ID: 1057221617

View in Genome Browser
Species Human (GRCh38)
Location 9:93260571-93260593
Sequence GATTCAGCACTAACGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057221617_1057221625 19 Left 1057221617 9:93260571-93260593 CCCAGCTCCGTTAGTGCTGAATC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1057221625 9:93260613-93260635 CCACCGTGAGCCGTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057221617 Original CRISPR GATTCAGCACTAACGGAGCT GGG (reversed) Intronic
907107975 1:51901333-51901355 GAATCAGGACTAGTGGAGCTTGG - Intergenic
1067098418 10:43317424-43317446 GATTCTGCACGTAAGGAGCTTGG + Intergenic
1072271600 10:93782487-93782509 GATCCAGGACTAATGGAGGTTGG - Intronic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1091464642 12:673421-673443 GATTCAGCAGTTACACAGCTGGG - Intergenic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1121841762 14:97140319-97140341 GGTTCAGCAGTGACGGGGCTTGG + Intergenic
1122280454 14:100619328-100619350 GCTTCAGGTCTCACGGAGCTGGG - Intergenic
1122651281 14:103228517-103228539 GAGTCTGCACTAAGGGTGCTGGG + Intergenic
1126419795 15:48459389-48459411 GATTTGGCACTAAGGGAGCCAGG + Intronic
1129295790 15:74599367-74599389 AACTCAGCACGAACGCAGCTGGG + Intronic
1130727972 15:86460769-86460791 GAACCAGCACTAAAGGAACTAGG - Intronic
1134465351 16:14471616-14471638 GATTCAGTACTACAGGAGATTGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1141331255 16:83113525-83113547 GAGTCTGCCCTTACGGAGCTGGG + Intronic
1142131686 16:88434158-88434180 GTTACAGCACTGACGGAGCCAGG - Exonic
1148575510 17:48707949-48707971 GATTCTGCACACACAGAGCTGGG + Intergenic
1152259297 17:79258455-79258477 GATTCAGCATTTACTGAGCACGG + Intronic
1164598961 19:29548478-29548500 AATTGAACACTAACGGAGTTCGG - Intronic
939929808 2:148218812-148218834 GATTTACCACGAATGGAGCTTGG + Intronic
1170151956 20:13235768-13235790 TATTCATCACTCACGGGGCTTGG + Intronic
1177894771 21:26845512-26845534 GGTTTAGCACCAACGGAGCCGGG - Intergenic
1179303684 21:40135828-40135850 GATACAGCATTAAAGGAGCATGG + Intronic
1180975774 22:19847350-19847372 GATCCAGCAATAAAGGAGCAAGG - Exonic
1181644268 22:24222405-24222427 GCTTCAGCAGTAAAGGATCTTGG - Intronic
975114199 4:70660677-70660699 AATTCAGCACTACTGGGGCTGGG - Intronic
984525120 4:180849322-180849344 GATTCTGAACTAAAGGAGCACGG + Intergenic
1006441902 6:34058383-34058405 AATCCAGCATTAATGGAGCTGGG - Intronic
1033425296 7:141238664-141238686 GGTTCAGCAGTAACGCGGCTGGG + Intronic
1033981533 7:147171023-147171045 GATTCAGCAGACATGGAGCTGGG - Intronic
1040442424 8:47457824-47457846 TATTCAGCACAAATGGTGCTGGG - Intronic
1040729683 8:50428396-50428418 AATTCACCACTAACTGACCTTGG + Intronic
1043806587 8:84679759-84679781 GATTCAGCACTGATGAAGCCAGG + Intronic
1045799591 8:106087128-106087150 GATTGTGCACTCAGGGAGCTCGG - Intergenic
1046130137 8:109956391-109956413 GATTCAGCATGTAAGGAGCTTGG - Intergenic
1048296063 8:133214773-133214795 GATTCAGCACTAAGGGAAGAAGG - Intronic
1057221617 9:93260571-93260593 GATTCAGCACTAACGGAGCTGGG - Intronic
1188825134 X:34822533-34822555 GATACAGCAAAAACGGTGCTAGG - Intergenic