ID: 1057226944

View in Genome Browser
Species Human (GRCh38)
Location 9:93297424-93297446
Sequence CAGGGGAAACAGACAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 1, 2: 3, 3: 44, 4: 512}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057226944_1057226951 11 Left 1057226944 9:93297424-93297446 CCTTCCACTGTCTGTTTCCCCTG 0: 1
1: 1
2: 3
3: 44
4: 512
Right 1057226951 9:93297458-93297480 ACACACATTTGCCTGATAAATGG No data
1057226944_1057226952 14 Left 1057226944 9:93297424-93297446 CCTTCCACTGTCTGTTTCCCCTG 0: 1
1: 1
2: 3
3: 44
4: 512
Right 1057226952 9:93297461-93297483 CACATTTGCCTGATAAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057226944 Original CRISPR CAGGGGAAACAGACAGTGGA AGG (reversed) Intronic
900076089 1:819004-819026 CAGGAGAAACAGAGAGTGTCTGG - Intergenic
900297571 1:1959646-1959668 CAGGGGAAAGAGTCAGTAGAGGG + Intronic
900508940 1:3049062-3049084 CAGGGGAAGGAGACGCTGGATGG + Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902205252 1:14863747-14863769 CAGGGGAAACTGAAGGTGCACGG + Intronic
902232441 1:15036414-15036436 CAGGCCAAACAGGCAGGGGAAGG - Intronic
903168326 1:21536767-21536789 AAGGGGAAACAGACTCTGGGTGG + Intronic
903362929 1:22788299-22788321 CAGGGGAAGATGAGAGTGGAAGG - Intronic
903788201 1:25875264-25875286 CCGGGGAAGCAGCCAGCGGAGGG - Intergenic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904317034 1:29672283-29672305 GAGGGAAAACAGACACTTGAGGG - Intergenic
904816380 1:33203930-33203952 CAGGGGAAACAGTCAGTAAAAGG - Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905841202 1:41180362-41180384 CAGGGCAATCAGACAGGAGAAGG + Intronic
906653221 1:47528263-47528285 TAAGGGAAACAGACAGAGAAGGG + Intergenic
906738296 1:48154139-48154161 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
908241695 1:62194220-62194242 CAGAGGAAACAGCCAGTGCAAGG + Intergenic
908274576 1:62456844-62456866 AAGGGGAAACCAAAAGTGGAGGG + Intronic
908522437 1:64957210-64957232 TAGGGGCAACAGTGAGTGGATGG + Intronic
909676629 1:78245543-78245565 CAGGGCAATCAGACAGGAGAAGG - Intergenic
909723720 1:78809165-78809187 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
911752783 1:101516877-101516899 CAGGGGAGAGAGAGAGTGAAGGG + Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913163112 1:116163206-116163228 GAGGTGAAAAAGACAGTGGAGGG + Intergenic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
915121470 1:153632037-153632059 CAGAGGAGACAGACATCGGATGG - Exonic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
915733799 1:158072069-158072091 CAAGGGAAACAGGCTCTGGACGG - Intronic
916155332 1:161839783-161839805 CAGAGGAAACAGCCATTGCAGGG + Intronic
917020206 1:170578790-170578812 AAAGGGAAACAGACAGAGAAGGG - Intergenic
918026989 1:180760261-180760283 CAGGGCAAACAGGCAGGAGAAGG + Intronic
918532604 1:185539695-185539717 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
918890797 1:190264813-190264835 TAGAGGAAACAAACAATGGAAGG + Intronic
919883160 1:201914260-201914282 CAGGGGCTGCAGACAGTGGACGG - Intronic
921188627 1:212690911-212690933 CAGGGGACACTGGCAGTGTATGG + Intronic
921283495 1:213589027-213589049 CAGAGGAGAGAGGCAGTGGAAGG + Intergenic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922081350 1:222300278-222300300 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
922387642 1:225103884-225103906 CAGGGCAATCAGGCAGGGGAAGG - Intronic
922660082 1:227422277-227422299 CAGGGTGAATAGACAGTGAAAGG - Intergenic
