ID: 1057218192

View in Genome Browser
Species Human (GRCh38)
Location 9:93241108-93241130
Sequence CAGGCAGCAGTGTTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 8, 3: 38, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057218192_1057218195 -7 Left 1057218192 9:93241108-93241130 CCCAGGGCCAACACTGCTGCCTG 0: 1
1: 0
2: 8
3: 38
4: 338
Right 1057218195 9:93241124-93241146 CTGCCTGAGAACCCTAGTGCAGG No data
1057218192_1057218196 -6 Left 1057218192 9:93241108-93241130 CCCAGGGCCAACACTGCTGCCTG 0: 1
1: 0
2: 8
3: 38
4: 338
Right 1057218196 9:93241125-93241147 TGCCTGAGAACCCTAGTGCAGGG No data
1057218192_1057218201 27 Left 1057218192 9:93241108-93241130 CCCAGGGCCAACACTGCTGCCTG 0: 1
1: 0
2: 8
3: 38
4: 338
Right 1057218201 9:93241158-93241180 GACAGAGACGTCTTTGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057218192 Original CRISPR CAGGCAGCAGTGTTGGCCCT GGG (reversed) Intronic
900090863 1:919848-919870 CAGGCCGCAGTGTTGGCAGGGGG + Intergenic
900164656 1:1239866-1239888 CAGGCAGCAGGGTCGGCCTGCGG + Intergenic
900372350 1:2337564-2337586 GAGACAGCAGGGTGGGCCCTGGG - Intronic
900867064 1:5276158-5276180 CAGGCAGCAGGGCTCTCCCTGGG + Intergenic
902870908 1:19312851-19312873 GAGGAGGCAGTGTAGGCCCTCGG - Exonic
902875606 1:19339023-19339045 CTGGGAGCAGAGGTGGCCCTCGG - Exonic
903446974 1:23428713-23428735 CAGGCAGCTGTGTTGGCCATTGG + Exonic
903692521 1:25184371-25184393 CAGGCAACAGTGTTTGCCCCAGG + Intergenic
904261361 1:29289586-29289608 CAGGCAGCAGGGTGGGGCCTGGG - Intronic
905182064 1:36173417-36173439 CCGGCAGCAGCGCTGGTCCTGGG + Exonic
905182238 1:36174745-36174767 CAGGAGGCAGCCTTGGCCCTGGG - Intronic
905308673 1:37035049-37035071 CTGGCAGCAGAGTTGGGGCTGGG + Intergenic
905386993 1:37611920-37611942 CCGGCAGCAGTGTTGTCACAGGG - Exonic
907329998 1:53664574-53664596 CAGGCACCATTCTAGGCCCTGGG + Intronic
907623723 1:56009035-56009057 CAGGCAGCTGTGGTGGCAGTAGG - Intergenic
909774310 1:79464784-79464806 CATGCAACAGTGGGGGCCCTGGG + Intergenic
909782296 1:79561787-79561809 CGGCCAGCACTGCTGGCCCTGGG - Intergenic
909904577 1:81178869-81178891 CAGCCAGCCCTGCTGGCCCTGGG - Intergenic
910118758 1:83761266-83761288 CAGGCAACAGTGTGGCCCCTGGG - Intergenic
910609764 1:89128303-89128325 CGGCCAGCCCTGTTGGCCCTGGG - Intronic
916790892 1:168124155-168124177 GTTGCAGCAGTGTTTGCCCTGGG - Intronic
917081776 1:171263098-171263120 CAGGCAGGAGTGTAGGCAATGGG - Intronic
917732993 1:177894977-177894999 CAGGCACCATTGTTGGCTCAAGG - Intergenic
919107190 1:193168334-193168356 TAGGCAGTATTGTAGGCCCTGGG + Intronic
919792350 1:201300308-201300330 CAGACACCAGTGTTTGCCATAGG - Intronic
920177693 1:204113233-204113255 CAGGCAGAAGTGGTGATCCTAGG + Intronic
920370930 1:205478929-205478951 AGGGCAGCAATGTTGGCCCTTGG + Intergenic
922485416 1:225969864-225969886 CAGCCGGCAGGGCTGGCCCTGGG + Intergenic
923958071 1:239044994-239045016 CAGGCAGGAGTGTGGGCTTTGGG - Intergenic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
924502682 1:244652297-244652319 CAGGCAGTGTTGTAGGCCCTCGG - Intergenic
1063197662 10:3758584-3758606 CAGGGAGCAGTGTTCCCCATAGG - Intergenic
1064014370 10:11761218-11761240 CTGGGAGCAGTATTGGCCCAGGG + Intronic
1064790369 10:18951540-18951562 CAGGCAGCCCTGCTGGCCCCAGG - Intergenic
1065113275 10:22460497-22460519 CAGACAGCAGCGTTGGGCCCAGG + Intergenic
1066567413 10:36734881-36734903 CAGCCAGCCCTGCTGGCCCTGGG - Intergenic
1067374869 10:45718606-45718628 CAGGCATCAGAGCTGGGCCTTGG - Intergenic
