ID: 1057217082

View in Genome Browser
Species Human (GRCh38)
Location 9:93235040-93235062
Sequence GTGGCTCTGTAAAGCCATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057217077_1057217082 0 Left 1057217077 9:93235017-93235039 CCGTACCCTGGGCTGGGCTCCAT 0: 1
1: 0
2: 2
3: 22
4: 248
Right 1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG 0: 1
1: 0
2: 2
3: 9
4: 128
1057217079_1057217082 -5 Left 1057217079 9:93235022-93235044 CCCTGGGCTGGGCTCCATGTGGC 0: 1
1: 1
2: 3
3: 42
4: 368
Right 1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG 0: 1
1: 0
2: 2
3: 9
4: 128
1057217074_1057217082 7 Left 1057217074 9:93235010-93235032 CCTTGGGCCGTACCCTGGGCTGG 0: 1
1: 0
2: 0
3: 32
4: 221
Right 1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG 0: 1
1: 0
2: 2
3: 9
4: 128
1057217080_1057217082 -6 Left 1057217080 9:93235023-93235045 CCTGGGCTGGGCTCCATGTGGCT 0: 1
1: 0
2: 3
3: 38
4: 392
Right 1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG 0: 1
1: 0
2: 2
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057217082 Original CRISPR GTGGCTCTGTAAAGCCATCC TGG Intronic
902794769 1:18793901-18793923 GTCGCTCCATGAAGCCATCCAGG - Intergenic
903188959 1:21645786-21645808 GTGGCTCTGAAATGCCAAGCAGG - Intronic
905705453 1:40053179-40053201 GTGCCACTGTACAGCCAGCCTGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906207998 1:43997242-43997264 GAGGCCACGTAAAGCCATCCAGG + Intronic
915353569 1:155241736-155241758 TTTCCTCTGTGAAGCCATCCTGG - Intronic
915558176 1:156671285-156671307 CTGGCTCAGGAAAGCCCTCCTGG - Exonic
917707583 1:177649741-177649763 GTGGCTCTGCAAAACACTCCAGG + Intergenic
923009912 1:230080502-230080524 GTGACTCTGTAAATCCATACTGG + Intronic
1063098343 10:2927957-2927979 GTGCCTCTGTAAAAACAGCCTGG + Intergenic
1070563528 10:77585958-77585980 GAGGTTCTGGAAAGCCATTCTGG - Intronic
1076541905 10:131220100-131220122 GAGGCTCTGAAAGGCCATGCGGG - Intronic
1077448564 11:2618360-2618382 GGGCCTCATTAAAGCCATCCTGG + Intronic
1078105204 11:8354059-8354081 GTGGCTCTGCAAAGCAAGCAGGG - Intergenic
1084333787 11:68445598-68445620 GTGGGTCTCCAAGGCCATCCTGG - Intronic
1084774675 11:71367669-71367691 GGGGCTCTGGAAAGGCATTCTGG - Intergenic
1085512422 11:77095158-77095180 GTGGCTCTCGAAAGCCCTCCTGG - Intronic
1085607591 11:77916019-77916041 GTGGCTCTGGAAATCATTCCTGG + Intronic
1091893726 12:4083602-4083624 GGGGCTCTGGGAAGCCAGCCAGG - Intergenic
1095040496 12:37435424-37435446 GAGGCTCTGGAAAGTTATCCAGG + Intergenic
1095523342 12:43094881-43094903 GAGGCTCTCTAAAGGAATCCTGG - Intergenic
1098169793 12:67736001-67736023 CTGGCTCTGTAATGTCATCCAGG - Intergenic
1100625387 12:96326147-96326169 GTTGCTCTGTAAAGCTGTCCTGG + Intronic