922973318 1:229761343-229761365 CAGAGGGAACAGAAACTGGAAGG - Intergenic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
924714775 1:246563121-246563143 CAGTGGAAACACACAGCGGCAGG - Intronic
1063309545 10:4939341-4939363 CAGGGGAAAGACACAGCAGAAGG + Intronic
1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG + Intergenic
1064989901 10:21247047-21247069 CAGGGGAGAGAGAGAGTGAAGGG - Intergenic
1066622679 10:37374772-37374794 CTGGGGGAGCAGACAGTGAATGG - Intronic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1069222638 10:65903551-65903573 GATGGGAACCAGAAAGTGGATGG - Intergenic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071226156 10:83530633-83530655 GATGGGAAACAGCCAGTTGATGG + Intergenic
1071567924 10:86681110-86681132 CAGGGGGAACAGACACAGAACGG + Intronic
1071789195 10:88936569-88936591 CAGGGGCAACAGAGAGGGCAGGG - Intronic
1071933143 10:90496472-90496494 CAGGGGAAACAGAGAGCTGTGGG + Intergenic
1072295882 10:94009228-94009250 CAGGGGCAAGAGACAGAGAAGGG + Intronic
1072306092 10:94108636-94108658 CAGGGGAAGCAGGGGGTGGAGGG - Intronic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073112102 10:101068643-101068665 AAGGGGAAAAAGGCAGTGAAGGG + Intergenic
1073112435 10:101070597-101070619 AAGGGGAAAAAGGCAGTGAAGGG - Intergenic
1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG + Intronic
1074943119 10:118254250-118254272 GAGGGGAGACAGGCAGTGAAAGG + Intergenic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075208875 10:120473764-120473786 CAGGGGAGAGAGAGAGTGAAGGG - Intronic
1075488721 10:122848074-122848096 CAGGGGACAGAGACAGTGCCCGG + Intronic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1076070000 10:127481828-127481850 CATGGGGTACAGAGAGTGGAAGG - Intergenic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077979347 11:7284766-7284788 AAGAGAAAACAGACAATGGAGGG - Intronic
1078019246 11:7641476-7641498 CAGGAGACACAGAAAGTGGCTGG + Exonic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079759575 11:24311289-24311311 CAGGAGAGACAGACAGTGCAGGG - Intergenic
1079879174 11:25903176-25903198 AAGGGCAAACAGACACTGAAAGG - Intergenic
1080830443 11:35888939-35888961 GAGGGGAAGCTGAGAGTGGATGG - Intergenic
1081390071 11:42518784-42518806 CAGGGAAAACAGGCAGGTGAAGG + Intergenic
1081405421 11:42692146-42692168 CAGGGCAAACAGGCAGCAGAAGG + Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081869770 11:46378026-46378048 CAGGGAAACGAGACAGAGGAAGG - Intronic
1082092023 11:48097946-48097968 TAGGGGACACAGTCAGTGAAGGG + Intronic
1082137261 11:48563570-48563592 CAGGGCAATCAGGCAGTAGAAGG - Intergenic
1082140193 11:48599949-48599971 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1083412978 11:62506467-62506489 CAGGGGAAACTGTCAGGGGCAGG + Intronic
1083518002 11:63278633-63278655 CAGAGGAAACAGACAATGCTTGG - Intronic
1083675804 11:64324084-64324106 CAGTGGCAACAGACCTTGGAGGG - Intergenic
1083994587 11:66265819-66265841 CAGGGGCATCAGGCAGTGAATGG - Intronic
1084536144 11:69758409-69758431 CGAGGGAGACAGACAGTGGATGG + Intergenic
1085312528 11:75525112-75525134 CAGGGGAAACAAGCAGAGGCTGG - Intronic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086657106 11:89372179-89372201 GAGGGGAAGGAGGCAGTGGAGGG - Intronic
1087272778 11:96128366-96128388 CCTGGGCAACAGACAGTGGGAGG + Intronic
1087781342 11:102304091-102304113 GAGGAGAAAGAGAGAGTGGAAGG + Intergenic
