ID: 1057220931

View in Genome Browser
Species Human (GRCh38)
Location 9:93257394-93257416
Sequence GTAGAGAAGGTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 594
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 536}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057220931_1057220939 -1 Left 1057220931 9:93257394-93257416 CCCTCCAGCCTCACCTTCTCTAC 0: 1
1: 0
2: 5
3: 52
4: 536
Right 1057220939 9:93257416-93257438 CCAACCTGGCAGGCTGCTCTTGG No data
1057220931_1057220941 9 Left 1057220931 9:93257394-93257416 CCCTCCAGCCTCACCTTCTCTAC 0: 1
1: 0
2: 5
3: 52
4: 536
Right 1057220941 9:93257426-93257448 AGGCTGCTCTTGGTCCTTCCAGG No data
1057220931_1057220943 24 Left 1057220931 9:93257394-93257416 CCCTCCAGCCTCACCTTCTCTAC 0: 1
1: 0
2: 5
3: 52
4: 536
Right 1057220943 9:93257441-93257463 CTTCCAGGCCATGACCTCCCTGG No data
1057220931_1057220944 25 Left 1057220931 9:93257394-93257416 CCCTCCAGCCTCACCTTCTCTAC 0: 1
1: 0
2: 5
3: 52
4: 536
Right 1057220944 9:93257442-93257464 TTCCAGGCCATGACCTCCCTGGG No data
1057220931_1057220945 26 Left 1057220931 9:93257394-93257416 CCCTCCAGCCTCACCTTCTCTAC 0: 1
1: 0
2: 5
3: 52
4: 536
Right 1057220945 9:93257443-93257465 TCCAGGCCATGACCTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057220931 Original CRISPR GTAGAGAAGGTGAGGCTGGA GGG (reversed) Intronic
900870904 1:5302080-5302102 GTAGAGAAGGGAAGGATGGGTGG + Intergenic
900907523 1:5571372-5571394 TTAGACAAGTTGAGGCTGGATGG + Intergenic
901180750 1:7340288-7340310 CTGGAGAAGGTAAGACTGGAGGG + Intronic
901435120 1:9242856-9242878 GGAGAGAAGGAGAAGCTGCAAGG - Intronic
901505291 1:9681343-9681365 CTTGAGAGGGTGAGGCTGGAGGG - Intronic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902780519 1:18701917-18701939 GGAGAGAAGGTGAGCCTTGTAGG + Intronic
903259672 1:22124593-22124615 GAAGAAAAGGTGAGGCTTGGTGG + Intronic
903329922 1:22592131-22592153 GTGGTGATGGTGAGGCAGGAGGG - Intronic
903345165 1:22679837-22679859 GGAGAGACGGGGAGGCAGGAAGG - Intergenic
903780061 1:25815290-25815312 GTAGAAGAGGTGATGTTGGAAGG + Intronic
904271972 1:29356097-29356119 GAAGAGAAGGGAATGCTGGAGGG - Intergenic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
905114254 1:35623708-35623730 GTAGAGAAGATGAGGCCTCAAGG + Intronic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
906197381 1:43937280-43937302 GTTGGGAAGAAGAGGCTGGATGG + Intergenic
906532239 1:46530533-46530555 CTACACATGGTGAGGCTGGAGGG - Intergenic
906718537 1:47988492-47988514 GGAGAGCAGCTGAGGCTGGGTGG + Intronic
906790196 1:48652478-48652500 GAGGAGGAGGTGAGGCAGGATGG + Intronic
907456668 1:54580776-54580798 ATGGAGATGGTGAGGCTGCAGGG + Intronic
908174540 1:61541423-61541445 ATAGAGGAAGGGAGGCTGGAAGG + Intergenic
911007223 1:93239543-93239565 TTTGAGATGGTGGGGCTGGAAGG + Intronic
911786529 1:101956471-101956493 GAAGAGAAGGTGAGGGTAGATGG - Intronic
912904833 1:113693357-113693379 GTAAAGGAGGTGAAGCTGGAAGG + Intergenic
913248478 1:116891515-116891537 GTTGTGAAAGTGAAGCTGGAGGG + Intergenic
914418890 1:147510228-147510250 ATAAAGAAAGTGAGGCTGCAGGG + Intergenic
915067925 1:153242227-153242249 GCAGAGAAACTGCGGCTGGAGGG + Intergenic
916323704 1:163533847-163533869 GTTAAGAAGGTGGGGCTGGGTGG - Intergenic
916415477 1:164588696-164588718 GGAGAGAGAGAGAGGCTGGAGGG + Intronic
916584321 1:166137091-166137113 GTAGAGAGCATGAGGTTGGAAGG + Intronic
916604363 1:166326400-166326422 ATGGGGAAGGTGAGGCTTGAGGG - Intergenic
917896458 1:179493168-179493190 GGTGACAAGATGAGGCTGGAAGG - Intronic
918924322 1:190761495-190761517 GTAGTGAAGGTGAGGGAGGATGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
920491128 1:206416227-206416249 GCAGAGGAGGCGAGGGTGGAGGG - Intronic
920850424 1:209624546-209624568 GTGGAGAATGTGAGGCTTGGAGG - Intronic
921736980 1:218640017-218640039 GTAGATAGGGTTTGGCTGGAAGG + Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
924387543 1:243513126-243513148 TTAGGGAAGGTGGGGGTGGAAGG + Intronic
1062942687 10:1435765-1435787 GCAGGCAACGTGAGGCTGGAAGG + Intronic
1063519890 10:6731649-6731671 GAAGAGAAGGTGAGGCTCACAGG - Intergenic
1063968921 10:11367856-11367878 GGAGAGGAGGAGAAGCTGGAGGG - Intergenic
1064346749 10:14539839-14539861 GTAGAGGAAGTGAGGGTGCAGGG - Intronic
1065204518 10:23344249-23344271 GTAGAGGAGGTGTGGAGGGAAGG + Intronic
1066095147 10:32065212-32065234 TTTGAGAAGCTGAGGCTGGTGGG - Intergenic
1067188505 10:44050383-44050405 TTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1067190559 10:44064491-44064513 GGAGGGGAGGGGAGGCTGGAGGG - Intergenic
1068931525 10:62595346-62595368 GTGGAGGATGTGTGGCTGGAAGG - Intronic
1070550479 10:77487102-77487124 GGAGAGAAAGTTAGGCAGGACGG - Intronic
1070561834 10:77573774-77573796 GTATACAGGGTGAGTCTGGAAGG - Intronic
1070625419 10:78047632-78047654 GTAGGGAAGCTGAACCTGGAGGG + Intronic
1070736189 10:78865347-78865369 GCAGAGCAGCTGGGGCTGGAAGG - Intergenic
1070833362 10:79433545-79433567 TTAGCGAAGGTGGGGCTGGCAGG + Intronic
1071490109 10:86130511-86130533 GTAGAGAAGGAGAGGAGAGAAGG + Intronic
1071563741 10:86661222-86661244 GAAGAGAAGGTGTGTCAGGAGGG + Intronic
1071671548 10:87613622-87613644 GTTGGGAAGCTGAGGCTGGAGGG + Intergenic
1073355203 10:102848334-102848356 GGAGAGTAGCAGAGGCTGGAAGG + Intergenic