1067378855 10:45753933-45753955 CAGGCATCAGAGCTGGGCCTTGG + Intronic
1067882686 10:50060253-50060275 CAGGCATCAGAGCTGGGCCTTGG - Intergenic
1067886558 10:50094595-50094617 CAGGCATCAGAGCTGGGCCTTGG + Intronic
1068820978 10:61377133-61377155 CAGCCAGCACTGCCGGCCCTGGG - Intergenic
1069060013 10:63885495-63885517 CAGCCTGCCATGTTGGCCCTGGG + Intergenic
1070801215 10:79245412-79245434 CAGGCACCACAGTTGGCACTGGG - Intronic
1072220968 10:93327213-93327235 CTGGCAGTTGTGTTGGCTCTCGG - Intronic
1072948056 10:99828299-99828321 GATGCTGCTGTGTTGGCCCTGGG + Intronic
1073046654 10:100643034-100643056 CAGGCACTAGTGCAGGCCCTGGG - Intergenic
1073662092 10:105487696-105487718 CAGGCAGAAGTTTTGGACTTTGG + Intergenic
1074726180 10:116312184-116312206 AAGGCAGCAGTGTGGGACCATGG + Intergenic
1076138049 10:128058462-128058484 CGGGCAGCTGCGTGGGCCCTGGG - Intronic
1076412813 10:130264015-130264037 CAGGGAGGAGTCTTGACCCTGGG + Intergenic
1076726463 10:132416398-132416420 CAGGGCCCAGGGTTGGCCCTGGG + Intronic
1076747102 10:132519970-132519992 CAGGAGGCAGTGTTGTCCGTGGG + Intergenic
1077223354 11:1427021-1427043 CAGGTGGCAGTGTTGGCACTGGG - Intronic
1078251907 11:9623299-9623321 CAGGCAGCCCTGCTGGCTCTGGG - Intergenic
1078301210 11:10133566-10133588 CAGGCAGCCCTGCTGGCCCTGGG - Intronic
1080363308 11:31542478-31542500 CAGGAATTACTGTTGGCCCTGGG - Intronic
1081152469 11:39648723-39648745 CAAGCAGCCGTGGTGGCACTGGG - Intergenic
1082889937 11:58127860-58127882 CAGGCTGCAGTCTTGGACATTGG - Intronic
1083203819 11:61135427-61135449 AAGGCAGCAGCGTGGGCTCTAGG - Intronic
1083238837 11:61370869-61370891 TAGGCAGCTGTGATGGCCTTGGG + Intergenic
1084323289 11:68385304-68385326 CCAGCAGCAGGCTTGGCCCTGGG + Intronic
1084587285 11:70069723-70069745 CAGGCAGCCCTGTGGCCCCTGGG + Intergenic
1084967837 11:72753616-72753638 CTGGCAGCAGGGGTGTCCCTTGG + Intronic
1088584891 11:111353600-111353622 CTGGCATCAGGGTAGGCCCTTGG + Exonic
1089497918 11:118916994-118917016 CAGGGAGGAGGGCTGGCCCTGGG + Intronic
1089858300 11:121566687-121566709 CAGGCAGCAGGGTTCCTCCTGGG - Intronic
1090185668 11:124737830-124737852 CTGGCCACAGTGCTGGCCCTGGG - Intergenic
1090307695 11:125704964-125704986 CAGCCAGCCCTGCTGGCCCTGGG - Intergenic
1090964918 11:131590228-131590250 CTGACAGCAGTGATGACCCTGGG + Intronic
1091885818 12:4016220-4016242 CAGGCAGCTCTCTTGACCCTGGG + Intergenic
1092063953 12:5574014-5574036 TTGGCAGCAGTGATGACCCTGGG - Intronic
1092427369 12:8385630-8385652 CAGGCAGCACTTTCGGCCCGGGG + Intergenic
1092731640 12:11540352-11540374 AAGGCTGCAGGGTTGGCCCCGGG - Intergenic
1094273802 12:28646031-28646053 CAGGCTGCTGTGCTGGCCCGCGG + Intergenic
1097128953 12:56796101-56796123 CAGGCAGCCCTGCTGGCCCCGGG - Intergenic
1098347742 12:69524155-69524177 CAGGCAGCAGTGTCGGCGGCAGG + Intronic
1098891467 12:76013842-76013864 CAGGCAGCAGTGTTTGCAGTTGG + Intergenic
1099159516 12:79223629-79223651 CAGGCAGCATTAGTGGCCCTTGG - Intronic
1101574742 12:105987063-105987085 TAGGCAGCATAGTTGGCTCTAGG + Intergenic
1104054792 12:125221234-125221256 CAGGCAGCATTCTAGGTCCTGGG - Intronic
1104844056 12:131838107-131838129 CCGGAAGCAGTGGTGGCCCGTGG + Intronic
1105290505 13:19050209-19050231 CAGGCAGGAGTCATGGACCTGGG - Intergenic
1106122679 13:26873613-26873635 GAGGCAGCACCGTTGGCTCTAGG + Intergenic
1106305514 13:28505674-28505696 CAGGCTGCAGTGCCTGCCCTTGG - Intergenic
1107384275 13:39890891-39890913 CAGGCTGCAGTTCTGTCCCTAGG - Intergenic
1107711961 13:43159337-43159359 CAGACAGCAGCGTTTGCCATGGG + Intergenic