1088993578 11:114976401-114976423 CAGTGGAGACAGACATGGGAGGG + Intergenic
1089332859 11:117701924-117701946 CAGGGTAAACAGACAGCGCGTGG + Intronic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090076673 11:123584222-123584244 AAGGGCACACAGACAGCGGAGGG - Intronic
1090736743 11:129617480-129617502 CAGGAGAAAGAGAGAGTGGCAGG - Intergenic
1091011527 11:132005754-132005776 CAGGTGAAACAGAAAATGGGAGG - Intronic
1091030831 11:132186321-132186343 CAAGGGAAGCAGGCAGTGGATGG + Intronic
1091334678 11:134757522-134757544 GAGGGCACAAAGACAGTGGAAGG - Intergenic
1093485203 12:19644670-19644692 CAGCTGAAACAGACAGATGAAGG + Intronic
1094691800 12:32776696-32776718 CAGGGGAAACAGACAGTGAACGG + Intergenic
1094728119 12:33143758-33143780 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1095578466 12:43766463-43766485 CAGGGGATACAAACAGTGACAGG - Intronic
1095820180 12:46469865-46469887 CAGGTGAAATAAAGAGTGGAAGG + Intergenic
1096182537 12:49558597-49558619 CAGGGGAAACAGGCCGGAGAGGG + Intronic
1096229783 12:49890459-49890481 CAATGAAAAAAGACAGTGGATGG + Intronic
1096465324 12:51845465-51845487 CAGGGGACAGAGACTGTGGGGGG - Intergenic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097237925 12:57552324-57552346 CAGGAGAGACACACAGTGGGAGG + Intronic
1097963042 12:65551408-65551430 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1098771725 12:74560778-74560800 CAGGGAAAACAGAGTGTGCAGGG + Intergenic
1098905630 12:76159172-76159194 GAGAAGAAACAGAGAGTGGATGG - Intergenic
1099246975 12:80203684-80203706 GAGGGGAAAGAAACAGAGGATGG - Intergenic
1101523481 12:105506221-105506243 AAGGAGAGACAGACAGTGGCAGG + Intergenic
1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG + Intronic
1101718846 12:107333994-107334016 CAGAGGGAACAGCCAGTGTAAGG + Intronic
1102251774 12:111392214-111392236 CAGGGGAAACAGACTGGGCGCGG + Intergenic
1102515815 12:113445923-113445945 AAGGGGAAAGAGAAAGTAGAGGG + Intergenic
1102862386 12:116347834-116347856 CAGTGAAAAGAGACAGGGGAGGG - Intergenic
1103072897 12:117959552-117959574 CAGGGTAAACAGACTGTAGGAGG - Intronic
1103440110 12:120956773-120956795 CAGAGGGCACACACAGTGGAGGG - Intergenic
1103451203 12:121030532-121030554 CAAGGGAATCAGACAGCAGAAGG - Intronic
1103560769 12:121792367-121792389 CAGGAGAAACAGTCAGTGGGAGG - Intronic
1103903977 12:124318010-124318032 GAGGGGAAACTGACAAAGGATGG + Intergenic
1103983314 12:124750851-124750873 CAGGGGAACCAGTGACTGGAGGG - Intergenic
1105265322 13:18809839-18809861 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1106032817 13:26018048-26018070 CAGGAGGAAGAGACAGTGGGCGG - Intronic
1106176673 13:27337862-27337884 CAGGAGAAACAGCCTGTGGCTGG + Intergenic
1106220906 13:27745554-27745576 CAGGGGGAACAGCCATTGGTGGG - Intergenic
1107073045 13:36292808-36292830 CAGGGAAAACAGACAGTGTAGGG + Intronic
1107479220 13:40771410-40771432 CCGGCGAACCCGACAGTGGAGGG + Intergenic
1107703789 13:43078066-43078088 AATGGGAACCAGACTGTGGATGG - Intronic
1108022096 13:46137992-46138014 CAGGTCAAACAGGCTGTGGATGG - Intronic
1111624672 13:90769381-90769403 CAGGGGAAGCTGAAAGTGAAGGG + Intergenic
1111838298 13:93416730-93416752 CAGTGGACACAGAGAGTAGAAGG - Intronic
1112732161 13:102376454-102376476 GAGGAGAGGCAGACAGTGGAAGG - Intronic
1113109753 13:106810346-106810368 TAGGGGAAATAAACAGTAGACGG + Intergenic
1113914198 13:113861230-113861252 CAGGGGAAACAGCCAGGGCTGGG + Intronic
