ID: 1057224147

View in Genome Browser
Species Human (GRCh38)
Location 9:93278490-93278512
Sequence GGCGCTTGCCTCAGTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057224138_1057224147 27 Left 1057224138 9:93278440-93278462 CCAGCTGGAAAGCCTTATAATTC 0: 1
1: 0
2: 1
3: 10
4: 124
Right 1057224147 9:93278490-93278512 GGCGCTTGCCTCAGTCCTGGAGG No data
1057224142_1057224147 15 Left 1057224142 9:93278452-93278474 CCTTATAATTCAAGGGGTTTTGG 0: 1
1: 0
2: 4
3: 35
4: 312
Right 1057224147 9:93278490-93278512 GGCGCTTGCCTCAGTCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057224147 Original CRISPR GGCGCTTGCCTCAGTCCTGG AGG Intronic
No off target data available for this crispr