1074147438 10:110729357-110729379 GGTGAGAAGGAGAGGCAGGAAGG - Intronic
1074211521 10:111339755-111339777 GTAAAGAAGGTGGGGGTGGGGGG + Intergenic
1074339965 10:112618867-112618889 TAAGAGGAGGTGAGGTTGGAAGG + Intronic
1074557742 10:114507622-114507644 GTACAGCAGGTGTGGCTGGCAGG - Intronic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1074967119 10:118501183-118501205 GCAGAGCAGATGAGGCAGGAAGG - Intergenic
1075278053 10:121113027-121113049 GCAGCAAAGCTGAGGCTGGAGGG + Intergenic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1075672175 10:124270303-124270325 TTGGGGAAGGTGAGGCTGGAGGG - Intergenic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1076128120 10:127992150-127992172 GGTGAGAAAGGGAGGCTGGAGGG + Intronic
1076404662 10:130203843-130203865 GTAGAGAAGGTGGGCAGGGATGG - Intergenic
1076508267 10:130993367-130993389 GCAGAGCAGGTGAGGCTTGGTGG - Intergenic
1076668219 10:132104794-132104816 TTGGACATGGTGAGGCTGGATGG - Exonic
1077159220 11:1105072-1105094 GTGGGGAAGGCCAGGCTGGAGGG + Intergenic
1077478201 11:2800890-2800912 GAGGAGAAGGTGTGGCTGGCAGG + Intronic
1079002957 11:16773094-16773116 CTCGGGAAGGTGAGGTTGGAGGG - Intergenic
1079240630 11:18720050-18720072 GAAGAAGAGGTGAGGCTGGCAGG - Exonic
1079452514 11:20609614-20609636 AGAGAGAAGGTGAGACTGGAAGG - Intronic
1079959566 11:26906446-26906468 CTCGAGAGGCTGAGGCTGGAGGG - Intergenic
1080154753 11:29096556-29096578 GGAGAGAAGGAGAGGCTAAAGGG + Intergenic
1080289215 11:30652239-30652261 TAATAGAAGGTGAGGCTAGAGGG + Intergenic
1081437393 11:43041803-43041825 GTAGAGTAGGTGTTGCTGAAAGG - Intergenic
1082739712 11:56897312-56897334 GTAGAGAAGATGAGGCATGAAGG + Intergenic
1082771648 11:57212382-57212404 GTAGAGAAAATGGTGCTGGAGGG - Intergenic
1082772543 11:57219616-57219638 TGACAGGAGGTGAGGCTGGAGGG - Intergenic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1083804913 11:65067767-65067789 GTAGTGAAGGTCAGGCCAGAGGG + Intronic
1084032506 11:66489214-66489236 GGGGACAAGGAGAGGCTGGAGGG - Intronic
1084566652 11:69932504-69932526 GTAGAGAAGCTGGGGCTGGGAGG - Intergenic
1084964351 11:72736664-72736686 AGAGAGAAGGAGAGGCAGGATGG - Intronic
1085306306 11:75488020-75488042 GAATGGAAGGGGAGGCTGGATGG - Intronic
1085473253 11:76771538-76771560 GTGGAGAGGTGGAGGCTGGAAGG + Intergenic
1086162273 11:83735131-83735153 TTAGAGAGGGTTAGGATGGAAGG + Intronic
1086846444 11:91755582-91755604 CTAGTTAAGGTGATGCTGGAGGG - Intergenic
1086860863 11:91923384-91923406 GGAGAGAAGCTGAGGATGGGAGG - Intergenic
1087211450 11:95449523-95449545 ATACAGAAGGTGAGTCTTGAAGG + Intergenic
1088965578 11:114717748-114717770 GTCGAGAAGATGAGGGAGGAGGG - Intergenic
1088993834 11:114978510-114978532 GTGGAGGATGTGTGGCTGGATGG + Intergenic
1089127070 11:116184058-116184080 ATGGAGAAAGTGAGGCTGAAGGG - Intergenic
1091387888 12:106320-106342 GAAGCGAAAGTGAGGCAGGAAGG + Intronic
1091726484 12:2849827-2849849 GTGGAAAAGGTGAGACTTGAAGG - Intronic
1092048795 12:5453357-5453379 TTAGGGAAGGGGAGGCAGGAGGG - Intronic
1092164678 12:6335745-6335767 GTGGAGTTGGTGAGGCTGGGTGG - Intronic
1092887138 12:12934775-12934797 GCAGAGAGGGAGGGGCTGGAGGG + Intergenic
1094274292 12:28653831-28653853 TTAGGGAGGGTGAGGCTGGCGGG + Intergenic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1096411011 12:51377181-51377203 GCACAGAGGGTGAGGCTGGAGGG - Exonic
1099648953 12:85399589-85399611 GAAGAGAATGTGGTGCTGGACGG + Intergenic
1099924083 12:88996245-88996267 GTATAGAAGATGGAGCTGGAGGG + Intergenic
1100365711 12:93918558-93918580 GTAGAGAAGCTGGCGCGGGAAGG - Intergenic
1100436271 12:94574084-94574106 TAAGAGAATGTGAGGCTTGATGG + Intronic
1100436606 12:94576921-94576943 CTAGAGAAGGCGGGACTGGAAGG - Intronic
1101134154 12:101722608-101722630 TTTGAGAAGCTGAGGCTGGGAGG + Intronic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102037930 12:109782839-109782861 GTGGGGAAGGTGGGGGTGGAGGG - Intergenic
1102147321 12:110664160-110664182 CTCGGGAAGCTGAGGCTGGAAGG - Intronic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1103485868 12:121282252-121282274 GTGGGGAAGGAGGGGCTGGAAGG + Intronic
1103722353 12:122981563-122981585 AGGGAGAAGGTGAGGCTGGAAGG - Exonic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1104490213 12:129187409-129187431 GGAGATAAGGTGAGTCTGGGAGG + Intronic
1104831939 12:131758264-131758286 GTGGAGAAGGTCACGCTGGTTGG - Intronic
1104996482 12:132660935-132660957 TCAGAGCAGGTGAGGGTGGAGGG + Intronic
1105384903 13:19920610-19920632 GGAGAGAAGGAGAGTCGGGAGGG + Intergenic
1105590053 13:21784369-21784391 GGAGAAAAGGTGAGGTTAGAGGG + Intergenic
1105635820 13:22214412-22214434 CTAGAGAGGGAGAGGCTGGAGGG - Intergenic
1106310403 13:28549198-28549220 GCAGGGAAGGTGAGACAGGAGGG + Intergenic
1106401669 13:29437020-29437042 GTGGGGAAGGAGTGGCTGGAAGG - Intronic
1106485702 13:30170850-30170872 GTAGAGAAGGGGAGGCAGAGAGG - Intergenic
1106580075 13:31010170-31010192 GCAGAGAAGACGAAGCTGGAAGG - Intergenic
1106843548 13:33712293-33712315 GGTTAGAAGTTGAGGCTGGAGGG - Intergenic
1110158894 13:72352140-72352162 GCAGAGATGATGAGGGTGGATGG + Intergenic
1110657627 13:78019017-78019039 GTAGACAAGGTCAGGGTGGGAGG + Intergenic
1111802633 13:92998971-92998993 GTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1112620587 13:101050306-101050328 TAAGAGCAGGTGAGTCTGGAGGG + Intergenic
