ID: 1057220351

View in Genome Browser
Species Human (GRCh38)
Location 9:93254326-93254348
Sequence CCTCGTGAGCAGCTCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057220346_1057220351 -3 Left 1057220346 9:93254306-93254328 CCGGGCCAAGCTCCTTCTTCCCT 0: 1
1: 2
2: 7
3: 48
4: 491
Right 1057220351 9:93254326-93254348 CCTCGTGAGCAGCTCCTGCCTGG No data
1057220345_1057220351 9 Left 1057220345 9:93254294-93254316 CCACTGTGTACTCCGGGCCAAGC 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1057220351 9:93254326-93254348 CCTCGTGAGCAGCTCCTGCCTGG No data
1057220347_1057220351 -8 Left 1057220347 9:93254311-93254333 CCAAGCTCCTTCTTCCCTCGTGA 0: 1
1: 0
2: 3
3: 21
4: 229
Right 1057220351 9:93254326-93254348 CCTCGTGAGCAGCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057220351 Original CRISPR CCTCGTGAGCAGCTCCTGCC TGG Intronic
No off target data available for this crispr