1101415923 12:104507925-104507947 GTGACTCTGCAGTGCCATCCTGG - Intronic
1101938980 12:109084892-109084914 GTGGCTCTGTAAACAAAACCTGG - Intronic
1102098426 12:110258579-110258601 TTGTCTCTGTGAAGCCTTCCTGG - Intergenic
1102778609 12:115543253-115543275 GGGGCTTTGTAAAGCCAGCCTGG - Intergenic
1104189707 12:126468168-126468190 GTGGCTCTGTGATGCATTCCAGG + Intergenic
1105950526 13:25225652-25225674 GTGGCTGTGCAGAGCCCTCCTGG + Intergenic
1110155790 13:72314410-72314432 GAGGCTCAGGAAAGCCACCCAGG - Intergenic
1113817511 13:113184663-113184685 GAGGCTCTGCAAAGCCGTTCCGG + Intronic
1117603608 14:57401317-57401339 GTGGCACAGTGAAGTCATCCTGG + Intronic
1121559584 14:94864686-94864708 GTGGAGCTGTAAAGCCCTCTGGG + Intergenic
1123117176 14:105899989-105900011 GTGGCCCTGGAAAGACCTCCAGG - Intergenic
1127623070 15:60752883-60752905 GGGGCTATGTCCAGCCATCCAGG + Intronic
1130221096 15:82020348-82020370 GTGGCTCAGGGAAGCCATCTTGG - Intergenic
1133248846 16:4466767-4466789 GTGCCTCTGTATAGCCTCCCAGG - Intronic
1134839386 16:17389536-17389558 GTGGATCTGTTTAGCCAGCCAGG + Intronic
1135522684 16:23189434-23189456 GGGACTCTGGAAAGCCATACAGG - Exonic
1138080324 16:54084619-54084641 GTGGCTCTGAAAAGACATTTTGG - Intronic
1138491077 16:57377086-57377108 GTGGCTCTTTAAAGCCCTGGAGG + Intronic
1139329356 16:66175525-66175547 CTGGCTCTGTGAAGGCAGCCAGG - Intergenic
1139640561 16:68288576-68288598 GTGGCTGTGTACAGTCACCCGGG + Intronic
1141604633 16:85145810-85145832 GTGGCTCTGTCCATCCGTCCTGG - Intergenic
1145834596 17:27944726-27944748 GTGGCTCTGCAATCCAATCCTGG - Intergenic
1147904255 17:43812829-43812851 GTGGCTCCCTGAAGCCCTCCAGG + Intronic
1148200674 17:45748095-45748117 GAGGCTCTGTCAACCCAGCCAGG + Intergenic
1150670155 17:67188124-67188146 GTGGCTCTGTGAAGAAATCAGGG + Intronic
1152223136 17:79080238-79080260 AAGGCTCTGTGAAGCCTTCCTGG + Exonic
1154026586 18:10713527-10713549 GTGTGACTCTAAAGCCATCCAGG + Intronic
1156369353 18:36458725-36458747 GTGGCTCTGTTGAACCATCGGGG + Intronic
1159848684 18:73498925-73498947 ATTACCCTGTAAAGCCATCCAGG + Intergenic
925048957 2:796349-796371 GTGGCTGTGCAAAGTCTTCCAGG - Intergenic
925542295 2:4979069-4979091 GTGTCTCTGTGAAGTGATCCGGG - Intergenic
926860666 2:17305440-17305462 GTGGTTCTGGAAATCGATCCAGG + Intergenic
927878792 2:26676068-26676090 GGGCCTCTGTCAAGCCATGCAGG + Intergenic
927956341 2:27210213-27210235 GGGGCTCTCTCAGGCCATCCAGG - Intronic
929544943 2:42849533-42849555 CTGGCTCTGCAAGGCCAGCCTGG + Intergenic
931735205 2:65187361-65187383 CTGGTTCTGTCAAGCCATTCTGG - Intergenic
932594234 2:73084176-73084198 CTGGCTCTGTAAAGCCTGCCAGG - Intronic
934766409 2:96882546-96882568 GTGCCTCTGTAGTGCCAGCCAGG - Intronic
935331443 2:101980392-101980414 CTGGCTCTGCATAGACATCCAGG - Intergenic