1109569272 13:64164673-64164695 CTGGTAGCAGTGTTGGCCTGGGG + Intergenic
1110099137 13:71573554-71573576 CAGGCAGCAGTGATGGTTCCTGG - Exonic
1111326956 13:86710883-86710905 CAGGCAGCAGTGTTGGAGAGTGG - Intergenic
1116243595 14:42379346-42379368 CTTGCAGCAGTGTTGGCACAAGG - Intergenic
1116487410 14:45467199-45467221 CTGGCTGCAGGGTTGGCCTTTGG + Intergenic
1119415447 14:74466553-74466575 GAGGCAGTGGTGATGGCCCTTGG - Intergenic
1121716707 14:96081392-96081414 CACGAGGCAATGTTGGCCCTGGG + Intronic
1122019587 14:98826588-98826610 CAGGCAGCAGAGTTGGCACCTGG + Intergenic
1122452271 14:101819261-101819283 CATGGAGCAGTGTTCACCCTGGG + Intronic
1122800848 14:104228857-104228879 CAGGGAGCAGGGTGGGCCCAAGG + Intergenic
1124062856 15:26310858-26310880 CAGGAAGCAGTGTTTGCCTGCGG + Intergenic
1125336397 15:38630691-38630713 AAAGCTGCACTGTTGGCCCTTGG - Intergenic
1127866614 15:63038377-63038399 CAGTCAGCACTGTTGACTCTGGG + Intergenic
1128227551 15:66012793-66012815 CAGGCAGCAGCGCTTCCCCTAGG + Intronic
1128524478 15:68403071-68403093 CAGGCAGAGGTGTAGGCCCTGGG + Intronic
1131838526 15:96413805-96413827 CAGGCAGCCCTCTTGGCTCTGGG - Intergenic
1132359643 15:101201708-101201730 CTGGCAGCTCTGGTGGCCCTGGG + Intronic
1132373579 15:101313795-101313817 CAGGGAGCAGAGGTGGGCCTAGG - Intronic
1132400492 15:101502045-101502067 CAGGCTGCACTGTTGCCCCCTGG + Intronic
1133236004 16:4387747-4387769 CTGGTAGCAGAGTGGGCCCTTGG - Intronic
1133270460 16:4608769-4608791 CAGGCAGCAGTGTGGAGCCGGGG + Intergenic
1133337608 16:5016153-5016175 GAGGCTGCTGTGTTTGCCCTGGG + Exonic
1134084936 16:11349763-11349785 CAGGCAGCAGGGCTGGCACCGGG + Intronic
1134572886 16:15306753-15306775 CACCCAGCAGTGTTGGACCTTGG - Intergenic
1134729498 16:16449229-16449251 CACCCAGCAGTGTTGGACCTTGG + Intergenic
1134937937 16:18262621-18262643 CACCCAGCAGTGTTGGACCTTGG - Intergenic
1137500774 16:49010372-49010394 CAGGCAGCAGCCCTGGCCCTTGG + Intergenic
1139490213 16:67281958-67281980 CAGCATGCAGTGTTGGTCCTGGG - Intronic
1140791239 16:78393125-78393147 CTGGCAGCAGTGGTGTCCATAGG + Intronic
1141566260 16:84904111-84904133 GAGACAGCCGTGGTGGCCCTTGG + Intronic
1141910961 16:87058035-87058057 CAGGGAGCACCGGTGGCCCTGGG - Intergenic
1142504310 17:353082-353104 CAGGCAGCAGTGGTGGTGCACGG + Intronic
1142681345 17:1550806-1550828 CCGTCAGCAGTTTTGGCGCTGGG + Intronic
1143659272 17:8314856-8314878 TGGGCAGCAGTGGTGGCCCTGGG + Intronic
1143864027 17:9911138-9911160 CAGGCAGCTGTGTGGACCCAGGG - Intronic
1144063454 17:11603519-11603541 CAGGCAGCAGTTTCAGCCTTAGG - Intronic
1144482567 17:15639811-15639833 CAGGCAGCAGGTTTGCCACTTGG - Intronic
1144508169 17:15851383-15851405 TTGGCAGCAGTGGTGGACCTGGG - Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1144916116 17:18725220-18725242 CAGGCAGCAGGTTTGCCACTTGG + Intronic
1145172290 17:20669017-20669039 TTGGCAGCAGTGGTGGACCTGGG - Intergenic
1145272925 17:21414155-21414177 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145311128 17:21701591-21701613 CAGGCCGCATTCTAGGCCCTGGG + Intronic
1145859844 17:28200386-28200408 CAGACACCATTGTTGGCTCTAGG + Intergenic
1148542110 17:48489026-48489048 CAGTCAGCAGTTTTGTCCCCAGG - Intergenic
1149211845 17:54312493-54312515 CTGGCATGAGTGTTGGCCATGGG - Intergenic
1150160239 17:62891642-62891664 CAGGCAGAAGGTTAGGCCCTTGG + Intergenic
1150226998 17:63529705-63529727 CATGGAGCTGGGTTGGCCCTGGG - Intronic
1150301350 17:64049623-64049645 CAGGCACCATTCTGGGCCCTGGG - Intronic
1150472134 17:65446392-65446414 CAGGTAGCAGGGTTGGACATGGG + Intergenic
