ID: 1057222021

View in Genome Browser
Species Human (GRCh38)
Location 9:93262583-93262605
Sequence GAGGGAGAGCTGACTATGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057222021 Original CRISPR GAGGGAGAGCTGACTATGCG TGG Intronic
900613302 1:3553430-3553452 GAGGAAGAGCTGACGAGGAGGGG + Intronic
902816377 1:18918867-18918889 GAGAGAGAGCTGCCTGTGTGGGG - Intronic
904403119 1:30269838-30269860 GAGGGAGTGCTGACAAGGAGTGG + Intergenic
905133189 1:35777117-35777139 GAGGGACAACTGACTGTGCCTGG + Intergenic
909290558 1:73878052-73878074 CAGGCAGAGCTGACTATGGAAGG + Intergenic
912996313 1:114535683-114535705 GAGGTTGAGCTGACAATGCATGG - Intergenic
915629260 1:157138758-157138780 GAGGCAGAACGGACTTTGCGGGG + Intergenic
915889033 1:159753826-159753848 GTGGGAGATGTGACCATGCGAGG + Intergenic
918035213 1:180864318-180864340 GATGAATAGCTGACTATGCTAGG - Intronic
918774741 1:188612524-188612546 GAGGCAAAGAAGACTATGCGTGG + Intergenic
919117773 1:193302482-193302504 TAGGAAGAGCTGACTATGGAAGG + Intergenic
1065855557 10:29827314-29827336 GAGAGAGAGCTGAAGATGCCAGG - Intergenic
1065855924 10:29829998-29830020 GAGAGAGAGCTGAAGATGCCAGG - Intergenic
1067054529 10:43043163-43043185 CAGGGAGCCCTGACTATGCAAGG + Intergenic
1067475472 10:46562464-46562486 GAGCAAGAGCTGACTTTGCAAGG - Intergenic
1067619264 10:47779299-47779321 GAGCAAGAGCTGACTTTGCAAGG + Intergenic
1069742740 10:70695868-70695890 CAGGGAGAGCTGATGATGGGAGG + Intronic
1071221857 10:83476513-83476535 GAGCAACAGCTGACTATGCAAGG - Intergenic
1075920890 10:126211732-126211754 GAGGCAGAGATGACTATTTGCGG - Intronic
1076315889 10:129541191-129541213 GAGGGAAAGGTAACTATGCAAGG - Intronic
1076765344 10:132630214-132630236 GAGGGAAAGCTGTCCATGAGGGG + Intronic
1077907638 11:6546442-6546464 GTGGCAGAGCTGACTCTGCTGGG + Exonic
1078830239 11:14971434-14971456 GAGGGAGAGCTGAGTGGGGGAGG + Intronic
1082169603 11:48987425-48987447 GTGGGAGTGCTGCCTATGGGTGG + Intergenic
1082234613 11:49808644-49808666 GTGGGAGTGCTGCCTATGGGTGG - Intergenic
1083342456 11:61967524-61967546 GACGGAGGGCTGGCTATGGGCGG + Exonic
1083651971 11:64209162-64209184 GAGGGGGAGCTGGCTAGGAGAGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085588594 11:77735125-77735147 GAGGGAGGGCTGGCTATGGGCGG + Intronic
1090606720 11:128429310-128429332 CAGGGATAGCTGACTATGAGCGG + Intergenic
1090731676 11:129578121-129578143 AAGGGAGAGCTTTCTCTGCGGGG + Intergenic
1091309654 11:134563317-134563339 GAAGGAGAGCTGGCTCTGGGTGG + Intergenic
1096694608 12:53340576-53340598 GAGGGAGAGATGAGTCAGCGGGG - Intronic
1096981819 12:55732489-55732511 GAGGGAAAGCTGGCTTTGCTTGG - Intergenic
1098876845 12:75874401-75874423 GAGTAAGAGCTGGCTAGGCGTGG - Intergenic
1103330241 12:120149229-120149251 GAGGGAGAGCTGGCCAGGCGTGG + Intronic
1104230808 12:126882177-126882199 AAGGGAGAGCTGTGTATACGTGG - Intergenic
1104811106 12:131620959-131620981 GTGGCAGAGCTGGCTATCCGGGG + Intergenic
1109410586 13:61961326-61961348 GAGAGAGAGATGGCTATGAGAGG - Intergenic
1113535755 13:111065053-111065075 GAGGGAGAGGAGACCATGCCAGG - Intergenic
1114483742 14:23050813-23050835 GAGGGATAGCTGACTAGCCTTGG + Intronic