937093125 2:119219789-119219811 TTGGCTCTGTAAATGCTTCCGGG + Intergenic
937320036 2:120955559-120955581 GTGCCTGTGGACAGCCATCCTGG - Intronic
937368698 2:121283492-121283514 GTGGTGCTGTAAAGCCATATTGG - Intronic
940118348 2:150235480-150235502 GTGACTCTCTAAAGTCATCCAGG - Intergenic
941676545 2:168348644-168348666 GTGGCTCTATTATGCCATCATGG + Intergenic
944103355 2:196053291-196053313 GTGGCTCTCTATTGCCAGCCTGG - Intronic
944412843 2:199459281-199459303 GTGGCTCTGTTACGCCTTCGCGG - Intronic
944667863 2:201971977-201971999 AATGCTCTGTACAGCCATCCTGG + Intergenic
945522631 2:210847306-210847328 CTGGCTCTGAAAAGCCATGGTGG - Intergenic
946859283 2:223985022-223985044 GTTGCTCTCTGAAGCTATCCCGG - Intronic
1171535054 20:25880095-25880117 GAGGCTCTGGAAAGTTATCCAGG + Intergenic
1171572828 20:26269861-26269883 GAGGCTCTGGAAAGTTATCCAGG - Intergenic
1171806014 20:29680855-29680877 GAGGCTCTGGAAAGTTATCCAGG - Intergenic
1174274127 20:49391233-49391255 ATGGCTCTATAAAGTCATCATGG - Intronic
1175684375 20:61016763-61016785 GTGGTTCTCTCAAGCAATCCTGG - Intergenic
1175904069 20:62371282-62371304 GGGGCTCTTCAAAGCCTTCCAGG + Intergenic
1178590824 21:33908407-33908429 GAGGATCTGAAAAGCAATCCAGG + Intronic
1179243105 21:39609148-39609170 GTGGGCCTGGAAAGCCTTCCAGG + Intronic
1180574432 22:16759625-16759647 GAGGCTCTGGAAAGTTATCCAGG + Intergenic
1184634878 22:45819500-45819522 GTGGCTTGGTAAAGCCACCTGGG - Intronic
950556367 3:13698608-13698630 GTGGCTGTGCACAGCCAGCCTGG - Intergenic
952880892 3:37985742-37985764 GTGGCTGGGAAAAGCCAGCCTGG + Intergenic
955024288 3:55152621-55152643 GTGCCGCTGTAATGCCATCATGG - Intergenic
958096375 3:88950810-88950832 GTGGCTGTGTATAGGCATTCTGG - Intergenic
962134160 3:132716022-132716044 GTTGGGCTGCAAAGCCATCCTGG - Intronic
965158008 3:165089377-165089399 TTGGCTCTCTAAAGTCATTCTGG - Intergenic
965421583 3:168465935-168465957 GTGGCTCTGCAGAGAAATCCAGG + Intergenic
967845296 3:194038112-194038134 ATGGCTCTGGAAAGGCTTCCTGG - Intergenic
968934378 4:3602310-3602332 GTGGCTCTGGAAGGCCAACAGGG - Intergenic
969050731 4:4371011-4371033 GTGGCCCTGTAATGACATTCTGG - Intronic
969930365 4:10625150-10625172 ATGGTGCTGTAAAGCCATGCAGG + Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
971379805 4:26086228-26086250 GTGGCTCAAGAAAGCCTTCCTGG - Intergenic
972581776 4:40401461-40401483 GTGGCTCTGTTTAGCCATGGCGG - Intergenic
973791279 4:54380397-54380419 TTAGCTCTGTAAAGACTTCCTGG + Intergenic
973857984 4:55032671-55032693 GTTGCTCTGTAAAACCACCTAGG + Intergenic
980043708 4:127965896-127965918 CTGGCTCTGACAAGCCCTCCAGG - Exonic
980112620 4:128649254-128649276 GTGGCTCTGTGAAGTCATGGGGG - Intergenic
982711851 4:158766292-158766314 GTGGCTCAATAATGCCATCAAGG + Intergenic
