ID: 1057223148

View in Genome Browser
Species Human (GRCh38)
Location 9:93268507-93268529
Sequence GTGAACTCCTTTACACCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057223148_1057223150 -10 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223150 9:93268520-93268542 AGGAGTTCACAGACCCACTGTGG 0: 1
1: 0
2: 2
3: 20
4: 226
1057223148_1057223160 28 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223160 9:93268558-93268580 TGATGGGGGTCACACTGGCCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
1057223148_1057223151 -1 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223151 9:93268529-93268551 CAGACCCACTGTGGCAAGTCTGG 0: 1
1: 0
2: 1
3: 6
4: 145
1057223148_1057223157 13 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223157 9:93268543-93268565 CAAGTCTGGTGCAGGTGATGGGG 0: 1
1: 0
2: 0
3: 21
4: 198
1057223148_1057223156 12 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223156 9:93268542-93268564 GCAAGTCTGGTGCAGGTGATGGG 0: 1
1: 0
2: 0
3: 7
4: 139
1057223148_1057223158 14 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223158 9:93268544-93268566 AAGTCTGGTGCAGGTGATGGGGG 0: 1
1: 0
2: 1
3: 36
4: 287
1057223148_1057223159 23 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223159 9:93268553-93268575 GCAGGTGATGGGGGTCACACTGG 0: 1
1: 0
2: 2
3: 30
4: 254
1057223148_1057223155 11 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223155 9:93268541-93268563 GGCAAGTCTGGTGCAGGTGATGG 0: 1
1: 0
2: 1
3: 14
4: 236
1057223148_1057223154 5 Left 1057223148 9:93268507-93268529 CCCATAGGTGTAAAGGAGTTCAC 0: 1
1: 0
2: 0
3: 3
4: 64
Right 1057223154 9:93268535-93268557 CACTGTGGCAAGTCTGGTGCAGG 0: 1
1: 0
2: 2
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057223148 Original CRISPR GTGAACTCCTTTACACCTAT GGG (reversed) Intronic
909336322 1:74479187-74479209 GTGAAATCCTCTGCACCTGTGGG - Intronic
914712431 1:150226896-150226918 GTGAGTTACTTTCCACCTATTGG - Intronic
923945324 1:238880075-238880097 GTGAAAATCTTTACACCCATAGG - Intergenic
1066644931 10:37596764-37596786 TTGAACTCCCTTAAACCTACTGG - Intergenic
1081536211 11:43998105-43998127 GTCACCCCCTTTACACCAATGGG - Intergenic
1081829408 11:46094914-46094936 ATGAAATCCTTTAAACCTAAGGG + Intronic
1090942164 11:131396424-131396446 GTGTACACCTTCACACCTCTCGG + Intronic
1096886788 12:54726514-54726536 GGCAAGTCCTTTCCACCTATGGG + Intergenic
1100837746 12:98583166-98583188 GTAATCTCCTTTACTCCCATAGG - Intergenic
1108303977 13:49112432-49112454 GTGAGCTGCTTTATACCTCTAGG - Intronic
1109237132 13:59837542-59837564 CTGAACTGCTTTATATCTATAGG + Intronic
1125060971 15:35423441-35423463 GTTAACTCCTTAACATATATAGG + Intronic
1133894377 16:9911809-9911831 GTGAACACTTTTACACTTTTGGG + Intronic
1146073936 17:29710604-29710626 ATGAATTCCTTTCCACCTAGTGG - Intronic
1147895836 17:43750830-43750852 GTGGTCTCGTTTACACCTGTAGG - Intergenic
1149369349 17:55977897-55977919 GAGAAGTCCCTTCCACCTATGGG + Intergenic
1157269648 18:46262619-46262641 CTGGACTCATTTACACCTCTGGG - Intronic
925871025 2:8270679-8270701 GTGAACCTCTTTGAACCTATGGG + Intergenic
928050950 2:27994965-27994987 GAGATCTCCTTTACCCCTTTAGG - Intronic
937570380 2:123350964-123350986 GTCAACTCCTTAACATGTATTGG - Intergenic
937805263 2:126134287-126134309 GTGCACTCCTTCATACATATAGG - Intergenic