1114153714 14:20074793-20074815 TAGGAGATACAGACATTGGAAGG + Intergenic
1114330207 14:21629152-21629174 CAGGAGAGAGAGACAGTGAAGGG + Intergenic
1114807393 14:25853933-25853955 CAGGGCAATCAGGCAGTAGAAGG - Intergenic
1114856496 14:26452180-26452202 CAGAGAAAAAAGACAGTGTAAGG - Intronic
1115088720 14:29548311-29548333 AAAGGGAAAGAAACAGTGGAAGG + Intergenic
1115654450 14:35429941-35429963 CAGGGGAAACAAATAGAGAAGGG + Intergenic
1115921492 14:38379244-38379266 CAGAGGAAACAGCAAGTGAATGG + Intergenic
1116028161 14:39538368-39538390 CTGGGGAAAAAGGCAGTTGAAGG - Intergenic
1116716892 14:48439041-48439063 CAGGGCAATCAGACAGGAGATGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116998117 14:51345594-51345616 CAGGAGAGACAGAGAGTGAAGGG - Intergenic
1117830324 14:59743715-59743737 CAGGGGAAACAAAGAGGTGAAGG - Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118323070 14:64764638-64764660 CAGATGACACAGACAGTGGATGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118696686 14:68393010-68393032 TAGGGGAAATAGACAAAGGAAGG - Intronic
1119081085 14:71694343-71694365 CAGTGAAAACAGAGAGTTGAAGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120932170 14:89859767-89859789 CAGAGGAAACAGGCAGAGGAGGG + Intronic
1121150452 14:91628616-91628638 CAGGAGAAAGAGACAGTGCAGGG - Intronic
1121210648 14:92206080-92206102 CAGGGGAAGGAAGCAGTGGAAGG - Intergenic
1121406124 14:93720370-93720392 CTGTGGAAACAGACATTGAAAGG + Exonic
1121526044 14:94620230-94620252 CAGAGGGAACAGTCAGTGCAAGG + Intronic
1121636997 14:95460800-95460822 CAGGAGTAACAGACAGAGGCTGG + Intronic
1122171051 14:99876130-99876152 CAGAGGAGACAGAGAGGGGAAGG + Intronic
1122471045 14:101965717-101965739 CAGTGAAAACAAGCAGTGGATGG - Intronic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1123174804 14:106406555-106406577 CAGGGCAATGAGACAGTAGAAGG - Intergenic
1202833170 14_GL000009v2_random:58277-58299 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1123887067 15:24736605-24736627 CAAGGAAAACAGAGATTGGAGGG - Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124066917 15:26353460-26353482 CAGGTGGAACAGGCTGTGGAGGG + Intergenic
1125004631 15:34803389-34803411 CAGGGAACACAGAAAGTAGATGG - Intergenic
1125549538 15:40535046-40535068 CTGGGGGACCAGACTGTGGAGGG + Intronic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1127117016 15:55738874-55738896 CAGGAGGAAAAGACAGAGGAAGG + Intronic
1127817354 15:62622947-62622969 CAGGGCACACAGACAGATGATGG - Intronic
1128325723 15:66722811-66722833 CTGGGGGAACAGACAGCTGAAGG + Intronic
1128948412 15:71848498-71848520 AGGCGGGAACAGACAGTGGAAGG + Intronic
1129054518 15:72809424-72809446 CTGTGGAAATAGACATTGGAGGG + Intergenic
1129319707 15:74767760-74767782 CTGGGCAAACAGGCAGTGGGTGG + Intergenic
1129718581 15:77865639-77865661 CAAGGGAAACAGATGGTAGAAGG - Intergenic
1130241384 15:82196128-82196150 CAGAAGAAGCAGACAGTGAAGGG + Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130460347 15:84155227-84155249 CAAGGGAAACAGATGGTAGAAGG + Intergenic
1130648485 15:85748768-85748790 CAGGGGACACAGCCAGTGGGGGG - Intronic
1131654412 15:94440764-94440786 CAGGGCAATCAGAGAGTGGGTGG + Intronic
1133668111 16:7990690-7990712 AAGGGGAAATAAACAGAGGATGG - Intergenic
1133865313 16:9636713-9636735 CAGGGGAGAGAGAAAGGGGAGGG + Intergenic
1133960829 16:10492078-10492100 CTGGGGGAAGAGACAGTGGAAGG - Intergenic
1135706275 16:24677826-24677848 CAGAGGAAACAAACAGTTCAAGG - Intergenic