1112845048 13:103631699-103631721 GTTGAGAGGCTGAGGCAGGAGGG + Intergenic
1113045736 13:106152785-106152807 GTGGAGAATGTGAGGCTGAGGGG + Intergenic
1113759890 13:112840105-112840127 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759900 13:112840137-112840159 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759923 13:112840201-112840223 GTGGGGAGGCTGAGGCTGGACGG - Intronic
1113759932 13:112840233-112840255 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759942 13:112840265-112840287 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759952 13:112840297-112840319 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113759998 13:112840457-112840479 GTAGGGAGGCTGAGGCTGGGGGG - Intronic
1113760009 13:112840489-112840511 GTGGGGAGGCTGAGGCTGGAGGG - Intronic
1113760019 13:112840522-112840544 GTAGGGAGGCTGAGGCTGGGGGG - Intronic
1114423008 14:22600311-22600333 CTTGAAAAGCTGAGGCTGGAAGG + Intronic
1114747509 14:25165923-25165945 GAAGAAAATGTGAAGCTGGAGGG + Intergenic
1116547440 14:46186556-46186578 GTGGCGGGGGTGAGGCTGGAGGG - Intergenic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1117601973 14:57385531-57385553 GTAGAAATGTTGAGGATGGATGG + Intergenic
1118349238 14:64961595-64961617 GTTAAGATGATGAGGCTGGAGGG - Intronic
1118780601 14:69005312-69005334 CTAGGGAAGGTGAGGCTGGGAGG - Intergenic
1118905273 14:70018960-70018982 TTAGAGAAGGTAAGGCGGGACGG - Intronic
1119765178 14:77183300-77183322 GCTGAGAAGCTGAGGCTGCAAGG + Intronic
1120204555 14:81573849-81573871 GAAAAGAAGGTGAGGATAGAAGG - Intergenic
1120587893 14:86337987-86338009 GTAGTGAGGGTAAGGTTGGAGGG - Intergenic
1121554908 14:94829133-94829155 GGAGACCAGGTGAGGCTGCAGGG - Intergenic
1121712826 14:96052224-96052246 GCAGAGACGGCCAGGCTGGAAGG - Intronic
1122214557 14:100194225-100194247 GTGGTGGAGGTGGGGCTGGATGG - Intergenic
1122420203 14:101571624-101571646 GGACAAAAGGTGACGCTGGAAGG + Intergenic
1122961316 14:105094723-105094745 GCATGGAAGATGAGGCTGGAGGG + Intergenic
1124374902 15:29123800-29123822 GTTGAGAAGGGGAGGAGGGATGG - Intronic
1125364939 15:38903570-38903592 ATAGAGCAGGGGAGGTTGGAAGG - Intergenic
1126960956 15:53993532-53993554 TGAGAGAAGGTGAGGATGGGAGG + Intergenic
1127346926 15:58110324-58110346 ATGGAGAAGGTGAGGGTAGAAGG + Intronic
1128185079 15:65637958-65637980 TTATAGAAGGTCAGACTGGAGGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1129011752 15:72424855-72424877 GTGGCAAAGATGAGGCTGGAAGG + Intergenic
1129183287 15:73890365-73890387 GCAGAGAAGGTGTTGCTGGGGGG - Intergenic
1129242059 15:74257666-74257688 GGAGAGAAGGTGAGGCTTGAGGG - Intronic
1129326832 15:74804413-74804435 GAAGAGATGCTGAGACTGGAGGG + Intergenic
1129515336 15:76153759-76153781 GGGGAGTAGGTGAGGCCGGAAGG + Intronic
1129737872 15:77975950-77975972 GGAGAGGAGGAGAGGCGGGAGGG - Intergenic
1129898847 15:79130091-79130113 GGATAGAAAGTGAGGCTGAAAGG - Intergenic
1129899076 15:79131736-79131758 GGATAGAAAGTGAGGCTGAAAGG - Intergenic
1130856023 15:87840841-87840863 ATAGAGAAAGTGAGGGAGGAAGG + Intergenic
1130971868 15:88739950-88739972 GTGGAGAAGGTGAGGCATAATGG + Intergenic
1131399367 15:92112250-92112272 TTAGAAAAGGTCATGCTGGAAGG + Intronic
1131435078 15:92415924-92415946 GAAAAGAAGATGAGGCTGAAGGG + Intronic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133014757 16:2934189-2934211 GTGGGGCAGGTCAGGCTGGAAGG - Intronic
1133415854 16:5606460-5606482 AGAGAGAAGGTGAGGAAGGAAGG - Intergenic
1134197825 16:12172417-12172439 GAAGAGAAGAGGATGCTGGATGG + Intronic
1134885455 16:17786914-17786936 GCAGTGAGGGTGAGGGTGGAGGG - Intergenic
1135170415 16:20178747-20178769 GTAGAGAAGGGGGCTCTGGAGGG - Intergenic
1136003952 16:27315571-27315593 GTAGAGCAGGGGAGTCTGGCAGG + Intronic
1136532114 16:30876697-30876719 AGAGAGAAGGGGAGGGTGGAGGG + Intronic
1136604200 16:31321619-31321641 TAAGAGAAGGTGAGGCTTGGTGG + Exonic
1137542357 16:49373592-49373614 GTAGAGGTGGAGAGGCTGCAAGG + Intergenic
1137579073 16:49622406-49622428 GCAGAGCAGGTGAGTCTGGGGGG - Intronic
1137721600 16:50630640-50630662 GGGGAGGAGGTGAGGCTAGATGG + Intronic
1137868155 16:51922836-51922858 GTATAGAATGTGAGTCTTGAAGG + Intergenic
1138083135 16:54110745-54110767 GGAGAGAAGGCGGGGGTGGAGGG + Intronic
1139578553 16:67857861-67857883 GGACAGAAGGTGTGGGTGGAGGG + Intronic
1140115677 16:72039413-72039435 TTGGAGAAGCTGCGGCTGGAGGG + Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1140823915 16:78688593-78688615 GTAGAGAAGCAGTGGCTGGAAGG - Intronic
1141115449 16:81304814-81304836 GGAGAGAAGTTCAGGCAGGAGGG + Intergenic
1141422687 16:83926853-83926875 GCAGAGCAGAGGAGGCTGGAGGG - Exonic
1141914436 16:87085430-87085452 GGAGAGAAGGGGATGCTGCATGG - Intronic
1142051186 16:87959434-87959456 GTAGAGAGGCAGTGGCTGGATGG + Intronic
1142392179 16:89808870-89808892 GATGAGAAGGGGAGGCTGCAGGG - Intronic
1142655983 17:1394496-1394518 CTAGGGAAGCTGAGGCAGGAGGG + Intronic
1142967003 17:3588042-3588064 GTGGGGAACGTGAGGCTGCAGGG + Intronic
1143090941 17:4448873-4448895 CTGGAGAATGTGATGCTGGATGG + Intronic
1143129890 17:4671639-4671661 GGCGAGAAGGTGGGGCTGGCGGG - Intronic
1143310537 17:5984916-5984938 TTAGAGGAGATGAGGTTGGAAGG + Intronic
1143481201 17:7228169-7228191 CTAGAGAAGGTGAGGGTGGAAGG + Intronic
