ID: 1057220121

View in Genome Browser
Species Human (GRCh38)
Location 9:93253034-93253056
Sequence GCCGCAGAGCCTGCCCTCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 207}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057220105_1057220121 26 Left 1057220105 9:93252985-93253007 CCCCGGCCCAGTGTGTGTGCAGC 0: 1
1: 0
2: 1
3: 16
4: 204
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220106_1057220121 25 Left 1057220106 9:93252986-93253008 CCCGGCCCAGTGTGTGTGCAGCC 0: 1
1: 0
2: 2
3: 40
4: 260
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220115_1057220121 2 Left 1057220115 9:93253009-93253031 CCCCTGTGAGCGAGGGGCCCGTC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220109_1057220121 19 Left 1057220109 9:93252992-93253014 CCAGTGTGTGTGCAGCCCCCCTG 0: 1
1: 0
2: 7
3: 18
4: 282
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220108_1057220121 20 Left 1057220108 9:93252991-93253013 CCCAGTGTGTGTGCAGCCCCCCT 0: 1
1: 0
2: 0
3: 14
4: 258
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220104_1057220121 30 Left 1057220104 9:93252981-93253003 CCGTCCCCGGCCCAGTGTGTGTG 0: 1
1: 0
2: 2
3: 41
4: 435
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220116_1057220121 1 Left 1057220116 9:93253010-93253032 CCCTGTGAGCGAGGGGCCCGTCC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220117_1057220121 0 Left 1057220117 9:93253011-93253033 CCTGTGAGCGAGGGGCCCGTCCT 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220114_1057220121 3 Left 1057220114 9:93253008-93253030 CCCCCTGTGAGCGAGGGGCCCGT 0: 1
1: 0
2: 1
3: 6
4: 72
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220107_1057220121 24 Left 1057220107 9:93252987-93253009 CCGGCCCAGTGTGTGTGCAGCCC 0: 1
1: 0
2: 3
3: 26
4: 234
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207
1057220113_1057220121 4 Left 1057220113 9:93253007-93253029 CCCCCCTGTGAGCGAGGGGCCCG 0: 1
1: 1
2: 1
3: 7
4: 114
Right 1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG 0: 1
1: 0
2: 0
3: 20
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057220121 Original CRISPR GCCGCAGAGCCTGCCCTCGC TGG Exonic
900301019 1:1977403-1977425 GCAGCAGAGCCTGCCTTCGAGGG - Intronic
900519447 1:3098547-3098569 GACCCAGAGCCTGGCCTCCCTGG + Intronic
900617926 1:3573659-3573681 GCCCCAGAGCCCGCCCTTCCAGG + Intronic
900782556 1:4627527-4627549 CCTGCAGAGGCTGCCCCCGCTGG - Intergenic
902535933 1:17119379-17119401 GCCGCAGTGCCCGCGCTCGCTGG + Exonic
904003624 1:27351818-27351840 GCCCCACAGCCTGGCCTCCCAGG - Intronic