1152058204 17:78049366-78049388 CAGGCAGCTGGGTTGGCATTAGG - Exonic
1152492724 17:80648555-80648577 CAGGCAGCCGGGTTGGCTTTGGG + Intronic
1152545553 17:80998518-80998540 CAGGCAGCAGGGCTTGCCCACGG - Intronic
1152810870 17:82382184-82382206 AAAGCAACAGTGTTAGCCCTTGG + Intergenic
1153192485 18:2557346-2557368 CAGGCACTATTCTTGGCCCTAGG - Intronic
1155226901 18:23737091-23737113 GAGCCAGCAGTCTTGGCTCTGGG - Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1156638138 18:39055888-39055910 CAGGCAGGAGTTGTGGCCTTTGG + Intergenic
1157120125 18:44901480-44901502 CAGGCTGAAGTGCTGCCCCTCGG - Intronic
1157202843 18:45673647-45673669 CAGGCATCAGGGTTGGGTCTAGG - Intronic
1157666001 18:49487334-49487356 CACGCAGCAGTGTTGCCCAAGGG + Intronic
1157856908 18:51112067-51112089 CAGCCAGCCCTGCTGGCCCTGGG - Intergenic
1160005990 18:75069379-75069401 CAGGCGGGAGTGGTGGGCCTGGG + Intergenic
1160861735 19:1240112-1240134 CAGGGAGCAGGGGAGGCCCTGGG - Intergenic
1160990480 19:1858309-1858331 CAGCCATCAGTTTTGACCCTAGG - Intronic
1163130801 19:15271665-15271687 CAGTCAGCTGTGTTGGCCTGCGG - Intronic
1163408962 19:17141492-17141514 GAGGCAGCAGAGCTGGTCCTGGG - Intronic
1163560041 19:18013713-18013735 CAGGCAGCTCTGATGCCCCTGGG - Exonic
1163694494 19:18757136-18757158 CAGCCAGAAGTGTTTGCCCCAGG + Intronic
1163713293 19:18859821-18859843 CAAGCTGCAGTGTTGGGCCCCGG + Intronic
1165882227 19:39052452-39052474 CAGGCAGCAGTCCTGGAACTGGG + Intergenic
1165991678 19:39818767-39818789 CAGGCAGCTGGGTTGGTCCTGGG - Intergenic
1166527242 19:43519654-43519676 CAGGGGGCAGTGTAGGCCGTGGG - Intronic
1166678371 19:44753412-44753434 GAGGCAGAAGTGTTTGCCTTGGG - Intronic
1166689404 19:44813567-44813589 CAGGCGGCCGTGGCGGCCCTCGG - Exonic
1167229286 19:48271548-48271570 CAGGCAGGAGTGCGGGCGCTGGG + Intronic
1167616296 19:50536026-50536048 CAGGAAGCGGTGTAGGCCCATGG - Intronic
925502556 2:4522519-4522541 CTGCCAGTAATGTTGGCCCTGGG - Intergenic
925900970 2:8509102-8509124 CAGGGAGCAGTGGCGGCTCTTGG - Intergenic
926106942 2:10158509-10158531 CAGGCAGCAGAGGTGGCTCAGGG - Intronic
926140275 2:10364236-10364258 CAGGCAGAAGTGGGGGCTCTGGG - Intronic
926300587 2:11599304-11599326 CAGGCATCAGTGGTGACCCACGG - Intronic
926311729 2:11680271-11680293 CTGGCAGCAGCGTGAGCCCTCGG + Intronic
926424120 2:12725861-12725883 CATGCAGCCGTGTTGCCCCAGGG + Intronic
927856497 2:26530864-26530886 CTGGCATCAGTGTGGGGCCTCGG + Intronic
928593553 2:32840218-32840240 CAGTCAGCAGTGTCAGCTCTGGG - Intergenic
928600148 2:32896636-32896658 CAGGCAGCATTGTTGGGAGTTGG + Intergenic
929488559 2:42376326-42376348 CAGGCAGCACTCGGGGCCCTAGG - Intronic
929539355 2:42808489-42808511 CAAGCAGCAGAGTTGGCCCTCGG - Intergenic
929904476 2:46034144-46034166 CAGACCGCAGTCTTGGCTCTTGG - Intronic
933990056 2:87627649-87627671 CAGGCAGCTGTGCTGGTCCAAGG + Intergenic
935788884 2:106572718-106572740 CAGGCAGCACTGCTGCCCCCAGG + Intergenic
935848059 2:107187912-107187934 CTTGCAGCAGTGTTGGCACAGGG - Intergenic
936045361 2:109183835-109183857 CAGGCCACTGTGTTGTCCCTGGG + Intronic
936303790 2:111323175-111323197 CAGGCAGCTGTGCTGGTCCAAGG - Intergenic
937921464 2:127134729-127134751 CAGGCAGGAGTGGGGGCCCTTGG - Intergenic
938985613 2:136572554-136572576 CTGGCAGCAGAGTTGGCACTGGG - Intergenic
942320634 2:174732835-174732857 TAAGCAGCAGCCTTGGCCCTTGG - Intergenic
943153002 2:184138195-184138217 CTGGCAGAAGTGTTGGCACAGGG + Intergenic
943381250 2:187151459-187151481 AAGTAAGCAGTGTTAGCCCTAGG - Intergenic