1144996921 17:19276104-19276126 GTGGGGAAGGTGTGGCTGGTGGG + Intronic
1145247645 17:21280083-21280105 ACAGAGAAGAGGAGGCTGGATGG + Intergenic
1146057189 17:29587397-29587419 GGTGAGAAGGTGAGGATGGTGGG - Intronic
1146376298 17:32296960-32296982 CTAGAGAAGCTGAGGCTGGCAGG - Intronic
1146935923 17:36812762-36812784 GAAGAGATGGGGTGGCTGGAAGG + Intergenic
1147795678 17:43040778-43040800 GAAGAGAAAGCCAGGCTGGAGGG - Intergenic
1148350343 17:46937126-46937148 GTAGGGAAGGACAGGCTGGATGG + Intronic
1148575582 17:48708411-48708433 GGAGAGAAGGTGCGGGTGGTAGG + Intergenic
1148701142 17:49587717-49587739 GAAGAGCAGGTGTGGCAGGAAGG + Intergenic
1148725929 17:49789813-49789835 GTATACAAGGTGTTGCTGGAAGG + Intronic
1149249384 17:54750346-54750368 GAAGAGAAGGTGAAGCAAGATGG - Intergenic
1149652386 17:58284081-58284103 GTGGACAGGGTGAGGCTGGTGGG + Intergenic
1150007357 17:61478126-61478148 TGAGAAGAGGTGAGGCTGGAGGG + Intronic
1150152244 17:62819590-62819612 GAAGAGAAGGAGAGGAAGGATGG - Intergenic
1150202277 17:63369920-63369942 GTAGGGAAGGTAAGGATGGAGGG - Intronic
1150605573 17:66687781-66687803 GTAGAGAAGGGGAAGAAGGAAGG + Intronic
1150722781 17:67627737-67627759 GCAGAGAAGCTCAGACTGGAGGG - Intronic
1150811897 17:68363355-68363377 GGAAGGAAGGTCAGGCTGGAAGG + Intronic
1150989429 17:70238733-70238755 GCAAAGAAGCTGAGGCTGAAAGG + Intergenic
1151990565 17:77571397-77571419 GGAGAGGAGGGGAGGCGGGAGGG + Intergenic
1152107548 17:78339924-78339946 GTAGAGACGGTGGGGGTGGGGGG - Intergenic
1152326661 17:79645533-79645555 GGAGAGAAGGGGCAGCTGGAAGG - Intergenic
1153303908 18:3615288-3615310 GTAGAAAAGCTGGGACTGGAAGG + Intronic
1153914036 18:9730269-9730291 AAAGATAAGGTGAGGCTCGAAGG - Intronic
1155348368 18:24881264-24881286 GTAGAGTAGGTGAACCTAGAAGG - Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1156063637 18:33114125-33114147 GTAGCAAAGATGAGGGTGGAAGG - Intronic
1156513341 18:37659983-37660005 GAAGAGAAGGTGGGGGTGGGGGG + Intergenic
1157255573 18:46135911-46135933 TTACAGAATGTCAGGCTGGAAGG + Intergenic
1157260820 18:46174322-46174344 GGAGCGCAGGTGAGGCGGGAAGG + Exonic
1157507457 18:48238815-48238837 GCAGAGAAGCTGTGGCAGGAGGG + Intronic
1159335376 18:67057701-67057723 GCAGAGCAGCTGAGGCTGGCAGG - Intergenic
1159961529 18:74559080-74559102 GTATAGAAGGTCAGGCAGGACGG - Intronic
1161051418 19:2165624-2165646 AGAGAGAAGTGGAGGCTGGAAGG - Intronic
1161694358 19:5757809-5757831 GGAGAGAAGCTCAGGCTGTACGG - Intronic
1161823666 19:6547287-6547309 GATGAGAAGCTGAGGCAGGAAGG + Intergenic
1162021748 19:7871239-7871261 GCAGAGGGGGTGAGGCAGGAAGG + Exonic
1162127418 19:8506914-8506936 ATAGAGAAGGTGAGGCTAGGAGG - Intergenic
1162723089 19:12674006-12674028 AGAGAGAAGATGAGGCAGGAAGG + Intronic
1162878980 19:13643260-13643282 CTAGAGAAGGCAAGGCTGTAGGG - Intergenic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1164402634 19:27912129-27912151 CTAGAGATGGGGAGGCAGGAAGG + Intergenic
1164616315 19:29668836-29668858 GTAGAGAAGGTGAGCATGCCGGG + Intronic
1165324079 19:35104136-35104158 GCAGAGGAGCAGAGGCTGGAAGG + Intergenic
1165592989 19:36987194-36987216 GGAGAGAATGTCAGGCAGGAAGG + Intronic
1165856755 19:38883613-38883635 GGATGAAAGGTGAGGCTGGAGGG - Exonic
1166746889 19:45145847-45145869 GTAGGGAAGGTGAGGCGGGTGGG - Exonic
1167619551 19:50553202-50553224 GCAGAAATGGGGAGGCTGGAGGG - Intronic
1168020673 19:53606643-53606665 GTGGAGGCGGTGAGGGTGGAGGG + Intergenic
1168522032 19:57059162-57059184 GTAGAAAAGATGAGGCAGGAGGG - Intergenic
924993877 2:339869-339891 GGAGTGAAGATGAAGCTGGAAGG + Intergenic
925044649 2:763649-763671 GGGGAGAAGGTGAAGATGGAGGG + Intergenic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925449323 2:3954488-3954510 GTAGTGAACGTGAGGATGCAGGG + Intergenic
925943013 2:8837695-8837717 GTAGAGCAGGCGGGGCTGGAGGG + Intergenic
926414920 2:12640076-12640098 GTTGACAAGCTGAGGCTGGGAGG + Intergenic
926425903 2:12738480-12738502 GCAGAGAAGGTGAGGAGGGATGG - Intronic
926625726 2:15088099-15088121 GTAGAGAAGGAGAGGCTGGGTGG + Intergenic
926756699 2:16242213-16242235 GTAGAGAAGATGAGTGTGCAAGG + Intergenic
928058168 2:28080065-28080087 GTATAGAAGGAGTGGCTGAAGGG - Intronic
928277941 2:29920009-29920031 GAAGAGAAGGCGGGGCTGGGAGG + Exonic
929391641 2:41475192-41475214 GCAAAGAAGGAAAGGCTGGAAGG - Intergenic
930982789 2:57547808-57547830 GGAGAGAAGGAAAGGCGGGAGGG + Intergenic
931253721 2:60553680-60553702 GGAGAGAAGGGGAGGAGGGAAGG + Intergenic
931304672 2:61017144-61017166 GGGGAGAAGGTGAGGCGGGTAGG - Intronic
931974793 2:67631469-67631491 ATAGAGAAGGTCAGGCTGTGGGG - Intergenic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
933603033 2:84353071-84353093 GGAGAGAAAGTGAGGAGGGAAGG + Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935131311 2:100263148-100263170 GAAGAGAAGGAGAGGATGGAAGG - Intergenic
935553592 2:104483380-104483402 GTGGGGAAGGTGGGGCTGGGTGG + Intergenic
936005328 2:108882044-108882066 CTCGAGAAGCTGAGGCAGGAGGG + Intronic
936503100 2:113082024-113082046 GTGGAGCTGGTGAGGGTGGATGG + Intergenic
936894571 2:117412987-117413009 GTACAGAAGCTGAGGCCGGCAGG + Intergenic
936912034 2:117603434-117603456 ATAGAGCAGGTGCGGATGGAGGG - Intergenic
937046328 2:118853917-118853939 GTACAGAAGGTGGGGCGGTAAGG + Intergenic
937230334 2:120394873-120394895 GTCGAGAAGCTGAGGCTGAGAGG - Intergenic