904521545 1:31099836-31099858 GCCCCAGAGCCTGCCCAGGGTGG + Intergenic
905231071 1:36515287-36515309 CCCCCAGAGCCTGCTCTCCCTGG - Intergenic
906858967 1:49338578-49338600 TCTGCAGAGCCTGCCCAGGCAGG + Intronic
907314188 1:53558149-53558171 GACCAAGAGCCTGCCCTCGGAGG + Intronic
911759505 1:101599736-101599758 GCAGCATAGCCTGCCTTTGCTGG + Intergenic
915334004 1:155130117-155130139 GCTGCAAAGCCTGGCCTCTCAGG + Intronic
916214739 1:162385134-162385156 GCCGCACCGCCTGCCCTGGCCGG - Intronic
916961391 1:169893488-169893510 GCCGCGGAGTCGGTCCTCGCAGG - Intronic
917329067 1:173863018-173863040 GCCGCAGTGCCCGGCCTCCCAGG - Intergenic
1065115117 10:22476989-22477011 GCGACAGGGCCTGCGCTCGCTGG - Intergenic
1068727140 10:60316191-60316213 GCCCCAGAGCCTGCCTTTGATGG - Intronic
1070551391 10:77493409-77493431 ACAGCAGTGCCTGCCCTGGCTGG - Intronic
1070812756 10:79306529-79306551 GCTTCAGAGCCTGCCCTGGTGGG + Intronic
1074218466 10:111411139-111411161 GCCCCAGAGCCTGGCCTGCCTGG - Intergenic
1074399961 10:113133895-113133917 GCTGCAGAACCTACCCCCGCAGG - Intronic
1075100672 10:119503997-119504019 GCTGCAGAGCCTGCCAGGGCTGG - Intronic
1077636046 11:3841558-3841580 TCCCCAGAGCCAGGCCTCGCAGG - Intergenic
1083249203 11:61454466-61454488 GTGGCAGAGCCTGCCCTCTCTGG - Intronic
1083729942 11:64647503-64647525 GCTGCTGACCCTGCCCTCTCTGG + Intronic
1083897378 11:65626815-65626837 ACCGCACAGCCTGCCCTCCTAGG + Intronic
1084198298 11:67538946-67538968 GCTGCAGCGCCTGCCCACGATGG - Intergenic
1085528717 11:77179216-77179238 GCAGCACAGCCTGGCCTCGTTGG + Intronic
1087177470 11:95108763-95108785 GCAGCAGCTCCTTCCCTCGCTGG + Intronic
1088066120 11:105721607-105721629 GCCAAAGATCCTGCCCTAGCAGG + Intronic
1089667876 11:120031904-120031926 GCTGCAGGGGCAGCCCTCGCTGG - Intergenic
1090252797 11:125263281-125263303 GCGGCTGAGCCTGCCCTGGCAGG - Intronic
1090887853 11:130895092-130895114 CCCACCGAGCCTGCCCTCTCTGG - Intronic
1091996718 12:4999701-4999723 GACCCAGCGCCTGCCCTCTCTGG + Intergenic
1093736375 12:22625153-22625175 GCCGCAGAGCATGCCGGGGCTGG - Exonic
1096177833 12:49534820-49534842 GAAGCAGAGCCTGGCCTTGCTGG + Intergenic
1096519099 12:52174108-52174130 GCCCCAGAGCCTGACTTCTCTGG - Intronic
1097990065 12:65824901-65824923 GTCGCAGAGGCTCCTCTCGCGGG - Exonic
1101342754 12:103857784-103857806 GCCGCTGAGCCTGACCTCTGTGG - Intergenic
1101925516 12:108968234-108968256 GCCCCAGAGCCTGACCTCCCTGG - Intronic
1104730837 12:131104471-131104493 GCCCCAGAGCCAGACCTCCCGGG - Intronic
1106954459 13:34920629-34920651 TCTGAAGAGCCTGCCCTAGCAGG - Intergenic