943455622 2:188103384-188103406 CTGGCAGCAGTGTTGGCACTGGG - Intergenic
945041513 2:205746818-205746840 CAGGCAGCATTTTTCTCCCTGGG - Intronic
946060492 2:216936904-216936926 CAGCCAGCAGAGTAGTCCCTGGG + Intergenic
946519189 2:220447097-220447119 CAGTCAGCAGTGTTGGTCCTGGG - Intergenic
946628076 2:221636391-221636413 CAGGTGGCATTCTTGGCCCTTGG - Intergenic
947576405 2:231278464-231278486 CATTCAGCACTGCTGGCCCTGGG + Intronic
947766434 2:232640867-232640889 GAGGCAGCAGGGAAGGCCCTTGG + Intronic
948342975 2:237270097-237270119 CTGGCGGCAGTGTTTGCCATTGG - Intergenic
948543288 2:238704940-238704962 CATGCTGCTGTGTTGGCCCTTGG - Intergenic
1169056268 20:2624171-2624193 CAGGCAGCAGCCCTGGACCTGGG + Intronic
1170610349 20:17907678-17907700 CAGGCAGCAATGATGGATCTTGG - Intergenic
1171139779 20:22730561-22730583 CAGGCAGAGGTGTTCTCCCTAGG - Intergenic
1171166382 20:22975525-22975547 CAGGCACCACTGTTTCCCCTGGG + Intergenic
1171181345 20:23093179-23093201 AAGGCAGCAGTCCTGGCCTTGGG - Intergenic
1171292992 20:23993401-23993423 CAGGCAGAAGGGTTGACACTGGG - Intergenic
1172069074 20:32243059-32243081 CAGCAAGCAGTGCTGGCCATAGG + Intergenic
1172847857 20:37940501-37940523 CTGCCAGCACTGGTGGCCCTCGG + Intronic
1172871036 20:38135721-38135743 CAGGCAGTGGTGTCAGCCCTGGG - Intronic
1173019053 20:39252094-39252116 CAGCCAGCAGATTTGGCCCGTGG + Intergenic
1174672549 20:52321707-52321729 CAACCAGCAGTGTTTGCCATGGG + Intergenic
1175225557 20:57441966-57441988 CAGCCAGCAGCTTTGGCTCTTGG + Intergenic
1175226004 20:57444442-57444464 CATGCAGCATTGTAGGCACTGGG + Intergenic
1176076455 20:63250545-63250567 CAGGCAGCAGGCTGGGGCCTCGG - Intronic
1176379368 21:6104173-6104195 CAGGAAGCAGTGGAGGGCCTGGG - Intergenic
1179593627 21:42427780-42427802 CAGGCACCAGGATGGGCCCTGGG - Intronic
1179744105 21:43434064-43434086 CAGGAAGCAGTGGAGGGCCTGGG + Intergenic
1180152742 21:45960051-45960073 CAGGCAGCGGCCTTGGCTCTGGG + Intergenic
1180709993 22:17832973-17832995 CTGGCAGGAGCGATGGCCCTGGG - Intronic
1180824050 22:18851116-18851138 CAGGCAGAAGGGTTGACACTGGG - Intronic
1180965280 22:19784901-19784923 CAGCCAGCAGGGGTGGCCTTGGG - Exonic
1181124476 22:20694270-20694292 CAGGCAGAAGGGTTGACACTGGG - Intergenic
1181188687 22:21123432-21123454 CAGGCAGAAGGGTTGACACTGGG + Intergenic
1181210512 22:21287061-21287083 CAGGCAGAAGGGTTGACACTGGG - Intergenic
1181398999 22:22639830-22639852 CAGGCAGAAGGGTTGACACTGGG + Intergenic
1181501729 22:23319176-23319198 CAGGCAGAAGGGTTGACACTGGG + Intergenic
1181650421 22:24256229-24256251 CAGGCAGAAGGGTTGACACTGGG - Intergenic
1181706959 22:24654509-24654531 CAGGCAGAAGGGTTGACACTGGG + Intergenic
1182064226 22:27418912-27418934 CAAGCATCAGTGCTGTCCCTGGG + Intergenic
1182224309 22:28783997-28784019 TAGGCCGCAGTGTTGTTCCTGGG - Intronic
1183394153 22:37561781-37561803 CAGGCCGCAGTGCTGGCCAGGGG - Intronic
1183420543 22:37709243-37709265 CAGGCTGCTGCCTTGGCCCTGGG + Intronic
1183426220 22:37740864-37740886 CAGGGTCCAGTGTTGGCCCCAGG - Intronic
1183687335 22:39368673-39368695 CAGGCAGAAGCCTGGGCCCTGGG - Intronic
1184283662 22:43453710-43453732 CAGGCAGAATTGTAGGCTCTTGG - Intronic
1184398060 22:44256723-44256745 CAGGCATCGTTATTGGCCCTGGG - Intronic
1184643327 22:45883478-45883500 GAGAGTGCAGTGTTGGCCCTGGG - Intergenic
1184788034 22:46681179-46681201 CAGGGGGCAGTGTGGGCCCATGG + Intergenic
1184820133 22:46903809-46903831 AAGGCAGCAGTGGAGGCACTGGG + Intronic
1185074879 22:48677814-48677836 CAGGCAGCTGTCCTGGCCCCTGG + Intronic