937276218 2:120685772-120685794 CTTGAGAAGCTGAGGCTGCAGGG - Intergenic
938132727 2:128731495-128731517 GTGAAGAAGGTGAGGCTGACAGG + Intergenic
938223075 2:129588123-129588145 GCAGAGATGGTGTGGCTGGGAGG + Intergenic
942224663 2:173804731-173804753 GTAGACAGGGAGTGGCTGGAAGG - Intergenic
943713404 2:191123461-191123483 TGAGAGAAGGTCAGGCTGGATGG - Intronic
944927428 2:204479493-204479515 TTAGTGAAGGTGAGGATGGGGGG - Intergenic
946462501 2:219881645-219881667 ATAGAGGAGGTGAGGTGGGATGG - Intergenic
946739551 2:222788241-222788263 GGAAAGAATGTGACGCTGGATGG - Intergenic
947715448 2:232336794-232336816 GGGGAGAGGGTGGGGCTGGAAGG + Exonic
948808151 2:240461775-240461797 GGAGAGAAGGAGCGGCTGGCAGG + Intronic
1168789021 20:563610-563632 GCAGAGAAGGAGAGGAGGGACGG + Intergenic
1169132594 20:3173726-3173748 CTAGAGAGGGTGAGGCTGAGGGG - Intergenic
1170658134 20:18309668-18309690 GGAGAGGATGTGAGGCTGGTAGG + Intronic
1170812823 20:19687881-19687903 GCCCAGAAGGTGTGGCTGGAAGG - Intronic
1172043635 20:32063610-32063632 TTAGAGTAGGTGAGGATGGGAGG - Intronic
1172092745 20:32445721-32445743 GCAGAGGTGGTGTGGCTGGATGG + Exonic
1173368708 20:42414982-42415004 GTACAGAAGGTGAAACTGTATGG + Intronic
1173524270 20:43720062-43720084 CCAGATCAGGTGAGGCTGGATGG - Intergenic
1173563016 20:44019824-44019846 GTGAAGAAAGTGAGGCCGGAAGG - Intronic
1173590287 20:44219755-44219777 ATAGAAAAGGTGAGGCTGAGAGG - Intergenic
1173861610 20:46287526-46287548 GTAGAGGCCCTGAGGCTGGATGG + Intronic
1173927567 20:46792199-46792221 CCAGATAAGGTGAGGCGGGAGGG - Intergenic
1174151562 20:48489695-48489717 GTGGAGAAGGCGAGGCTGATGGG + Intergenic
1174513923 20:51076681-51076703 GCAGAGGAGGCGGGGCTGGAAGG + Intergenic
1174570879 20:51500628-51500650 GTGGTGAGGGTGAGGGTGGAGGG - Intronic
1175365161 20:58448629-58448651 GCAGAGTAGCTGAGGCAGGAAGG - Exonic
1175419392 20:58821889-58821911 GGAGAGGAGGTGAGGGAGGAGGG - Intergenic
1175522412 20:59610410-59610432 GGAAGGCAGGTGAGGCTGGACGG - Intronic
1176618812 21:9041781-9041803 GAGGAGAAGGTGAGGTTTGAGGG - Intergenic
1176623784 21:9074846-9074868 GGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1178876960 21:36421033-36421055 GTAGACAAGGTCAGCATGGAGGG + Intergenic
1179205970 21:39278975-39278997 CTAGGGAGGCTGAGGCTGGAGGG - Intronic
1179477858 21:41659465-41659487 GAAGAGAGGGTGAGGGTGAACGG + Intergenic
1179553572 21:42158908-42158930 GCCGGGAAGGTGAGGCTGGCGGG - Intergenic
1179890314 21:44331829-44331851 GGAGGCAACGTGAGGCTGGAGGG - Exonic
1180939059 22:19645033-19645055 GCACAGGAGGTGAGGCAGGAGGG - Intergenic
1180990753 22:19934271-19934293 CTAGGGAGGCTGAGGCTGGAGGG + Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1182232143 22:28846401-28846423 CCAGGGAAGGTGGGGCTGGATGG + Intergenic
1182379903 22:29879556-29879578 GTAGGGAAGCCGAGGCAGGAGGG + Intergenic
1182411438 22:30190213-30190235 GTAGAGAAAGAGAGGGTTGAGGG - Intergenic
1182460137 22:30477737-30477759 GTAGAGATGGTGTGGCGGGAGGG - Intergenic
1182620578 22:31616424-31616446 TTAGAGCAGGTGGGGGTGGAGGG + Intronic
1182659516 22:31915398-31915420 GTGGGGAAGGGGATGCTGGAGGG + Intergenic
1182805301 22:33064654-33064676 GTTGAGAAGGTAGGGCTGGAGGG + Intergenic
1182930477 22:34168900-34168922 GAAGAGAAGATGAGGCTGAGAGG - Intergenic
1183642057 22:39098704-39098726 GAAGAGAAGGAGATGCTGGCAGG - Intronic
1183744899 22:39686436-39686458 GTAAAGAAGGTGAGACGGGGCGG - Exonic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184389231 22:44193377-44193399 GTAGGGAGGGAGAGGATGGAAGG + Intronic
949564242 3:5230325-5230347 CTAGAGAAAGTGAGGCTGAGAGG + Intergenic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950453732 3:13080246-13080268 GTTGGGATGGTGAGTCTGGAGGG + Intergenic
950627178 3:14255981-14256003 ATGGAGAAATTGAGGCTGGAGGG - Intergenic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951063102 3:18233670-18233692 GTAGAGAAGCTAAGGGTAGAGGG + Intronic
951466702 3:23008117-23008139 GGACAGAAGGCGAGACTGGATGG + Intergenic
952623812 3:35379521-35379543 GGAGAGAAGGTGAGCCAGGGAGG - Intergenic
953137535 3:40195398-40195420 CTTGGGAAGCTGAGGCTGGAGGG - Intronic
953607149 3:44419524-44419546 GGAGAGCAGGCCAGGCTGGAGGG - Intergenic
953848971 3:46450676-46450698 GCAGGGAAGGTGAGGTGGGAGGG + Intronic
954347407 3:50012092-50012114 TTTGGGAAGGTGAGGCAGGAAGG - Intronic
954810877 3:53246922-53246944 GAAGGGAAGATGAGGATGGAGGG + Intronic
955694513 3:61622320-61622342 GTAAAGAAGGGGGAGCTGGAAGG + Intronic
957702923 3:83741328-83741350 TTAGGGAGGCTGAGGCTGGAGGG + Intergenic
957827713 3:85469968-85469990 GAAGGGGAGGTGATGCTGGAGGG + Intronic
960327829 3:116318411-116318433 TTAGAGAATGTCAGACTGGAAGG - Intronic
960967753 3:123116798-123116820 GAGGAGGAGGTGGGGCTGGATGG + Intronic
961135448 3:124505704-124505726 GTAGAGTAGGTGGGGCAGGCTGG + Intronic
961485995 3:127216924-127216946 CTAGAGAAAGTGAGGTGGGAAGG - Intergenic
962178774 3:133183428-133183450 ATAGAGAAGATAAGCCTGGAGGG + Intronic
962235633 3:133704783-133704805 GTTGAGAAGGTGGGGCTGCAAGG + Intergenic
962893377 3:139692467-139692489 ATGGGAAAGGTGAGGCTGGAGGG + Intergenic
962963999 3:140336916-140336938 GTGGGGAAGGTGGGGCGGGATGG - Intronic
963034093 3:141010131-141010153 TTTGGGAAGGTGAGGCAGGAGGG + Intergenic