1136077337 16:27826213-27826235 CTGGGGAAAGACACAGTGGCAGG + Intronic
1136239624 16:28936252-28936274 CAGAGGAAACAGTAAGTGCAAGG - Intronic
1137850788 16:51740337-51740359 CAAGGGGAACACAAAGTGGAAGG - Intergenic
1138056180 16:53836323-53836345 GTGGGGAAGCAGACACTGGAAGG - Intronic
1138293450 16:55867514-55867536 CAGTGGTCATAGACAGTGGAGGG - Intronic
1139020137 16:62738797-62738819 GAGGGGAAAGAGACTCTGGAAGG + Intergenic
1139197370 16:64935492-64935514 CAGGTAAAACAGACCTTGGAAGG + Intergenic
1139699858 16:68701508-68701530 CAGGAGAAACAGATCCTGGAAGG - Intronic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140422498 16:74832039-74832061 GAGGGAAAACATACAGTGGTGGG + Intergenic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141740802 16:85891546-85891568 CTGGGGCTACAGACACTGGAAGG - Intergenic
1141946026 16:87310739-87310761 CAGGGGAGAGAGTCAGAGGAGGG + Intronic
1142252876 16:89000761-89000783 GAGGGGGCACAGACAGAGGAGGG - Intergenic
1142599055 17:1044180-1044202 CAGGGGCAAGAGCCGGTGGAGGG + Intronic
1143593998 17:7903246-7903268 CAGGGGCAAGAGAAAGTGGCGGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144118496 17:12125989-12126011 CAGGGGAGAGAGAGAGTGAAGGG + Intronic
1144588483 17:16503584-16503606 CAGGAGAGAGAGCCAGTGGAGGG + Intergenic
1145730927 17:27185024-27185046 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1146372878 17:32276164-32276186 CAGGGGAAAAGGTCAGGGGAAGG + Intronic
1147916180 17:43888302-43888324 CTGGGGAAACAGACAACTGATGG + Intronic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148496627 17:48056806-48056828 CCGTGGCAACAGACAGTGCAAGG + Intronic
1149023537 17:51998092-51998114 CAGTGCAGACAGACAGAGGAAGG + Intronic
1149205002 17:54233826-54233848 AATGGAAAACAGACAGTGGGAGG - Intergenic
1149232202 17:54547434-54547456 CAGTGCAAGCAGACAGTGAAGGG + Intergenic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1152426337 17:80220539-80220561 CAGGGGGAGCGGACAGTGGCCGG + Intronic
1152799709 17:82325182-82325204 CAGTGGAAATATACAGGGGAGGG - Intronic
1152856571 17:82668094-82668116 CAGGGGAGACCCACAGTGGGTGG + Intronic
1153995859 18:10440891-10440913 CAGTTGAGACAGACTGTGGATGG - Intergenic
1154423073 18:14251690-14251712 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1155012305 18:21792083-21792105 CAAGGGATACAGACAGGGAAAGG - Intronic
1156211851 18:34952948-34952970 CAGGAGGGACAGACAGTGGCTGG - Intergenic
1156295439 18:35785288-35785310 CAGAGGGAACAGTCAGTGCAAGG - Intergenic
1156412552 18:36846605-36846627 AAGGGGAAACAGACTGTAAAAGG - Intronic
1157631698 18:49104406-49104428 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1157644444 18:49252737-49252759 CAGAGGAAACAGCCAGTGGAGGG + Intronic
1158153714 18:54401725-54401747 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158176776 18:54666183-54666205 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158273531 18:55742193-55742215 CAGAGGACACAGCCAGGGGAGGG - Intergenic
1158626359 18:59075131-59075153 CAGGGGAAAGACCCAGTGGGAGG + Intergenic
1159333383 18:67030844-67030866 CAGGAGCAACAGAAAGTGGGAGG - Intergenic
1159555002 18:69936377-69936399 AATGGGAAACTGAAAGTGGATGG - Intronic
1160685113 19:430987-431009 CAGGGGGAACAGCCATTGCAAGG - Intronic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1161290844 19:3492582-3492604 CAGGGGAGAGAGACACTGGCAGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1162059492 19:8086049-8086071 TGGGGGGAACAGGCAGTGGAGGG + Intronic