1203216435 22_KI270731v1_random:8369-8391 CAGGCAGAAGGGTTGACACTGGG + Intergenic
1203274191 22_KI270734v1_random:77020-77042 CAGGCAGAAGGGTTGACACTGGG - Intergenic
949875766 3:8625155-8625177 CAGGCACTATTCTTGGCCCTGGG - Intronic
950688337 3:14635387-14635409 CAGGCAGCAGCGCAGCCCCTGGG + Intergenic
950750420 3:15123875-15123897 CAGGCAGCACTTTTGGCCAGGGG - Intergenic
951204475 3:19910685-19910707 CAGTCAGCAGTGGTGGCCACAGG + Intronic
951540172 3:23775053-23775075 CACTCAGCAGTTTTTGCCCTAGG - Intergenic
953344044 3:42160243-42160265 CAGGGCGCAGTGTGTGCCCTGGG + Intronic
953875170 3:46662540-46662562 CTGGCTGCAGTGTTGGCACCTGG + Intergenic
953955368 3:47227762-47227784 CAGGCTGCAGCTTGGGCCCTTGG - Intergenic
954793965 3:53152072-53152094 CAGGCAGCAGAGCTGGCCCCAGG + Intergenic
955346408 3:58165042-58165064 CAGGCAGCAGTGCTGGCACTTGG + Intronic
956223025 3:66923925-66923947 CAGGCGGCGGTGGTGGCCATAGG + Intergenic
957280278 3:78142726-78142748 CTGGCAGCAGAGTTGGCCCAGGG - Intergenic
958147170 3:89640413-89640435 CATGGAGCAGTGGTGGCCATGGG + Intergenic
958464331 3:94440006-94440028 CAGGGGGCAGTGTTGGGACTTGG - Intergenic
958678503 3:97296046-97296068 CAGGCAGCTGTGTGGGTCCTAGG + Intronic
960619056 3:119621768-119621790 TAAGCAGCAGGGTTGGGCCTTGG + Intronic
961645523 3:128390842-128390864 CTGGCCCCAGTGCTGGCCCTTGG + Intronic
962464872 3:135648949-135648971 CTTGCAGCAGTGTTGGCACAAGG + Intergenic
963063829 3:141246677-141246699 CAGGCAGTGTTCTTGGCCCTGGG + Intronic
963262297 3:143205243-143205265 CAGGCATCATTCTTGGCACTGGG + Intergenic
963849931 3:150201077-150201099 CAGGCAGTAGTCTAGGCACTGGG - Intergenic
965659889 3:171029938-171029960 CAGGCAGCATTTTAGGCACTGGG - Intergenic
966326999 3:178767969-178767991 CAGGCTGCAGTGTTCGCATTTGG + Intronic
966974193 3:185070574-185070596 CAGGCACCAGACTTGGCCCCAGG + Intergenic
967891933 3:194369795-194369817 CAGAGGGCAGTGTTGGCCCTGGG + Intergenic
968606910 4:1539868-1539890 GCGGCAGCCGTGGTGGCCCTAGG + Intergenic
968771419 4:2509940-2509962 CTGGTAACAGTGCTGGCCCTTGG - Intronic
969241567 4:5902033-5902055 CAGGCACCACAGTAGGCCCTGGG - Intronic
969267332 4:6073166-6073188 CAGGCAGCAGGCTTGGCCTCAGG + Intronic
969267343 4:6073206-6073228 CAGGCAGCAGGCTTGGCCTCAGG + Intronic
969494847 4:7520649-7520671 CAGGCACCGGGGGTGGCCCTAGG + Intronic
971395150 4:26220453-26220475 CAGGCATCATTGTAGGCACTTGG + Intronic
972247004 4:37255755-37255777 CAGGCTGCAGTTCTGGCCTTGGG - Intronic
974010448 4:56601731-56601753 CAGGCAGCAGAGTAAGACCTTGG + Intronic
975909318 4:79248725-79248747 CAGGCAGCAGTATTGGCACGGGG - Intronic
976098185 4:81531666-81531688 CAGGAAGGAATGTTGTCCCTTGG + Intronic
978688952 4:111483732-111483754 CTGGCAGCAGTGTTGGTTCAAGG - Intergenic
980060999 4:128129302-128129324 CAGGCTGCAGTGTGTGACCTCGG - Intronic
980583949 4:134789002-134789024 CTGGCAGCAGTGTTGGTGCAGGG + Intergenic
982324708 4:154118332-154118354 CAGGCAGCTGTGTTGGAGTTGGG - Intergenic
982464588 4:155714384-155714406 CAGGCATCATTGTAGGCACTGGG + Intronic
984752035 4:183287167-183287189 CAGGCAGCAGTGGGCGCCCCTGG + Intronic
986529159 5:8716521-8716543 CTGGCCGCAGTGTTGGAACTTGG + Intergenic
987296404 5:16556112-16556134 CAAGCAGCTGTGTAGGCCCAAGG + Intronic
988348445 5:30069997-30070019 CCTGCAGCAGTGTTGGCACAAGG - Intergenic
988897487 5:35693223-35693245 CAGGGACCAATGCTGGCCCTGGG + Intronic
989086786 5:37685097-37685119 CTGGCAGCAGTGTTGGCACTGGG + Intronic
989154864 5:38334891-38334913 CGGGGAGCAGTTTTGCCCCTTGG + Intronic
990740168 5:58904217-58904239 TAGGCAGGAGTGCAGGCCCTGGG + Intergenic