1115564478 14:34613216-34613238 GAGGGAGAGCTGGCCCTGCCAGG + Intronic
1117162318 14:53001605-53001627 GAGGGAGAGCAGATTATGAAGGG + Intergenic
1202902409 14_GL000194v1_random:51358-51380 GATGGAGAGCTGAGTGTGGGGGG - Intergenic
1124360756 15:29035143-29035165 GAGGGAGTGCTGCCTCTGCTTGG + Intronic
1124417261 15:29482484-29482506 GAGGGAGAGATGAATAGGTGGGG - Intronic
1126861445 15:52886859-52886881 GAGGGAGAGATGAGTAGGCAGGG - Intergenic
1128211495 15:65906395-65906417 GAAGGAGTGCTGAATATGCCGGG - Intronic
1131219614 15:90571331-90571353 GAGGAAGAGGTGACTAAGCTGGG + Intronic
1139441153 16:66967937-66967959 GAGGGAGACCTGACTATACACGG - Intronic
1139952194 16:70677877-70677899 AATGGAGAGCTGACCATGCTGGG - Exonic
1139965076 16:70740839-70740861 GAGGGAGAGATGTTTATGCAAGG + Intronic
1140820059 16:78655206-78655228 GACGGAGAGCAGACTATGAAGGG - Intronic
1142139926 16:88468301-88468323 GAGGGAGAGCTGAGCACTCGGGG + Intronic
1145804759 17:27718675-27718697 AGGGGAGAGGTGACTATGGGGGG - Intergenic
1147003111 17:37379298-37379320 GAGGCAGAGCTGTTTCTGCGGGG - Exonic
1147982423 17:44282713-44282735 GAGGGACAGCTGAGTCTGAGTGG - Intergenic
1149453855 17:56771364-56771386 GAGGGACAGCTGACTGTCCTGGG - Intergenic
1151569157 17:74917495-74917517 GAGGGGGAGCTGGCTATGCTTGG + Exonic
1151682461 17:75629248-75629270 GAGGCAGCGCTCACTATGGGGGG - Exonic
1155586537 18:27372773-27372795 GATGGAGACCTGACTATCAGTGG + Intergenic
1156589452 18:38469346-38469368 GAGGAAGAGCTGCCCATGCATGG + Intergenic
1156950558 18:42891742-42891764 GAGGGAGAGATGAATAAGCAGGG + Intronic
1157059609 18:44272598-44272620 GAGGAAGAGCTGACTTTGAAGGG - Intergenic
1158117949 18:54017546-54017568 GAGGGAGAGCAGACTAGGACTGG + Intergenic
1159637883 18:70827553-70827575 GAGGGAGAGCTGACAGGGAGTGG - Intergenic
1160936440 19:1598219-1598241 GAGGGAGAGCAGACGAGGCAGGG + Intronic
1163055509 19:14714674-14714696 GAGGGAGAGGTGAGGATGCAGGG + Intronic
1164720667 19:30429494-30429516 TGGGGTGAGCTGACGATGCGGGG - Intronic
1165935341 19:39385349-39385371 CAGGGTGAGCTGACTGTGCCTGG + Intronic
1167152153 19:47716548-47716570 GATGGAGAGCTGCCTGTGGGAGG - Exonic
1167513790 19:49910885-49910907 GAGGGAGTGCTGAATAGGGGTGG + Intronic
926911795 2:17858338-17858360 GAGTGACAGCTGACTAAGGGAGG - Intergenic
927983835 2:27393469-27393491 GACGGAGGGCTGGCTATGGGCGG + Intronic
934504262 2:94879042-94879064 GATGGAGAGCTGAGTGTGGGGGG + Intergenic
940177354 2:150893347-150893369 GAGGGATAGCTGACTATCCAGGG + Intergenic
946294414 2:218772639-218772661 GAGGGACAGCTGCCTATATGAGG + Intergenic
1171439023 20:25146749-25146771 GAGGCAGAGCTGACAAAGCTGGG + Intergenic
1171898060 20:30829193-30829215 GAGGGAGAGCAGAGTTTGTGAGG + Intergenic
1172274014 20:33670091-33670113 GAGGAAGAGCTGCCTAAGTGAGG + Intronic
1173856808 20:46255556-46255578 GAGGGAGAGGTGAGGATGGGAGG - Intronic
1176240555 20:64073905-64073927 GTGGGAGAGCTGAGGAAGCGGGG + Exonic
1176621777 21:9066125-9066147 GATGGAGAGCTGAGTGTGGGGGG - Intergenic
1178893100 21:36536310-36536332 GAGGGAGAACTGAGGATGGGTGG - Intronic
950631850 3:14287204-14287226 GAGGGACAGGTGTCTATGTGGGG + Intergenic