985012534 4:185598985-185599007 TTGGCTCTGGAAGGCCATTCGGG + Intronic
985731362 5:1550845-1550867 TTCCCTCTGCAAAGCCATCCAGG + Intergenic
992346652 5:75885993-75886015 GCAGCTCTGAAAGGCCATCCTGG - Intergenic
995214662 5:109581713-109581735 GTGGCTCCTTACAGCCATCATGG + Intergenic
995495656 5:112739333-112739355 GTGGCTTTGTAAAGCCCTCCAGG + Intronic
1001804512 5:174571813-174571835 GTGGATCTGAAAAGCCAGCAGGG + Intergenic
1003507531 6:6751983-6752005 GGGGCTCTGTCCAGCCACCCTGG - Intergenic
1003598173 6:7493571-7493593 GTACCTCTGGAAATCCATCCCGG - Intergenic
1007208693 6:40173542-40173564 TTGGCACTTTACAGCCATCCAGG + Intergenic
1008002380 6:46374049-46374071 GTGGGACTGTAAAGCCTTCAAGG - Intronic
1013060518 6:106629484-106629506 TTGGCGCCGCAAAGCCATCCCGG - Exonic
1019434381 7:1014642-1014664 GGGGCTCCATAAAGCCAGCCTGG + Intronic
1020054442 7:5107554-5107576 GTGGAAACGTAAAGCCATCCAGG + Intergenic
1021654893 7:22865155-22865177 CTGGCCCTGTAAAGGCCTCCTGG + Intergenic
1025845361 7:65191910-65191932 GTGGCTCTGGAAATCATTCCTGG - Intergenic
1025895637 7:65697942-65697964 GTGGCTCTGGAAATCATTCCTGG - Intergenic
1027469791 7:78558882-78558904 ATGGCACTTTAAAGTCATCCTGG - Intronic
1029806620 7:103004270-103004292 GTGGTGCTGTAAGTCCATCCAGG + Intronic
1036632500 8:10525396-10525418 GTGCCTCTGTGCAGCCGTCCCGG + Intergenic
1037649487 8:20823631-20823653 GTGGCTCTGTAGGGACAGCCTGG - Intergenic
1038801631 8:30754547-30754569 GTGGCTCTGTTCAGCCAGCAGGG + Intronic
1039366548 8:36933982-36934004 GTGGATTTGTGAAGCAATCCTGG + Intronic
1042159543 8:65878305-65878327 GTGGTTTTGTAAAGAAATCCTGG + Intergenic
1043165199 8:76894644-76894666 GAGACTCTGTAAAGCCTTTCAGG + Intergenic
1045486370 8:102634704-102634726 CTGGATCTGTAAAGGCATTCTGG + Intergenic
1047801490 8:128314945-128314967 GTGGCTGTGTAAAGACCCCCTGG + Intergenic
1051950596 9:22626770-22626792 GTGGTTCAGAAAGGCCATCCCGG - Intergenic
1053303612 9:36968984-36969006 GTGGCTCTGCCCAGTCATCCTGG + Intronic
1056997311 9:91474953-91474975 GTGGCTCCACAAGGCCATCCAGG - Intergenic
1057217082 9:93235040-93235062 GTGGCTCTGTAAAGCCATCCTGG + Intronic
1057446718 9:95121202-95121224 GTGGCTCAGTACAGCCAGTCAGG - Intronic
1057573730 9:96222828-96222850 ATGACTCTTCAAAGCCATCCTGG + Intergenic
1061381252 9:130259470-130259492 GAGGAACTGTACAGCCATCCTGG - Intergenic
1186955595 X:14678484-14678506 TTCTCTCTGTAAAGCAATCCTGG - Intronic
1190784027 X:53626004-53626026 GTGGCTATGGAAAGCAGTCCAGG - Intronic
1191253563 X:58270432-58270454 GGGGCACTTTAAAGCAATCCAGG - Intergenic
1194426942 X:93750353-93750375 GCGGCCCTGTAAAGGCATCATGG + Intergenic
1195885217 X:109630464-109630486 GTGGCTCTGTAAGGCCATACTGG - Intronic
1199973921 X:152880506-152880528 GTGCCACTGTAAATCCAGCCTGG + Intergenic