991160442 5:63492812-63492834 CAGGCAGTAATGCTTGCCCTTGG - Intergenic
992048852 5:72925591-72925613 CAGCCAGCACTGCTGGCCCTGGG + Intergenic
992491449 5:77248247-77248269 CAGCCAGCATTCTTGGCCCTTGG - Intronic
996117507 5:119634385-119634407 CAGTCAGGAGTCTTGGCTCTGGG - Exonic
996186306 5:120480076-120480098 CAGGCTGCATTGTATGCCCTTGG + Intronic
996779563 5:127171092-127171114 CAGGAAGCAGTGTTTGTGCTAGG + Intergenic
997299259 5:132790415-132790437 CAGGCAGAGCTGTTGGCACTTGG - Intronic
998859096 5:146425504-146425526 CAGCCAGCGGTGTTGGCCACAGG + Intergenic
999126547 5:149250351-149250373 TTGGGAGCAGTGTTGGCCATTGG + Intronic
999784099 5:154875427-154875449 CATGCAGCAGTGATGGCGCCAGG + Exonic
1000348150 5:160331685-160331707 CAGGCAGCTGTATTGAACCTGGG - Intronic
1001409790 5:171502624-171502646 CAGGCAGAAGAGATGACCCTGGG - Intergenic
1002779063 6:352670-352692 CAGGCAGCAGTGTTGGCACCAGG + Intergenic
1002948593 6:1786348-1786370 CAGGAAGCAGGGTTGGCTATGGG + Intronic
1003095174 6:3137086-3137108 GAGGCACTAGTGTAGGCCCTGGG + Intronic
1003816303 6:9844891-9844913 CAGGGATCAGTGTTGCCCCAGGG - Intronic
1004845718 6:19639417-19639439 CTGGCAGCAGCTTTTGCCCTAGG + Intergenic
1005589347 6:27309207-27309229 CAGGCAGCAGTGTTGGCTTTGGG - Exonic
1006935274 6:37712907-37712929 CAGGCAGCACTCCTGGCCCTGGG - Intergenic
1007119976 6:39371589-39371611 CAGGAAGCATTGCTGTCCCTAGG - Intronic
1008660063 6:53658490-53658512 CAGGCCACAGTGCTGGACCTGGG + Intronic
1011143680 6:84189468-84189490 CAGCCAGCCCTGCTGGCCCTGGG + Intronic
1011509395 6:88083502-88083524 CAGGCAGCAGGGGTGGCTATAGG - Intergenic
1013737945 6:113249045-113249067 CTGGCAGCAGTGTTGGCACAGGG - Intergenic
1014039306 6:116806437-116806459 CAGCTTGCAGTGTTTGCCCTTGG - Exonic
1016242909 6:141952993-141953015 CATGGAGCAGTGAGGGCCCTGGG - Intergenic
1016473455 6:144399912-144399934 TAGGCAGCAGTGAAGGCCTTTGG + Intronic
1017396201 6:154002549-154002571 CAGGAAGCAGTGGTGGGGCTGGG - Intergenic
1018197613 6:161368734-161368756 CAGGCAGCAGCGATGGCCCAGGG - Intronic
1018698463 6:166408602-166408624 CAGTCTGCACTGTTGGTCCTTGG - Intergenic
1018834192 6:167470988-167471010 CAGGCAGGACTGAGGGCCCTTGG + Intergenic
1018950184 6:168374022-168374044 CAGCCAGCAGTTTAAGCCCTGGG - Intergenic
1019684195 7:2371468-2371490 CAGCCTGCAGTGTGGACCCTGGG + Intronic
1023876111 7:44287140-44287162 CAGGGAGCAGTGGTGTCCTTGGG - Intronic
1024060109 7:45691011-45691033 CAGACAGCAGATTTGGGCCTTGG + Intronic
1024211838 7:47212877-47212899 GGGGCAGCAGTGTTTGACCTAGG - Intergenic
1024261419 7:47576688-47576710 CGGGCAGGAGAGTGGGCCCTGGG - Intronic
1024512883 7:50217040-50217062 CAGGCAGCATGGTGGGCCATGGG + Intergenic
1024733613 7:52278675-52278697 CAGGAAGCAGTTATTGCCCTTGG + Intergenic
1026171169 7:67955174-67955196 CAGGCAGCAGAGAAGGACCTGGG + Intergenic
1027665880 7:81042808-81042830 CAGCCAGCCCTGCTGGCCCTGGG + Intergenic
1028631504 7:92939609-92939631 CAAGCAGCAGTGATGTCCCCTGG + Intergenic
1029712487 7:102307295-102307317 CTGGCAGCGGTGTGGGGCCTGGG - Intronic
1031836228 7:126685016-126685038 AGGGCAGCAGTGGTGGCCATGGG + Intronic
1031972018 7:128072015-128072037 CACCCTGCAGTGTTGGCCCCAGG + Intronic
1032985425 7:137331751-137331773 CAGGCAGCTGTGTCTTCCCTGGG + Intronic
1034983294 7:155491702-155491724 CAGGCCGAAGGGATGGCCCTGGG - Intronic
1036243368 8:7097010-7097032 CAGGCAGCACTTTTGGCCAGGGG - Intergenic
1036479000 8:9121028-9121050 CAGCCAGCATTGTTTGTCCTGGG - Intergenic
1036645372 8:10608966-10608988 GAGGCAGCAGAGGTGGCCCCTGG - Exonic