1163776136 19:19219008-19219030 CAGGGTAAAGAGACAGGGCAGGG - Exonic
1164420917 19:28091770-28091792 CAGGGCAATCAGGCAGTAGAAGG + Intergenic
1164489541 19:28694065-28694087 CAGAGGAAAGAAACAGTGCATGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1165650272 19:37481840-37481862 GAGGTCAAACAGACTGTGGAAGG - Intronic
1166800124 19:45451376-45451398 CAGGGGAGACAGACAGACAAGGG + Intronic
1166855226 19:45779938-45779960 AAGGGGAGACAGACAGAGGGTGG - Exonic
1167214662 19:48156543-48156565 CAGGTCATACAGCCAGTGGATGG + Intronic
1167298054 19:48663433-48663455 CTGGGGAGACAGACAGCTGAAGG - Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
1202639497 1_KI270706v1_random:69433-69455 CTGGGGATGCAGACAGAGGAGGG + Intergenic
926308499 2:11657642-11657664 CAGTGGCAAAAGACAGGGGAGGG - Intergenic
927107635 2:19841620-19841642 CTGGGGAGACAGATAGTGTAAGG + Intergenic
927239395 2:20907467-20907489 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
928823618 2:35392158-35392180 GAGGGGAAACAGAGACTGCAGGG + Intergenic
929241702 2:39660140-39660162 CAGAGTAAACAGCCAGTGCAAGG - Intergenic
929375746 2:41284645-41284667 CAGGGGAAAAAGAAAATGAAAGG - Intergenic
929940989 2:46333867-46333889 CAAGGGAAACAAACAGAAGATGG + Intronic
930541555 2:52713057-52713079 CAGGGGACACAGACACTGTTTGG - Intergenic
931877533 2:66529967-66529989 AAGGGCAGGCAGACAGTGGAGGG + Intronic
932397595 2:71458841-71458863 AAGTGGAAACAGACACTGAAAGG + Intronic
932520599 2:72407862-72407884 CAGGGCAATCAGACAGGAGAAGG + Intronic
932624529 2:73286778-73286800 GAAGGGAAACAGAAAGGGGAAGG - Intergenic
932649761 2:73542511-73542533 CAGGGCAATCAGGCAGGGGAAGG + Intronic
933023458 2:77223356-77223378 CAGGGCAATCAGGCAGTAGAAGG + Intronic
933939810 2:87235754-87235776 CAGGAGAACCAGGCAGTGGACGG + Intergenic
933990244 2:87628651-87628673 CAAGGGAGACAGAGGGTGGAGGG + Intergenic
934494982 2:94788883-94788905 CTGGGGATGCAGACAGAGGAGGG + Intergenic
935450611 2:103204683-103204705 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
936303602 2:111322173-111322195 CAAGGGAGACAGAGGGTGGAGGG - Intergenic
936353327 2:111730019-111730041 CAGGAGAACCAGGCAGTGGACGG - Intergenic
936918914 2:117668001-117668023 GAGGGGAAGAAGACCGTGGAAGG - Intergenic
937525591 2:122765071-122765093 CAGCACAGACAGACAGTGGAAGG - Intergenic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938196652 2:129334528-129334550 GGGGTGAAACGGACAGTGGAGGG - Intergenic
938925437 2:136036926-136036948 AAGGGGAACAAGACAGTGCAGGG - Intergenic
940095541 2:149969855-149969877 CAGGGCAATCAGGCAGCGGAAGG + Intergenic
940784052 2:157962990-157963012 CAAGGGAAAGAGACAGTGAAGGG + Intronic
941623603 2:167806322-167806344 CAGGGCAATCAGACAGGAGAAGG - Intergenic
941760650 2:169238925-169238947 AAGGGGAAAGAGAAAGTGGAGGG - Intronic
942455531 2:176135941-176135963 GAGGGGAAACCGAAAGTGGTTGG + Intergenic
942810641 2:179995924-179995946 GAGGGGAGAGAGTCAGTGGAGGG + Intronic
943283039 2:185962691-185962713 CAGGAGCAAAAGACAGTGGTGGG + Intergenic
943638458 2:190332680-190332702 CAGAGCACAAAGACAGTGGAAGG + Intronic
943665838 2:190607301-190607323 CAGGGGCAACAGCAAGTGGGTGG + Intergenic
943704846 2:191023485-191023507 CAGGGGAAACAGAGAGAACATGG + Intergenic
943919152 2:193679978-193680000 CAAGGGAAACAGAGAAAGGAAGG + Intergenic
945266409 2:207895503-207895525 CAGGGGAAGGAGACTGTGAAAGG - Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945956396 2:216090225-216090247 AAGGGGAAAGAGCCAGTAGAAGG + Intronic
