCTGGTCTCGG - Intergenic
1117965353 14:61202163-61202185 ATTCCTAGCCCCAGTGGTCTTGG + Intronic
1122070545 14:99202935-99202957 CCTCACAGCCCAAGTGCTCTGGG + Intronic
1123930170 15:25164922-25164944 TATCCCAGCCCAAATGGTGAGGG + Intergenic
1124209207 15:27748260-27748282 TTTCCCAGCCCAGGTAGTTTGGG - Intergenic
1124887313 15:33699159-33699181 TATCAAAGCCCAAGTGCCCTGGG - Intronic
1125551635 15:40549482-40549504 TACCCCACTCCAACTGGTCTAGG + Intronic
1132738661 16:1399771-1399793 CCTCCCAGCCCTGGTGGTCTCGG - Intronic
1133006166 16:2883015-2883037 TATCCCAGCACCAGTGGGTTGGG - Intergenic
1133406819 16:5531151-5531173 AATCACAGTCCAGGTGGTCTGGG + Intergenic
1134909225 16:18009159-18009181 TCTCCCTGCTCATGTGGTCTTGG - Intergenic
1136011820 16:27368371-27368393 TCTCCCAGGCCAAGTTTTCTGGG - Intergenic
1139295621 16:65897943-65897965 TATCCCAGCCCAAGAGGTCAAGG - Intergenic
1144848129 17:18230636-18230658 AATCCCACCCCAACTGCTCTTGG + Intronic
1145052396 17:19673089-19673111 TATCCCAGCCTTAGTGGAATTGG + Intronic
1146680018 17:34800345-34800367 TCTCCCAGGCCCAGTGGTCAGGG + Intergenic
1146904925 17:36612184-36612206 TTTCCCTGTCCCAGTGGTCTGGG + Intergenic
1149756493 17:59190810-59190832 TAACCCAGGCCAAGTTCTCTTGG - Intronic
1160147518 18:76377190-76377212 TCTCCCCGCCCATGTGCTCTGGG - Intronic
1161749445 19:6083997-6084019 TCTCCCTGCCCAAGAGGTCTGGG - Intronic
1161795935 19:6386905-6386927 CATCCAAGACCAAGTGCTCTGGG + Intronic
1163188069 19:15653560-15653582 CATCCCTGCCCACGTGGGCTGGG - Intronic
1163221038 19:15921418-15921440 CATCCCTGCCCATGTGGGCTGGG + Intronic
1163764058 19:19152759-19152781 GACCCCTGCCCAAGCGGTCTGGG + Intronic
1166305761 19:41936136-41936158 AGCCCCAGCCCTAGTGGTCTGGG + Intergenic
1166718689 19:44985362-44985384 GATGACAGCCCCAGTGGTCTGGG - Intronic
925117724 2:1394589-1394611 AATCCCAGCCCCACTGGCCTGGG - Intronic
931189344 2:59984676-59984698 GACTCCAGCCCAACTGGTCTGGG - Intergenic
932222022 2:70006855-70006877 TATACCAGCACAAGTGCTCGGGG + Intergenic
933281318 2:80335565-80335587 TTTTCCAGACCAATTGGTCTGGG + Intronic
937004433 2:118498219-118498241 CATCCCAGGCCATGTGGCCTCGG - Intergenic
937356039 2:121198855-121198877 CATCCCAGCCTCAGGGGTCTGGG - Intergenic
937791418 2:125966731-125966753 TTTCCAACACCAAGTGGTCTTGG + Intergenic
939060680 2:137418375-137418397 TATCCCATTCTAAGGGGTCTGGG - Intronic
940282317 2:152000789-152000811 TGTCCCAGCCCAAGAGGTCAGGG - Intronic
943172491 2:184420899-184420921 TATCACAGCTTAAGTGGACTGGG + Intergenic
946884628 2:224210712-224210734 TATCCCAGGGCAAGAGGTCATGG + Intergenic
948873673 2:240816625-240816647 AATCCCAGGCCTTGTGGTCTGGG - Intronic
1169831561 20:9831038-9831060 TATCCCATGCCCAGTGGGCTGGG + Intronic
1170300643 20:14880936-14880958 TATCCCTGCCTGAGTGGTCCTGG + Intronic