1113801438 13:113088590-113088612 GTCACAGAGCCTGCCCCTGCCGG + Exonic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119182384 14:72613835-72613857 GCCGCACAGCCAGGCCTCCCCGG + Intergenic
1121494752 14:94384481-94384503 TCGGCAGAGCCTGCTCTCGCTGG - Intronic
1121718933 14:96095892-96095914 TCTCCAAAGCCTGCCCTCGCTGG + Intergenic
1122083914 14:99286240-99286262 GACACAGACCCTGCCCTCGGGGG + Intergenic
1122802755 14:104239760-104239782 GCAGCAGGGCCTGCCAGCGCAGG - Intergenic
1122888088 14:104719426-104719448 TCCCCAGGGCCTGCCCACGCTGG - Exonic
1123041207 14:105490941-105490963 ACCGCAGAGTCCGCCCTTGCAGG - Intronic
1123449795 15:20352460-20352482 GCCGGGGAGCCTCCCATCGCAGG + Intergenic
1127262210 15:57334734-57334756 TCCTCAGGCCCTGCCCTCGCGGG + Intergenic
1128213338 15:65917215-65917237 GCCCCCGAGCCTCCCCTCTCAGG + Intronic
1128791705 15:70439106-70439128 TCTGCAGAGCCAGCCCTCGGGGG + Intergenic
1129462433 15:75706265-75706287 GCCAGAGGGCCTGCCCTGGCGGG + Intronic
1131006324 15:88981813-88981835 TCCGCAGGGTCTGCCCTCTCAGG - Intergenic
1131048803 15:89333301-89333323 GAAGCAGAGCCTGCCCTACCTGG - Exonic
1132553396 16:562381-562403 GGCACAGAGCCTGCTCTAGCAGG - Intronic
1132571363 16:645774-645796 GCCCCTCAGCCTGCCCTCACTGG - Intronic
1132576770 16:668014-668036 GCCGCACAGCCTGTCCGCTCTGG + Intronic
1132932234 16:2464563-2464585 GCCGCAGGGGCCGCCCTGGCTGG + Exonic
1133403054 16:5502751-5502773 GCACCAGAGCCTGCCCCCGAAGG + Intergenic
1136514134 16:30757542-30757564 GCTGCTGAGCCTTTCCTCGCTGG + Exonic
1137616948 16:49854446-49854468 GCCCCAGCGCCTTCCCGCGCAGG + Intronic
1140126301 16:72121554-72121576 GCCTCAGAGCCTGCCCCCAAGGG - Intronic
1140400381 16:74666490-74666512 GCTGCGGGGCCTGCCCTGGCCGG - Intronic
1142192931 16:88726173-88726195 GTGGCAGAGCCTGCCCTCCACGG + Intronic
1142270760 16:89088246-89088268 GCCGCAGAGCCTGCAGTGGGAGG + Intergenic
1142367810 16:89659309-89659331 CCCGCAGAGCCTGCCGTCCGAGG + Intronic
1142429772 16:90019623-90019645 CCCGCCGACCCTTCCCTCGCGGG + Intronic
1142976098 17:3645434-3645456 GTAGCAGAGCCTGGCCTGGCAGG + Intronic
1143150844 17:4807092-4807114 GGCTCAGGGCCTGCCCTCGGGGG - Exonic
1144957401 17:19025938-19025960 GAGGCAGAGCCTGTCCTGGCTGG + Intronic
1144977755 17:19148578-19148600 GAGGCAGAGCCTGTCCTGGCTGG - Intronic
1146398527 17:32486869-32486891 GCCTCAGCGCCCTCCCTCGCGGG - Exonic
1146733083 17:35212526-35212548 GCCCCAGACCCTGCCCTAGAGGG - Intergenic
1146943559 17:36859791-36859813 GGGGCAGAGCGTGCCCTCCCTGG + Intergenic
1147726063 17:42566889-42566911 CCCGCCGTGCCTGCCCTCCCCGG - Intergenic
1148676859 17:49450827-49450849 GCCACAGAGCCTGCCTTCCTGGG - Intronic