964363448 3:155923317-155923339 GTAGAAAAGGTTAAGATGGAAGG + Intronic
964389815 3:156185330-156185352 TTGGAGATGGTGAGGCTGGAAGG - Intronic
965386090 3:168048555-168048577 TTAGAAAAGGGCAGGCTGGATGG - Intronic
965449976 3:168825741-168825763 GTAGAGAAGGTGATACAGGCAGG - Intergenic
966399850 3:179537099-179537121 GTTGAAATGGTGAGCCTGGAAGG - Intergenic
967299049 3:187994201-187994223 GTAGTGAGGTTGAGGCTGGGTGG - Intergenic
967823791 3:193862523-193862545 GGAGAGAGGTTTAGGCTGGATGG - Intergenic
968116924 3:196097580-196097602 GAAGTGAAGGTGTGCCTGGAAGG - Intergenic
968503063 4:960110-960132 GGCGGGGAGGTGAGGCTGGAGGG + Exonic
968537473 4:1143518-1143540 GGATAGAAGGTGGGGCTGGAAGG - Intergenic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969462695 4:7337149-7337171 TTGCAGAAGGTGGGGCTGGAAGG + Intronic
969467542 4:7366531-7366553 GAGGAGGGGGTGAGGCTGGAGGG - Intronic
969481315 4:7448539-7448561 GTAGAGAAAGGGAGGGAGGAAGG - Intronic
969484792 4:7466300-7466322 GGAGACAAGGAGAGGCTGGCGGG + Intronic
969495316 4:7523044-7523066 GGAGAGAAGGGGAGGAAGGAGGG - Intronic
970372746 4:15424492-15424514 GTACAGAATCTGAGGCTGGTGGG - Intronic
970444583 4:16113021-16113043 ATAGAGACAGTGAGGCTGGGAGG + Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971713464 4:30146705-30146727 TTTGAGAAGCTGAGGCAGGAGGG + Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
972450810 4:39196544-39196566 GTAGAGATGGTGAGACCGGCTGG - Intronic
973843302 4:54885159-54885181 ATAGAGAAGCTGAGGCTTCAAGG - Intergenic
975237785 4:72020495-72020517 GTACAGAAGCAAAGGCTGGAAGG - Intergenic
975259972 4:72286942-72286964 GTAGAGAAAAAGAGGCTGGAAGG + Intronic
975409523 4:74033072-74033094 GGAGAGCAAGTGAGGCAGGAGGG + Intergenic
975489238 4:74970366-74970388 GTGGACCATGTGAGGCTGGACGG + Intronic
975612055 4:76213413-76213435 ATCGAGAAGGTGAGGCGGGGCGG - Exonic
976289687 4:83404816-83404838 GAAGAGATGGTGAGTATGGACGG + Intergenic
977343589 4:95791181-95791203 GCAAAGAAGCTCAGGCTGGATGG + Intergenic
978334785 4:107654831-107654853 GAAGATAAAGAGAGGCTGGACGG - Exonic
979158521 4:117429244-117429266 GTGGGGAAGGTGGGGCTGGCTGG + Intergenic
981289866 4:143062046-143062068 GGAGAGAAGGTGGGGATGAAGGG + Intergenic
981536487 4:145805754-145805776 GGAAGGGAGGTGAGGCTGGAGGG - Intronic
982147747 4:152415927-152415949 AAAGAGAAGGTGATGCTGGGGGG - Intronic
982867624 4:160537262-160537284 GTTGAGAAAGTAAGGCTAGAGGG + Intergenic
983525910 4:168760181-168760203 GTACAGAGACTGAGGCTGGAAGG - Intronic
984672730 4:182510335-182510357 GTAGAGAAAATAAGGCTAGAGGG - Intronic
984993205 4:185401984-185402006 GGCGAAGAGGTGAGGCTGGAAGG - Intronic
985166098 4:187095728-187095750 AGGGAGAAGGTGAGGCTGCAGGG + Intergenic
985172452 4:187166411-187166433 GGAAAGGAGGGGAGGCTGGATGG + Intergenic
985223201 4:187730245-187730267 GTATAGAAGGTGAGGCCTGGAGG + Intergenic
985785301 5:1890147-1890169 GTGGAGAAGATGAGGCTGTGGGG - Intergenic
985877952 5:2614518-2614540 GTATGGCAGGTGAGGCTGGGAGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986278724 5:6304957-6304979 GGAGAGATGGTGAGGAGGGAGGG + Intergenic
986519621 5:8600303-8600325 GTAGAGAAAGCATGGCTGGAAGG - Intergenic
986647043 5:9927594-9927616 GAAGAGAAGGTGATGCCCGAAGG + Intergenic
987167482 5:15216109-15216131 GTAGAGAAGGGAAGGAAGGAAGG + Intergenic
989435785 5:41411432-41411454 GAAGAGAAAGGGAGACTGGAAGG - Intronic
990553084 5:56903810-56903832 GTGGAGATGGAGAGGGTGGATGG - Intergenic
990989091 5:61667956-61667978 GTTGAGAAGTTGTGGGTGGATGG + Intronic
991035370 5:62122883-62122905 ATTGGGAAGGTGAGGATGGAGGG - Intergenic
991035403 5:62123074-62123096 GTGGAGAAGATCAGGATGGAGGG + Intergenic
992401273 5:76413966-76413988 GTAGAGGCGGTGAGGCCTGAGGG - Intronic
992887626 5:81174464-81174486 GCAGAGGTGGAGAGGCTGGAGGG + Intronic
994246991 5:97489303-97489325 GAAGAGGAGGTGAGGCAGCAGGG + Intergenic
994589062 5:101750915-101750937 GAAGAAAAGGTGGGGCTGGGAGG + Intergenic
996557709 5:124796301-124796323 GATGGGAAGGTGAGGGTGGAGGG - Intergenic
997294333 5:132760402-132760424 GTGGTGAAGGTGGGGCTGCACGG - Intronic
997731923 5:136187758-136187780 TGAGAGAAGATGAGGCTGGTGGG + Intronic
998057111 5:139087686-139087708 ATAGAGGAGGTGAGGCTGACAGG + Intronic
998471982 5:142390515-142390537 GGAGAGAGGGAGAGGGTGGAGGG + Intergenic
998531632 5:142890439-142890461 TGGGAGGAGGTGAGGCTGGAGGG + Intronic
999124245 5:149235115-149235137 TGAGAGCAGGAGAGGCTGGAAGG - Intronic
999652443 5:153780780-153780802 GAAGAGATGGTGAGTGTGGAGGG - Intronic
999780644 5:154847387-154847409 GGGAATAAGGTGAGGCTGGAAGG + Intronic
1000357823 5:160417902-160417924 GTTGTAATGGTGAGGCTGGAAGG - Intronic
1000614714 5:163414043-163414065 GGAGGGAAGGTGAGACGGGAAGG + Intergenic
1001224462 5:169931858-169931880 ATAGAGAAGGGCAGGCAGGAGGG - Intronic
1001749359 5:174117144-174117166 ATGGAGAAAGTGAAGCTGGAAGG - Intronic
1001794107 5:174487572-174487594 GTACAGAAGGGGAGGAAGGACGG + Intergenic
1001951617 5:175820480-175820502 GGAGACAAGGTGATGCGGGAGGG - Intronic
1002051506 5:176574164-176574186 ATAGAGAAGGTGAGTGTGAAGGG + Exonic
1002173957 5:177391081-177391103 GTGGGGTAGGAGAGGCTGGAGGG - Intronic
1003076633 6:2988646-2988668 GTAGGGGAGGCGGGGCTGGAGGG + Intronic
1003224120 6:4189374-4189396 GTAGAGGGAGTGGGGCTGGAAGG + Intergenic
1003932840 6:10943001-10943023 GGAGAGAAGGTGTGACTGGCTGG - Intronic