953414351 3:42707146-42707168 GAGGGTGATCTGAGTATGAGGGG - Intronic
957284568 3:78201805-78201827 GAGAGAAAGCTAACTATGTGAGG + Intergenic
959303642 3:104632655-104632677 GAGGGAGAGCTGACTCACTGGGG - Intergenic
961685215 3:128625190-128625212 GAGGGAGAGGGGACTAAGAGGGG + Intronic
961847719 3:129781670-129781692 AATGGAGAGCAGACTATGTGGGG + Intronic
962279447 3:134039106-134039128 AAGGGAGAACTGACGCTGCGTGG - Intronic
963849941 3:150201165-150201187 GAGGGAGAGCTGTCTATTATAGG + Intergenic
968614972 4:1573660-1573682 GAGGGGGAGCTGAGGATGGGGGG - Intergenic
968614979 4:1573677-1573699 GAGGGGGAGCTGAGGATGAGGGG - Intergenic
968614995 4:1573744-1573766 GAGGGGGAGCTGAGGATGGGGGG - Intergenic
978558805 4:110009894-110009916 TAGGGGCAGCTGACTATGCCAGG + Intronic
980564389 4:134519755-134519777 GAGTGAGAGCTGACTAGTGGAGG + Intergenic
988875269 5:35438426-35438448 GAGGGAAATGTGACTATGGGAGG - Intergenic
1001648330 5:173298320-173298342 CAGGGAGAGCGGACAATGCCGGG - Intergenic
1002366594 5:178717327-178717349 GAGGTACAGATGACTATGCCAGG + Intronic
1010422082 6:75687780-75687802 GAGGGGCAGCTGCCTATGTGAGG + Intronic
1011558781 6:88594751-88594773 GAGAGAGAGCAGAGTATGTGAGG - Intergenic
1016682877 6:146850978-146851000 CAGGGAGAGCTGCCTGTGCCTGG - Intergenic
1017234385 6:152104408-152104430 GATTGAGTGCTGACTATGTGTGG - Intronic
1017279602 6:152609139-152609161 GAGGGTGAGCTGACGAAGCAGGG + Intronic
1022496637 7:30857153-30857175 GAGGGCAAGCTGACTATGCGGGG - Intronic
1030177571 7:106670783-106670805 GAGGGAGATGTGACTATTCAAGG - Intergenic
1030907883 7:115208993-115209015 GAGGGAAAGCTGAATATGGCAGG + Intergenic
1038342829 8:26702063-26702085 GAAGGAAAGCTGAGCATGCGTGG - Intergenic
1039243954 8:35587112-35587134 GAGGGAGAGGTGACAAAGCCGGG - Intronic
1039368583 8:36960125-36960147 AATGGAGAGCTGAGTATGTGAGG - Intergenic
1040716014 8:50253350-50253372 GAGGCAGAGGTGACTGTGAGTGG + Intronic
1046489795 8:114936591-114936613 GAGGAAGATGTGACTATGGGAGG + Intergenic
1050021883 9:1293037-1293059 GAGGGAGAGGTGACAATGAGAGG + Intergenic
1051289136 9:15527779-15527801 GACGGAGGGCTGGCTATGGGCGG + Intergenic
1056827921 9:89889840-89889862 GAGGGAGGGATGACCATGTGGGG + Intergenic
1057105086 9:92407294-92407316 GAGGTAGAGGTGGCTATGCCAGG - Intronic
1057222021 9:93262583-93262605 GAGGGAGAGCTGACTATGCGTGG + Intronic
1058414183 9:104768153-104768175 GAGGGAGGGCTGACTATACTAGG + Intronic
1185469611 X:374553-374575 GAGGGTGAGCTGACATTCCGGGG + Intronic
1190230288 X:48576453-48576475 GAGGGAGAGTTGCCTATGTGTGG + Intronic
1191830156 X:65407411-65407433 GAGCGAGGGATGACTAGGCGGGG - Intronic
1192533365 X:71908607-71908629 GAGTGAGAGCAGACTAGGCTGGG + Intergenic
1196094577 X:111785150-111785172 GAGGGACAGCTGCCTATATGAGG - Intronic
1196970914 X:121107632-121107654 CAGGGAGAGGGGAGTATGCGTGG + Intergenic
1199300565 X:146208632-146208654 GAGGGAGAGCAAACTATAAGAGG + Intergenic
1199458047 X:148052097-148052119 GACGGAGGGCTGGCTATGGGTGG - Intergenic
1201158295 Y:11151578-11151600 GATGGAGAGCTGAGTGTGGGGGG - Intergenic
1201301289 Y:12507267-12507289 GAGGGAGATCTGCCTGGGCGTGG - Intergenic