ID: 1057217257

View in Genome Browser
Species Human (GRCh38)
Location 9:93235974-93235996
Sequence CTGTGTGCCCCTGAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057217247_1057217257 25 Left 1057217247 9:93235926-93235948 CCCTTGGTTGTTGTAAATCATCG 0: 1
1: 0
2: 0
3: 9
4: 50
Right 1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG No data
1057217248_1057217257 24 Left 1057217248 9:93235927-93235949 CCTTGGTTGTTGTAAATCATCGG 0: 1
1: 0
2: 0
3: 7
4: 50
Right 1057217257 9:93235974-93235996 CTGTGTGCCCCTGAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057217257 Original CRISPR CTGTGTGCCCCTGAGGAAGT GGG Intronic
No off target data available for this crispr