1151673830 17:75588208-75588230 GCGGCCGAGCCTGCCACCGCCGG + Intergenic
1152111585 17:78360078-78360100 GCCGCGGAGGCCGCGCTCGCGGG + Intergenic
1152276301 17:79359654-79359676 CCTGCAGAGCCAGCCCTCCCTGG - Intronic
1152550617 17:81028166-81028188 CCTCCAGAGCCTGCCCTGGCGGG - Intergenic
1152613717 17:81328552-81328574 GCCCCAGAGCCTGAGTTCGCAGG + Intronic
1153334452 18:3907815-3907837 TCCTCACAGCCTGGCCTCGCTGG - Intronic
1153987872 18:10369007-10369029 TCTGCAGAGTCTGCCCTCCCTGG + Intergenic
1154303075 18:13211754-13211776 GCAGCAGAGCCAGCTCTCTCAGG - Intergenic
1155407121 18:25501383-25501405 GCTCCACAGCCTGGCCTCGCAGG - Intergenic
1157364859 18:47055213-47055235 GCCCCAGAGCTGGCCCTCACTGG - Intronic
1158163001 18:54507309-54507331 GCTTCATAGCCTGCCCTCCCTGG - Intergenic
1158563745 18:58536751-58536773 GCAGCAGAGCCTGTCCCAGCAGG - Exonic
1161075239 19:2282145-2282167 GCCACAGCCCCTGGCCTCGCAGG + Exonic
1161221122 19:3118713-3118735 ACCGCAGACCCTTCCCTCACTGG - Intronic
1162299230 19:9834975-9834997 GCCGCAGAGCCCACCCAGGCGGG - Intergenic
1162478881 19:10916526-10916548 GCCCCACAGCCTGCCTTCTCAGG + Intronic
1162809536 19:13155679-13155701 GCGGCAGAGCCAGCCGTCGGCGG - Intergenic
1163175928 19:15564078-15564100 GCTGCTGAGCCTGTCCTGGCTGG + Intergenic
1163186250 19:15641421-15641443 ACAGCTGAGCCTGTCCTCGCTGG + Exonic
1163190518 19:15673535-15673557 GCTGCTGAGCCTGCCCTGGCTGG + Exonic
1163202667 19:15779884-15779906 GCAGCTGAGCCTGTCCTGGCTGG - Intergenic
1163222835 19:15934381-15934403 GCAGCTGAGCCTGTCCTGGCTGG - Exonic
1163584976 19:18158687-18158709 GCCACAGGACCTGCCCTCTCTGG - Intronic
1163774586 19:19210570-19210592 GGGGCAAAGCCTGCCCTCTCTGG + Intergenic
1163847668 19:19646602-19646624 GAAGCAGATCCTGCCCTCCCTGG + Intronic
1164244930 19:23420576-23420598 GAGGCAGAGCCTCCCCTCACAGG + Intergenic
1166131517 19:40748659-40748681 GCGGCAGAGCCAGCCCACGCAGG - Intronic
1166708043 19:44919405-44919427 CCTGCAGACCCTGCCCTCTCTGG - Intergenic
1167079873 19:47271436-47271458 GCCCCAGAGGCTGCCCCCACCGG + Exonic
1167468930 19:49664802-49664824 GCCACGGATCCTGCCCTGGCTGG - Exonic
1167772472 19:51529922-51529944 GCCGCAGAGCCTGGCCCTCCAGG + Exonic
1167784806 19:51628032-51628054 GCCGCAGAGCCTGGCCCTCCAGG + Exonic
926914481 2:17879008-17879030 TCCCCAGAGCCCGCCGTCGCTGG + Intronic
927133691 2:20081272-20081294 GCTGCAGGCCCTGCCCTCACTGG - Intergenic
927704035 2:25286198-25286220 GCCTCAGAGCCGGCCCTCATAGG - Intronic
931445517 2:62324027-62324049 GCCACATAGCCAGCCCTGGCTGG + Intergenic
932759919 2:74432567-74432589 CCTCCAGAGCCTGCTCTCGCTGG + Exonic