1036898462 8:12654420-12654442 CAGGCAGCACTTTTGGCCAGGGG + Intergenic
1037239498 8:16760701-16760723 CCCCCAGCAGTGCTGGCCCTGGG - Intergenic
1038055491 8:23853843-23853865 CAGGCAGCAGGGTTGGGGGTGGG + Intronic
1039284852 8:36028926-36028948 CAGCCAGCCCTGCTGGCCCTGGG + Intergenic
1039768697 8:40660616-40660638 CAGGTAGCAGTTTTGGTCCTGGG + Intronic
1039840767 8:41291466-41291488 CAGGCAGCAAAGGTGGGCCTAGG - Intronic
1039887213 8:41661750-41661772 AAGGCAGCAGTGATGGCGCTGGG + Intronic
1040861593 8:52005170-52005192 CAGGCAGCATGATTGTCCCTGGG + Intergenic
1041176770 8:55204940-55204962 AAGGCAGCTGGGTGGGCCCTTGG + Intronic
1041196592 8:55407542-55407564 CAGTGAGCAGAGCTGGCCCTCGG + Intronic
1042042266 8:64605080-64605102 AAGGCAGCAGTGTTGTACCTGGG + Intronic
1042206526 8:66334927-66334949 CAGGATGCAGTTTTGGCCCCAGG - Intergenic
1043738384 8:83775596-83775618 CAGACAGTGGTGTTGGCACTTGG - Intergenic
1044170955 8:89050562-89050584 AAGGCAGAAGTGTGGGTCCTTGG + Intergenic
1045272121 8:100670867-100670889 CAGGAAGCAGTGGTGGGTCTGGG + Intergenic
1046143791 8:110130117-110130139 TATGTAGCAGTGGTGGCCCTGGG - Intergenic
1047409410 8:124611936-124611958 CAGGCAGCAGAGCTGTCCCTGGG - Intronic
1047493179 8:125390691-125390713 CAGACAGCAGGGTGGGCACTGGG - Intergenic
1048045690 8:130770616-130770638 GGGTCAGCAGTGGTGGCCCTGGG + Intergenic
1052013154 9:23434764-23434786 AAGGCTCCAGTGTTGGCTCTTGG - Intergenic
1052348245 9:27431588-27431610 CAGTCATCAGTGTTGTACCTTGG - Intronic
1052738699 9:32372721-32372743 CAGACACCAGTGTTGGATCTAGG + Intergenic
1053530852 9:38879396-38879418 CTGGCAGCAGTGTTGGCACAGGG - Intergenic
1054203075 9:62103829-62103851 CTGGCAGCAGTGTTGGCACAGGG - Intergenic
1054532505 9:66197382-66197404 CTGCCAGCAGGGTTGGTCCTTGG - Intergenic
1054635288 9:67484536-67484558 CTGGCAGCAGTGTTGGCACAGGG + Intergenic
1054829005 9:69602724-69602746 CAGGCACCACTTTAGGCCCTGGG + Intronic
1055327517 9:75146452-75146474 CATGCAGAAGTTTTGGTCCTAGG - Intronic
1056563189 9:87750834-87750856 CAGGCAGGATTGGTGGCCCGTGG + Intergenic
1056576378 9:87858495-87858517 CAGGGAGCACTGTTGGAACTGGG + Intergenic
1056797164 9:89666557-89666579 CAGCCAGCAGCGTGGGCCCCAGG - Intergenic
1057122810 9:92592310-92592332 GAGCCAGCAGTGCTCGCCCTGGG - Intronic
1057218192 9:93241108-93241130 CAGGCAGCAGTGTTGGCCCTGGG - Intronic
1057275645 9:93674802-93674824 CAGGCCTTAGTGTAGGCCCTGGG + Intronic
1059215332 9:112556295-112556317 CAGGCAGCAGACTTTGCCCTGGG - Intronic
1061068778 9:128295878-128295900 CAGCCTGCACTGTTGTCCCTGGG + Intergenic
1061139439 9:128755605-128755627 CAGGAATCACTGTTGCCCCTGGG - Exonic
1062130265 9:134888712-134888734 CGGGAAGCAGGGATGGCCCTGGG + Intergenic
1186705294 X:12134370-12134392 CAGGCACCACTGTAGGCACTGGG - Intergenic
1187697822 X:21939229-21939251 CTGGCAGCACAGGTGGCCCTCGG - Intergenic
1188392636 X:29640207-29640229 CAGGCAGCTGTGGTGCCCCTGGG - Intronic
1190114029 X:47614035-47614057 CTGGTAGCAGTGTTCCCCCTTGG - Intronic
1197344844 X:125319324-125319346 CAGCCAGCCCTGCTGGCCCTGGG - Intergenic
1198891584 X:141403068-141403090 CCAGCAGCAGTGTTGGCACAGGG + Intergenic
1199146876 X:144379311-144379333 TTGGCTGCAGTGTTGGCACTGGG + Intergenic
1199255960 X:145719212-145719234 CAGGCAGTAGTGGGAGCCCTGGG + Intergenic
1199366664 X:146994046-146994068 CAGGCACCATTCTTGGCACTGGG + Intergenic
1199580739 X:149357780-149357802 CACACAGCAGGGTGGGCCCTAGG - Intergenic
1199615586 X:149652510-149652532 CTGGCAGCAGGGGTGGCACTGGG + Intergenic