1004020961 6:11775226-11775248 GTAGAGAAGGTGATGCAGGAGGG - Intronic
1004378199 6:15109067-15109089 GAAGAGAGGGTGAGGCAGGTCGG - Intergenic
1004746604 6:18515066-18515088 GAAGTGAAAGTGAGGCAGGAGGG + Intergenic
1005087074 6:22018008-22018030 GTAGAGAACATGAAGCTAGAAGG - Intergenic
1005098081 6:22140600-22140622 GTAGAGAAGGAAAATCTGGATGG + Intergenic
1006155360 6:32010443-32010465 GTGGTGAAGGTGATGCTGGCTGG + Intergenic
1006161666 6:32043177-32043199 GTGGTGAAGGTGATGCTGGCTGG + Exonic
1006210516 6:32389781-32389803 GTAGAAAACGTGAAGGTGGATGG + Intergenic
1006765883 6:36506302-36506324 GGAGAAAAGGTGGGGCAGGAAGG + Intronic
1007642799 6:43356095-43356117 GTAGAGAGGGTGATCCTGGCTGG + Exonic
1007762199 6:44139637-44139659 GGAGAGAGGATGGGGCTGGAGGG + Intronic
1008088469 6:47268787-47268809 GTAGATGAGGTGGGGATGGAAGG - Intronic
1009450942 6:63799978-63800000 GTCGAGAAGCTGAGCCTGGGCGG + Intronic
1010418270 6:75641102-75641124 GTAGGGGAGGAGAGGATGGAGGG - Intronic
1010941648 6:81926129-81926151 GTAGAGATGGTGGAGGTGGAGGG + Intergenic
1011637178 6:89385440-89385462 GTAGGGAAGGGGAGGCTCCAGGG - Intronic
1011803379 6:91043920-91043942 GTTGAGAAGGTGAGTCAGCATGG - Intergenic
1011826942 6:91318810-91318832 GTAGACAAGGTGTGGTGGGAGGG - Intergenic
1013242149 6:108256120-108256142 GTAGAGAGGCTGAGGTTGGGAGG + Intronic
1013504738 6:110788268-110788290 TTTGAGAAGCTGAGGCAGGAGGG - Intronic
1016505346 6:144772866-144772888 GTAGCTAAGGAGATGCTGGAGGG + Intronic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017057895 6:150454338-150454360 GGAGAGAAGGAGAGGCTGGCAGG - Intergenic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1018690496 6:166340434-166340456 GAAGAAAAGGTGAAGCAGGAAGG - Intronic
1018883475 6:167909367-167909389 ATGGAGAAGGTGAGGATGGAGGG + Intronic
1018916352 6:168134861-168134883 GGAGAGCAGGGGAGGCAGGAGGG + Intergenic
1019173366 6:170147196-170147218 GGAGAGAAGGGGAGGCCGGGGGG + Intergenic
1019266787 7:121600-121622 GGAGGGAAGGAGAGGCAGGAGGG + Intergenic
1019319593 7:409544-409566 TTAGGGAGGGGGAGGCTGGAGGG - Intergenic
1020011392 7:4807668-4807690 GGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011500 7:4808039-4808061 GGAGAGAAGGAGAGGGAGGAAGG - Intronic
1020129881 7:5553690-5553712 TTCGGGAAGGTGAGGCAGGAGGG + Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020719677 7:11726310-11726332 GTAGATGAGGTGAGGCGTGATGG - Intronic
1021450614 7:20780353-20780375 AGAGAGAAGGTGAGGAAGGAAGG + Intergenic
1022168698 7:27800815-27800837 TTAGAGAAGGTCAGGCATGATGG + Intronic
1022194731 7:28053849-28053871 GTGGGAAAGGTGAGGATGGAAGG - Intronic
1023251680 7:38269992-38270014 CTCGAGAAGCTGAGGCAGGAGGG + Intergenic
1023485368 7:40680838-40680860 GTACAGTAGGTGAGGCTCTAGGG + Intronic
1023913979 7:44574791-44574813 GAAGAGAAGGGGAGGGGGGAGGG - Intronic
1024687529 7:51763016-51763038 GTGGAGGAGGTGAGGCTCAATGG - Intergenic
1026962458 7:74417469-74417491 GAACAGGAGGGGAGGCTGGAGGG + Intergenic
1026977413 7:74506993-74507015 GGAGGGAAACTGAGGCTGGAAGG + Intronic
1028482723 7:91325330-91325352 GTATAGCAGCTGAGGTTGGATGG + Intergenic
1028664182 7:93321274-93321296 GGTGAGAAGGCGAGGCTGGTAGG - Intronic
1029184483 7:98728784-98728806 GGAGAGAAGGAGAGGAAGGAGGG - Intergenic
1030189255 7:106794375-106794397 GGAGAGAAGGGGAGGGTGGAAGG + Intergenic
1030266583 7:107628402-107628424 GTAGAGGAGGAGAGGGAGGAGGG + Intronic
1030464470 7:109882512-109882534 GTAGAGAGGGAGAGGCTGAAGGG + Intergenic
1031992296 7:128206357-128206379 GCAAAGAAGGTGGGGCAGGAGGG + Intergenic
1032483283 7:132263458-132263480 GTAAAGAAGCTGAGGCTCGGAGG - Intronic
1032491933 7:132330249-132330271 GGGAAGAAGGTGAAGCTGGAGGG + Intronic
1032585201 7:133139988-133140010 AAAGAGAAGGTGGGGCTGGCTGG - Intergenic
1032675846 7:134129205-134129227 GGAGAGAGGGGGAGGCAGGAAGG - Intronic
1033414115 7:141147312-141147334 GCAGAGGAGGTGAGGCTGGGTGG + Intronic
1034274674 7:149818813-149818835 GATCAGAAGTTGAGGCTGGAAGG - Intergenic
1035374342 7:158397504-158397526 GAAGGGAAGGTGAGGGTGCAGGG - Intronic
1035689617 8:1551457-1551479 GTGGAGAAGGCGCAGCTGGAGGG - Intronic
1036400033 8:8399987-8400009 GGAGAGAAGGAGAGGATAGAAGG - Intergenic
1036671154 8:10789062-10789084 GGAGGGAAGGGGAGGCTGGCAGG - Intronic
1036752135 8:11450017-11450039 GTGGAGAATGCGAGGCTGGAAGG - Intronic
1037939737 8:22942500-22942522 GTAGAGATGGTGGGGGTGGTGGG - Intronic
1038411787 8:27364682-27364704 GATGAGAAGGTGGGGCTGGAAGG - Intronic
1038459424 8:27703406-27703428 GAAGTCAGGGTGAGGCTGGAGGG + Intergenic
1038779454 8:30557677-30557699 GTGGAGAAGGTGAGGCCTGTGGG - Intronic
1038923320 8:32110342-32110364 GGAGAGAAGGGGAGAATGGAAGG + Intronic
1040340847 8:46439820-46439842 GGAGAAAAGGTGAGACTGCAGGG - Intergenic
1040360607 8:46660790-46660812 TTTGGGAAGCTGAGGCTGGATGG - Intergenic
1040559996 8:48515161-48515183 GGAGAGAAGGCGATGCTGGTGGG - Intergenic
1040644696 8:49384468-49384490 GTAGAGAAAGTGAGTATTGAGGG - Intergenic
1041502043 8:58549673-58549695 CTAGAGAGGCTGAGGCAGGAGGG - Intergenic
1042155510 8:65841292-65841314 GTAGAGGAGGTGAAGCTGGGTGG + Intronic
1042206185 8:66332041-66332063 GTAGGGGAGGTGAGGAGGGAAGG + Intergenic
1042284137 8:67088974-67088996 TTTGAGAAGGTGGGACTGGAAGG + Intronic
1042383800 8:68150311-68150333 GTAGACAAGCTGGGGCTGCAAGG - Intronic