932793392 2:74674753-74674775 GCGGGAGAGCCTGCCCCCTCTGG - Intronic
934854992 2:97724144-97724166 GCGCCAGTGCCTGCGCTCGCTGG + Exonic
936985881 2:118310987-118311009 ACCGCAGAGCCTGGGCTCGCCGG - Intergenic
938127287 2:128683788-128683810 GCCACAGAGCCCGGCCTTGCTGG - Intergenic
938312260 2:130301196-130301218 GCCACCGAGGCTCCCCTCGCTGG + Intergenic
938485717 2:131705697-131705719 TCTGAAGAGCCTGCCCTAGCAGG - Intergenic
940908156 2:159187048-159187070 GCCGGAGACCCAGCCCTGGCCGG + Intronic
947625373 2:231615150-231615172 GCCACCGATCCTGCCCGCGCCGG + Intergenic
948693502 2:239721252-239721274 GAGGCAGGGCCTGCCCTGGCAGG + Intergenic
948709958 2:239819312-239819334 CTTGCAGAGCATGCCCTCGCTGG - Intergenic
1171313636 20:24166900-24166922 GCCTCAGCGCCTGGCCTCCCAGG + Intergenic
1171788638 20:29497588-29497610 GCGGCTTAGGCTGCCCTCGCCGG + Intergenic
1174199101 20:48794583-48794605 TCTGCAGAGGCTGCCCTGGCAGG - Intronic
1174663449 20:52235516-52235538 ACTGCAGACCCTGCCCTCCCTGG + Intergenic
1175372518 20:58501483-58501505 TCTGCAGAGCCTGCCCTCCCTGG - Intronic
1176140803 20:63544240-63544262 GCCCCCGAGGCTGCTCTCGCTGG + Exonic
1179800507 21:43809623-43809645 GCTGCAGGGCCTACCCTCGCCGG - Intergenic
1180920302 22:19518260-19518282 GCCCCAGACCCAGCCCACGCAGG - Intronic
1180997223 22:19971568-19971590 GCAGCAGGTCCTGCCATCGCTGG + Intronic
1183029750 22:35094654-35094676 GCCTCAGACCCTGCCCTAACTGG - Intergenic
1183191107 22:36322567-36322589 GCTGCCGAGCCTGCCCTGCCTGG + Intronic
1183298635 22:37047005-37047027 GCCTCAGAGCCTGGTCTTGCTGG - Intergenic
1184677729 22:46052884-46052906 GCCGCAGAGCCTCCCCAGGCAGG + Intronic
1184679162 22:46061309-46061331 GCCGCAGAGCCCCCTCTCCCGGG + Intronic
1184858376 22:47158819-47158841 GACGCAGGTCCTGCCCTGGCTGG - Intronic
1185076104 22:48683550-48683572 GCCACAGACCGTGCACTCGCTGG + Intronic
1185309651 22:50147059-50147081 GCCGAAGAGCCAGTCCTCACTGG + Intronic
949987558 3:9552801-9552823 GCCCCAGGCCCCGCCCTCGCGGG - Exonic
950004336 3:9681987-9682009 TCGGCAGGGCCTGCCCTCCCCGG + Intronic
950432872 3:12961111-12961133 GCTGCAGAGCCTGGCCTCAGGGG - Intronic
953351632 3:42220604-42220626 CCAGCAGTGCCTGCCCTGGCAGG + Intronic
954297167 3:49680703-49680725 GCCCCAGAGTCTGACCTGGCTGG + Intronic
954301046 3:49700953-49700975 GCCACAGGGCCTGCCCTCTTCGG + Intronic
954691716 3:52399249-52399271 GCCTCAGAGCCTCTCCTCCCTGG - Intronic
958627662 3:96646684-96646706 TCCACAGACCCTGCACTCGCAGG - Intergenic
959159201 3:102703546-102703568 CCTGCAGAGACTGCCCTAGCAGG - Intergenic
959817707 3:110694213-110694235 GCCATAGAGCCTGCCCTCTAGGG - Intergenic