1171142914 20:22758442-22758464 TTTCCCATCTCAAGTGGTCCTGG + Intergenic
1172530487 20:35627484-35627506 CATCCCAGCCCAGGAGATCTCGG + Intronic
1173098440 20:40060908-40060930 TATCACAGACCCAGAGGTCTAGG + Intergenic
1173126985 20:40346190-40346212 TAGCCCAGCCCCAGTGGTGGTGG + Intergenic
1173683863 20:44909441-44909463 TATCCCAGGAAAAGGGGTCTTGG + Intergenic
1173716620 20:45212657-45212679 GATCACAGCCCAAGTGCTCAGGG + Intergenic
1174684540 20:52441077-52441099 TATTCCAAGCCAAGTGATCTTGG - Intergenic
1174930351 20:54806774-54806796 TTTTCCATCCCAAGTGCTCTTGG + Intergenic
1175392003 20:58633369-58633391 TTTTCCAGCCAAAGTGGCCTTGG - Intergenic
1177319283 21:19499560-19499582 TATCTCAGCCCAAGTGGTAATGG - Intergenic
1178812530 21:35897112-35897134 TATCCCAGTCAATGTGTTCTGGG - Intronic
1179566598 21:42252870-42252892 CATCCCCGCCCAGGTGGTGTTGG + Intronic
1182262688 22:29086498-29086520 TATCACAGCCTCAGTGGTGTTGG + Intronic
1182271682 22:29157767-29157789 TCTCCCAGCCCAAGGGCTCAGGG - Intronic
1183661427 22:39223870-39223892 GATCCCACCCCAGGGGGTCTTGG + Exonic
1184905935 22:47486729-47486751 CAGCCCAGGCCAAGTGGTCTAGG - Exonic
949102907 3:167420-167442 GAGCCCAGCCCAAGTGGCCTAGG - Intergenic
954450955 3:50571504-50571526 TATCTCTGCCTAAGTGTTCTGGG + Intronic
955409754 3:58647821-58647843 AATCCCTGCCCCAGTGCTCTTGG - Intronic
958793318 3:98678693-98678715 TAACTCAGCCCAAGAGGTCAAGG - Intergenic
960154854 3:114289741-114289763 TATCCCAGTCCTAGTTGTCTTGG + Intronic
960191477 3:114711614-114711636 TTTCCCAGCCCAACTGGTCCTGG + Intronic
963801990 3:149685287-149685309 TATCCCAGCCCCAGCTTTCTTGG - Intronic
963974551 3:151466482-151466504 TATCTCAGTCCAAGGAGTCTGGG + Intergenic
968625447 4:1624861-1624883 TGTCCCGGCCCACGTGGTCAGGG + Intronic
968625489 4:1625010-1625032 CGTCCCAGCCCACGTGGTCAGGG + Intronic
968625545 4:1625208-1625230 CGTCCCAGCCCACGTGGTCAGGG + Intronic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971535467 4:27743024-27743046 TTTCCCAGCCCAGCTGGGCTGGG + Intergenic
972102934 4:35445487-35445509 TATCACAGGCCCAGAGGTCTAGG + Intergenic
972328049 4:38036702-38036724 TACACCAGCCCAAGTGTTCAGGG - Intronic
972457975 4:39272732-39272754 GAACCCATACCAAGTGGTCTAGG + Intronic
973571167 4:52241261-52241283 TACAGCAGCCCAAGTGGACTAGG - Intergenic
976184498 4:82430574-82430596 TTTTCCTGCCCACGTGGTCTCGG + Exonic
977112672 4:92978821-92978843 TGTTGCAGCCCAACTGGTCTCGG - Intronic
977885913 4:102251436-102251458 TTTCCCAGGCCTGGTGGTCTGGG + Intronic
980525730 4:133989118-133989140 TATCACAGCCCTAGAGGCCTAGG - Intergenic
982952847 4:161721687-161721709 TATCCTAGCCCATGAGGTCAAGG - Intronic
983972552 4:173892765-173892787 TATCCCAACCGAGCTGGTCTTGG - Intergenic