1042499391 8:69492038-69492060 GGGGAGTAGGTGAGGCGGGAGGG + Intronic
1042564786 8:70100776-70100798 CTAGTGAAGGTGGGGCAGGAGGG - Intergenic
1042603031 8:70518138-70518160 CTAGGGAGGGTGAGGCAGGAGGG - Intergenic
1042632692 8:70837257-70837279 TTAGAGAAGGTGAGGCTTAGAGG + Intergenic
1044152207 8:88795302-88795324 TTAGGGATGGTGAGGATGGAAGG + Intergenic
1045305629 8:100953674-100953696 GTAGAGAACATGAGGCTAAACGG - Intergenic
1046439527 8:114239997-114240019 TTTGAGAAGCTGAGGCAGGAAGG + Intergenic
1047406801 8:124592199-124592221 TTAGAGAAGGTGTGCCTGAAGGG - Intronic
1048374157 8:133807785-133807807 GTAGAGAAGTTGAAGCTCAATGG - Intergenic
1048807655 8:138255503-138255525 GGAGAGAAGCTGAGGGTGGCTGG + Intronic
1049170460 8:141157480-141157502 GTCGTGGAGGTGACGCTGGAGGG + Intronic
1049198627 8:141329269-141329291 GTAGAGTCAGAGAGGCTGGAAGG + Intergenic
1049815410 8:144596881-144596903 GTTGGGAAGGTGGGGCTGGCCGG - Intronic
1052184879 9:25580672-25580694 GCAGAGAAGATGAAGATGGAAGG - Intergenic
1053002146 9:34583140-34583162 GGACAGCAGGTGAGGATGGAGGG - Intronic
1053146885 9:35718113-35718135 GTAAAGAAGCTGGGGGTGGAGGG - Intronic
1053329196 9:37188564-37188586 GTAGGGGAGGTGAGGGGGGAGGG - Intronic
1056711987 9:88998813-88998835 GTAGAGAGGGAGGGGCTGGGGGG + Exonic
1056922250 9:90801534-90801556 GCAGAGAAGGTGGGGCTGCCCGG - Intergenic
1056954771 9:91073208-91073230 CTAGAGGAGCTGAGGCTGGGCGG - Intergenic
1057216315 9:93230735-93230757 GTAGTGAAGGTGAGACGGGAGGG - Intronic
1057220931 9:93257394-93257416 GTAGAGAAGGTGAGGCTGGAGGG - Intronic
1057489720 9:95511350-95511372 GGGGAGGAGGAGAGGCTGGAGGG - Intronic
1057495104 9:95554264-95554286 ATAGAGAAGAGAAGGCTGGAAGG - Intergenic
1057549841 9:96044326-96044348 GTTAAGAAAGTCAGGCTGGATGG + Intergenic
1058025186 9:100135212-100135234 GTAGGGAAGGTAAGGGAGGACGG + Intronic
1058951841 9:109911127-109911149 GGTCAGAAGGTGTGGCTGGATGG + Intronic
1058954360 9:109931736-109931758 GCAGAGTAGCTGAGGCAGGAGGG - Intronic
1059053950 9:110959265-110959287 ACAGAGAAGGTAAGGATGGAAGG + Intronic
1059116513 9:111604568-111604590 GGGTAGAAGGAGAGGCTGGAAGG - Intergenic
1060198009 9:121635676-121635698 CTAGAGAGGGTGGGGCTTGAGGG + Intronic
1060200784 9:121650848-121650870 GGAGCAGAGGTGAGGCTGGAGGG + Intronic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060247397 9:121957897-121957919 GAAGAGAAGGAGGGGCTGGAAGG + Intronic
1060268606 9:122126422-122126444 GCAGGGAATGTGAAGCTGGAGGG + Intergenic
1060453200 9:123763252-123763274 GTAGTCCAGGTGAGACTGGATGG + Intronic
1061090890 9:128425423-128425445 CTTGGGAAGCTGAGGCTGGAGGG + Intronic
1061168931 9:128940833-128940855 AAAGAGAAGGAGGGGCTGGATGG + Intronic
1061658503 9:132111479-132111501 GTAGAGACGGTGGTGCGGGAGGG - Intergenic
1061930277 9:133828822-133828844 GTGTGGAAGGCGAGGCTGGAGGG - Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062231963 9:135486839-135486861 GCAGAGAGGATGAGGCAGGAGGG + Exonic
1062549660 9:137080217-137080239 GTAGGGAAGTAGAGGCTTGAGGG + Intronic
1062615641 9:137394567-137394589 TTAGGGAAGCGGAGGCTGGAAGG - Intronic
1203746970 Un_GL000218v1:45274-45296 GGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1203563136 Un_KI270744v1:74206-74228 GGAGAGGAGGTGAAGGTGGAAGG + Intergenic
1185673129 X:1827131-1827153 GTATTGGTGGTGAGGCTGGATGG - Intergenic
1185864627 X:3612542-3612564 TTTAAGAAGGTGAGGCGGGAGGG + Intronic
1186239894 X:7554999-7555021 GAAGAGAAAGAGAGGTTGGAAGG + Intergenic
1186649940 X:11548407-11548429 GTAGAGAAGGTCAGAAGGGAGGG - Intronic
1186881285 X:13868996-13869018 ATAGAGCATGGGAGGCTGGAAGG + Intronic
1187176144 X:16897915-16897937 ATGGAGAGAGTGAGGCTGGAGGG + Intergenic
1187277736 X:17831004-17831026 GTAGAAAAGATGAGGATGGATGG - Intronic
1187415840 X:19092647-19092669 GTGAGGAGGGTGAGGCTGGAGGG - Intronic
1187808377 X:23146919-23146941 TTAGATGAGGTGAGGTTGGAAGG - Intergenic
1187859384 X:23666892-23666914 GTAGGGAAGGCGAGGCGAGAGGG - Intronic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1190093654 X:47461902-47461924 GTAGAGATGGTGGTGCAGGAGGG + Intronic
1190161969 X:48038703-48038725 AGAGTGAAGGTGATGCTGGAGGG + Intronic
1190185323 X:48228626-48228648 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190190722 X:48274694-48274716 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190664860 X:52687299-52687321 ATGGTGATGGTGAGGCTGGAAGG + Intronic
1190674562 X:52771120-52771142 ATGGTGATGGTGAGGCTGGAAGG - Intronic
1191896137 X:65995324-65995346 CTAGAGGAGGTGGGGTTGGATGG + Intergenic
1194841040 X:98742454-98742476 GTAGAGAAGGACATGGTGGAAGG - Intergenic
1196871757 X:120119140-120119162 GTAGGAAATGTGAGGCTGCATGG + Intergenic
1197903090 X:131394296-131394318 ATAGAGAAGGGGAGGCTGGATGG - Intronic
1198149311 X:133892678-133892700 GGAAAGAAGGTCAAGCTGGAAGG + Intronic
1198215954 X:134554976-134554998 ATAAAGAAGGTGTGGCTGGAGGG - Intergenic
1199520457 X:148729421-148729443 GCAAAGGAGATGAGGCTGGATGG + Intronic
1200144693 X:153920612-153920634 GTGGAGAAGGTGGGCCTGGAGGG - Exonic
1200908551 Y:8510998-8511020 GGAGGGAAGGAGAGGATGGAAGG - Intergenic
1201160295 Y:11160288-11160310 GGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1201452431 Y:14130576-14130598 GAAGAGAAGGTGAAGAGGGAAGG - Intergenic