960623660 3:119660063-119660085 GACGCTGTGCCTGCCCTTGCAGG - Exonic
962311853 3:134332449-134332471 GTTGCAGACCCTGCCCTCCCGGG + Intergenic
962370184 3:134814712-134814734 GATGCAGAGCCTTCCCTCACAGG - Intronic
964344658 3:155744219-155744241 GGCGCAGAGCGTGCCGCCGCGGG + Intronic
968945601 4:3661967-3661989 GCTGCAGAGGCTGCCCTCCTAGG + Intergenic
969601623 4:8179789-8179811 GCCCCAGGGCCTGGCCTCCCTGG + Intergenic
969619014 4:8269695-8269717 ACCGCCCAGCCCGCCCTCGCTGG - Intergenic
969619138 4:8270135-8270157 GCCACAGGGCTCGCCCTCGCTGG - Exonic
973551336 4:52038420-52038442 GCCGCAGAGCCTGAGCCCGCAGG - Exonic
977225073 4:94385163-94385185 GTAGCATAGCCTGCCTTCGCTGG + Intergenic
983919891 4:173334123-173334145 TCCACAGACCCAGCCCTCGCCGG + Intronic
985437036 4:189940580-189940602 GCGGCTCAGGCTGCCCTCGCTGG - Intergenic
985700577 5:1369541-1369563 GCAGCTGAGCCTGCCCAAGCTGG + Intergenic
992993736 5:82312449-82312471 GCTGCAGAGCCTTCCCTGGATGG - Intronic
994245641 5:97472160-97472182 CCCGCAGAGCCTGCCATCCTAGG - Intergenic
999720769 5:154397838-154397860 GCCCCAGCCCCTGCCCTCTCGGG + Intronic
1002665777 5:180823483-180823505 GCTGCAGCTCCTGCCCTGGCAGG - Intergenic
1002927867 6:1615098-1615120 GCCGCAGCGCCGGCCCGGGCAGG - Intergenic
1006389716 6:33751261-33751283 GCATCAGAGCCTGCCCTGTCGGG + Intergenic
1007345714 6:41228250-41228272 TCTGCAGAGCCCGCCCTCCCAGG + Intergenic
1009431795 6:63573126-63573148 GCCGCGGAGCCTGCCATGCCCGG - Intronic
1011481316 6:87796607-87796629 GCGGCACATCCTGCCCTTGCAGG + Intergenic
1011614356 6:89184400-89184422 GTCACAGAGCATGCCCCCGCAGG + Intronic
1013196289 6:107848017-107848039 GCCTCAGAGCCTCTCCTAGCCGG - Intergenic
1015455740 6:133424591-133424613 GCAGCTGTGCCTGCCCTCCCAGG - Intronic
1015605646 6:134952520-134952542 GCCACTGTGCCTGGCCTCGCTGG + Intergenic
1017744293 6:157432995-157433017 GCAGCAGAGCCGCCCCACGCCGG - Intronic
1018256758 6:161928157-161928179 TCAGCAGAGCCTGACCTTGCTGG + Intronic
1018683590 6:166284546-166284568 GGAGCAGAGCCTGCCCTCACGGG - Intergenic
1019388725 7:773577-773599 GCCGCAGCGACTGTCCTTGCTGG + Intronic
1019689656 7:2403581-2403603 CCCCCAGAGGCAGCCCTCGCCGG - Exonic
1020012734 7:4815517-4815539 TCCCCAGAGCCTGCCCTTCCCGG + Intronic
1020100731 7:5393039-5393061 GCCTCAGAGCCAGCCCTGCCCGG - Intronic
1022151989 7:27617807-27617829 GGTGCAGTGCCTGCCCTTGCAGG - Intronic
1023435226 7:40134911-40134933 GCCGCAGACCCCGCCCCCGCCGG - Intergenic
1023791897 7:43759046-43759068 GACGCCGAGCCTGCCCTCTTGGG - Intronic
1031029273 7:116716898-116716920 ACCGCAGAGCATGCCCTCTCTGG + Intronic