942698370 2:178673860-178673882 GTAATATCCTTTACACCTCTAGG - Intronic
943227381 2:185195473-185195495 GTAAAATATTTTACACCTATAGG - Intergenic
1170972997 20:21133965-21133987 GTTAACTCCTTTACACATCTAGG + Intronic
1178892322 21:36530492-36530514 GAGACCTCCTTTATGCCTATTGG - Intronic
1179074970 21:38112664-38112686 GTGAACTCCACTACTACTATAGG + Intronic
952087388 3:29841918-29841940 GTCTTCTCTTTTACACCTATGGG - Intronic
953775780 3:45816048-45816070 TTGACTTCCTTTACACCTGTTGG - Intergenic
962342144 3:134594612-134594634 GTGTACTCCTTTGCCCCTGTGGG - Intergenic
962867415 3:139459208-139459230 GTGAACACCTATACACGTGTGGG - Intronic
964403583 3:156325088-156325110 GTGAAATACCTTACACCTACTGG + Intronic
966578439 3:181530248-181530270 GTGTACTCTTGTACACCTAGTGG - Intergenic
968039352 3:195575564-195575586 GTGTATTCTTTTACACCTTTAGG + Intronic
971977162 4:33705167-33705189 TTGAAGTCCTTTACTGCTATTGG + Intergenic
984541548 4:181043115-181043137 GTGAACTGCTATTGACCTATGGG + Intergenic
987878056 5:23706523-23706545 GTCAACTCTTTTTAACCTATGGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990369934 5:55107381-55107403 GTGCATTACTTTACAACTATTGG + Intronic
990496377 5:56352247-56352269 GTGAACTCGTTCACAAATATAGG + Intergenic
996681950 5:126237381-126237403 GTAAGCTCCTTGACAGCTATTGG - Intergenic
998152216 5:139764047-139764069 GAGAACTCCTTTTCACAGATGGG - Intergenic
999022049 5:148177280-148177302 CTGATCTCCTTTACATCTTTGGG - Intergenic
1004116566 6:12774289-12774311 GTAAACTCCTTGAAACCTAGAGG + Intronic
1010439919 6:75881823-75881845 GTGTTTTCCTTTACACCTATAGG + Intronic
1015130575 6:129804018-129804040 GGCAAATCCTTTCCACCTATGGG - Intergenic
1028405184 7:90466595-90466617 CTGAACTCATTAACATCTATGGG + Intronic
1033843095 7:145399122-145399144 GTTAACTCCTTTGCACTCATTGG + Intergenic
1036998916 8:13694478-13694500 GTGAACACCTTTTCACTTAATGG + Intergenic
1037772527 8:21810887-21810909 GTGACTTCCTTTATACCCATAGG - Intronic
1040136662 8:43862258-43862280 GTGAGCTCATTGAGACCTATGGG + Intergenic
1046160806 8:110361936-110361958 GTGAATTCCTTTTCTCCTCTCGG + Intergenic
1046605489 8:116367074-116367096 GTGAACTCCTTTCTAAATATTGG + Intergenic
1047135896 8:122078207-122078229 GAGAACTCCTTGACCTCTATAGG - Intergenic
1047903083 8:129444874-129444896 GTGAACACATTTACAACTATTGG - Intergenic
1050116737 9:2271186-2271208 GTGAACTGCTCATCACCTATGGG + Intergenic
1050361784 9:4837390-4837412 GTGTATTCCTGTACACTTATTGG - Intronic
1050934777 9:11381557-11381579 GTGAACCCCTTAACTCCTAAAGG - Intergenic
1055400453 9:75918311-75918333 GTGACCTCCTTCTCACCTCTTGG + Intronic
1057223148 9:93268507-93268529 GTGAACTCCTTTACACCTATGGG - Intronic
1058936749 9:109776686-109776708 GTGAACTCCTTCCCATCTTTGGG - Intronic
1203381471 Un_KI270435v1:51370-51392 GTGAACTCATTGATGCCTATGGG + Intergenic
1185801134 X:3012187-3012209 GTGAATTCCTTTTAAACTATAGG + Intronic
1188092638 X:25982123-25982145 TTGAACTTCTTTTCACATATTGG - Intergenic
1188236619 X:27739557-27739579 GTGATCTCCTTTACTCCCAGTGG + Intronic
1191182367 X:57577306-57577328 GTGTATACCTTTACAACTATTGG - Intergenic
1192410386 X:70928455-70928477 CTGAACTCAATGACACCTATAGG - Exonic
1195905264 X:109838154-109838176 GTGATCTCCTCTACTCCCATGGG + Intergenic
1201548950 Y:15198481-15198503 GTAACCACCTTTACACCAATAGG - Intergenic