990264506 5:54061092-54061114 TATCACAGGCCCAGAGGTCTAGG + Intronic
993275413 5:85850559-85850581 TATCACAGGCCAAGAGGACTAGG - Intergenic
994190064 5:96859423-96859445 TATCCCAGCACAAACGGTCTGGG - Intronic
998355765 5:141535031-141535053 TATCTGAGCCCAAGAGGTCAAGG - Intronic
1001416107 5:171545677-171545699 TGTTCAGGCCCAAGTGGTCTGGG + Intergenic
1001422449 5:171598123-171598145 ATTCTCAGCCCATGTGGTCTGGG + Intergenic
1003854281 6:10256430-10256452 TATCCCAGCCCAACTTACCTGGG + Intergenic
1005471717 6:26167442-26167464 TATCTGAGCCCCAGCGGTCTAGG - Intronic
1006831188 6:36969233-36969255 CTTCAGAGCCCAAGTGGTCTAGG + Intronic
1010879887 6:81154091-81154113 TATCACAGCCCCAGAGGTTTAGG - Intergenic
1011260962 6:85469064-85469086 TCTCCCAGTCCTAGTGGCCTGGG + Intronic
1013851676 6:114523548-114523570 TATCTCAGCCCAAGCAGTTTAGG + Intergenic
1015045224 6:128768412-128768434 CATCACAGGCCCAGTGGTCTAGG - Intergenic
1017155398 6:151318324-151318346 TATAGCAGCCCAAATGGACTAGG + Intronic
1018287751 6:162258674-162258696 CATCCAAGGCCAACTGGTCTGGG + Intronic
1018692053 6:166354405-166354427 TATGGCAGCCCAAATGGACTGGG + Intergenic
1021980718 7:26052781-26052803 TCCCCCATCCCATGTGGTCTTGG + Intergenic
1022536738 7:31103077-31103099 TCTCCCAGTACAAGTGGCCTGGG - Intronic
1024015291 7:45308172-45308194 TATCCCAGGCCTAGAGGCCTGGG + Intergenic
1025636481 7:63324371-63324393 TCTCCCAGCCTAACTGTTCTAGG + Intergenic
1025646215 7:63423731-63423753 TCTCCCAGCCTAACTGTTCTAGG - Intergenic
1025753902 7:64315734-64315756 TCTCCCAGCCTAACTGTTCTAGG + Intronic
1027518169 7:79168253-79168275 TATCCCAACCGAGCTGGTCTCGG + Intronic
1027594784 7:80159256-80159278 TAGCCCAGCCCATCTGGACTTGG - Intronic
1032395785 7:131588658-131588680 TGGCCCAGCACAACTGGTCTGGG - Intergenic
1033483054 7:141760597-141760619 TATCACAGGCCCAGAGGTCTTGG - Intronic
1040644959 8:49387762-49387784 TATCACAGCCCTGGAGGTCTAGG + Intergenic
1043515622 8:80992220-80992242 TGTCCCAGCCACAGAGGTCTGGG + Intronic
1045507408 8:102788558-102788580 TTTTAGAGCCCAAGTGGTCTAGG + Intergenic
1052338934 9:27346312-27346334 TATAGCAGCCCGAATGGTCTAGG + Intronic
1053311352 9:37022781-37022803 TATCTCAGCCTATGTGGTCAAGG - Intronic
1057216434 9:93231316-93231338 TATCCCAGCCCAAGTGGTCTGGG - Intronic
1058148908 9:101442694-101442716 TAACCCAGCCCAAAAGCTCTGGG - Intergenic
1060585354 9:124782160-124782182 TGTCCCAGCCCAATTGCTCAGGG + Intronic
1062051713 9:134450670-134450692 CCACCCAGCCCAAGTGGACTAGG - Intergenic
1062373758 9:136252969-136252991 TCTCCCAGGCCAAGTGCCCTTGG - Intergenic
1185881517 X:3745549-3745571 CCTCCCAGCCCAAATGGACTAGG - Intergenic
1189794569 X:44634375-44634397 TTTCCAAGACCAAGTGGCCTGGG + Intergenic
1200063094 X:153492246-153492268 GATCCCAGCTGAAGTGCTCTAGG - Intronic