1032106359 7:129034601-129034623 GCCACCGCGCCTGGCCTCGCAGG - Intronic
1032501414 7:132403068-132403090 GCTGCCCAGCCTGCCCTCTCTGG - Intronic
1035524592 8:302514-302536 GGCTCAGAGCCTGCACTTGCTGG + Intergenic
1035628396 8:1090422-1090444 GCCCAAGAGCCTGCCCTGCCTGG - Intergenic
1036671164 8:10789086-10789108 GCTGCAGCGCCTTCCCTCACGGG + Intronic
1040909145 8:52501017-52501039 GCTGCGGAGCCAGCCCTCGTGGG + Intergenic
1042020639 8:64369641-64369663 GCCGCAGATGCGGCCCTGGCGGG - Intergenic
1045479757 8:102582596-102582618 GCTTCAGAGCCTCCCATCGCTGG - Intergenic
1049161801 8:141102806-141102828 GCCTCAGAGCCTGCGCCAGCAGG - Intergenic
1049236672 8:141515590-141515612 GCCCCAGCTCCTGCCCTCGAGGG + Intronic
1049660117 8:143816034-143816056 GCCGCAGAGCCGGCCGTCCAAGG - Intergenic
1049832492 8:144710937-144710959 CCTGCAGAGCCTGGCCTTGCAGG + Intergenic
1051560874 9:18438769-18438791 GGCGCAGAGTCTGCACACGCCGG + Intergenic
1054805330 9:69391741-69391763 GCCGCTCAGCCTCCACTCGCCGG - Exonic
1056707641 9:88965646-88965668 GCCTGAAAGTCTGCCCTCGCAGG - Intergenic
1057116237 9:92525023-92525045 GCCACAGTGCCTGGCCTCTCAGG - Intronic
1057220121 9:93253034-93253056 GCCGCAGAGCCTGCCCTCGCTGG + Exonic
1057422335 9:94922359-94922381 GCTGCAGACCCTGCCCACGCAGG + Intronic
1057869208 9:98706194-98706216 GCCGCTGAGCCTGCCAGCTCAGG + Intronic
1059375222 9:113876137-113876159 GCCGCCGAGCCGCCCCTCGCGGG - Intergenic
1060974361 9:127755514-127755536 GAGGCAGAACCTCCCCTCGCTGG - Intronic
1061259309 9:129470998-129471020 GCCACAGTGCCTGGCCTCCCTGG + Intergenic
1062025225 9:134337168-134337190 GCCCCAGTGCCTGCCCTTGTTGG + Intronic
1062162523 9:135088055-135088077 GTCCCAGACGCTGCCCTCGCTGG + Exonic
1062339450 9:136087506-136087528 GCGACAGAGCCAGTCCTCGCAGG + Intronic
1062463631 9:136671949-136671971 ACTGCACAGCCTGGCCTCGCAGG + Exonic
1062566999 9:137167932-137167954 GCCCCAGAGACTGCCCACCCTGG + Exonic
1062583968 9:137240771-137240793 GCCACCGAGCCTGCCCTTCCCGG + Intergenic
1062621916 9:137426657-137426679 CCCACAGAGCCTGCCCTCCTGGG - Intronic
1062627322 9:137449194-137449216 GCCGCAGAGGCTGCAGTCCCTGG - Exonic
1188007571 X:25026617-25026639 GCCCCAGAGCCTCTCCTGGCGGG + Intergenic
1189360110 X:40343677-40343699 GCAGCTGAGGCTGCCCTCCCAGG + Intergenic
1189659157 X:43278704-43278726 GCCGCAGCCCATGCCCACGCTGG + Intergenic
1190108444 X:47574519-47574541 GCAGCAGCGCCCGCCCCCGCAGG - Exonic
1192361819 X:70445366-70445388 CTCGCAGACCTTGCCCTCGCAGG + Exonic
1192764199 X:74125805-74125827 ACAGCATAGCCTGCCCTTGCTGG + Intergenic
1200234108 X:154459993-154460015 GCCCCCAAGCCTGCCCTCGCTGG + Intronic