946976846 2:225162722-225162744 CAGGGAACCCAGTCAGTGGAAGG - Intergenic
947074665 2:226329478-226329500 CAGGGGTGACAGTGAGTGGATGG - Intergenic
947576481 2:231279017-231279039 CTGTGGCAACAGAGAGTGGATGG - Intronic
947889770 2:233606740-233606762 CAGGAGAAAGAGAGAGTCGATGG + Intergenic
948460887 2:238129404-238129426 CAGAGGGAACAGCCAGTGCAAGG + Intronic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
948879646 2:240850316-240850338 CACGGGGAAGAGACAGTGCAGGG + Intergenic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1169967401 20:11232831-11232853 CAGTGGAAACTGACAGAGGATGG + Intergenic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1170614577 20:17938381-17938403 CATGGGAAGCAGGCCGTGGAAGG + Intergenic
1170898335 20:20436621-20436643 CTGGGGAGACAAACACTGGATGG + Intronic
1171885971 20:30652659-30652681 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1171886165 20:30653789-30653811 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1172049191 20:32103332-32103354 CAGGGGAAGCTCTCAGTGGAGGG + Intergenic
1172135407 20:32683365-32683387 CTGGGGAGACAGACAGTAGCTGG - Intergenic
1172438192 20:34945400-34945422 CAAGGGAAAGAGACAGAGAAGGG + Intronic
1172509099 20:35487521-35487543 AAGGGGAGACAGACAGTAGATGG - Intronic
1172814912 20:37678673-37678695 CAGGGGAGAGAGGCAGTGGCAGG - Intergenic
1172992674 20:39047867-39047889 CAGGGGGAGCAGTGAGTGGAAGG + Intergenic
1174251872 20:49225982-49226004 CAGAGGGAACAGAAAGTGCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1175324202 20:58111134-58111156 CAGGGGACACTGACAGTCCAGGG - Intergenic
1175419296 20:58821255-58821277 CAGAGGGGACAGCCAGTGGAAGG - Intergenic
1175789493 20:61732518-61732540 CAGAGGGAACAGACAGTGCAAGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175873405 20:62218853-62218875 CAGGGGACACAGATAGTGCTGGG - Intronic
1176647827 21:9367032-9367054 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177490768 21:21823229-21823251 CAGAGTAAACAGACAGTTTATGG - Intergenic
1178011628 21:28293484-28293506 CAGATGAAACAGGCAGTGGAAGG - Intergenic
1178346449 21:31832593-31832615 CAGGGGAGAAGGTCAGTGGAAGG - Intergenic
1178913140 21:36692676-36692698 CAGGGGCGAGGGACAGTGGAGGG + Intergenic
1178927204 21:36785922-36785944 AAGGGAAAACACACAATGGAGGG - Intronic
1179472816 21:41622859-41622881 CAGGAGAAAGCGGCAGTGGAGGG + Intergenic
1179675909 21:42981999-42982021 CAGATGGAACAGACAGTGGAGGG - Intronic
1180362445 22:11912437-11912459 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1181161540 22:20962855-20962877 CAGGAGAACCTGACAGTAGAGGG + Intergenic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181639773 22:24190394-24190416 CTGGGGATTCAGACAGTGGGAGG - Intergenic
1181744837 22:24948798-24948820 CACGTGAAACAGACCATGGAAGG - Intergenic
1182069627 22:27454517-27454539 CAGGTGATACAGAGAGTTGATGG + Intergenic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1182810480 22:33111916-33111938 CTGAGGGAACAGACAGTGGAAGG + Intergenic
1183290684 22:36999998-37000020 CAGGGATGACAGACAGGGGATGG + Intronic
1183531450 22:38356067-38356089 CAGTGGAAACACACAGCGGCAGG + Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184879812 22:47297625-47297647 CAGAGGGAACAGACAGTGTGGGG + Intergenic
1184897657 22:47421049-47421071 CAGGGGAAGCAGCCAGGGAATGG - Intergenic
949763435 3:7498851-7498873 CAAGGACAACAGAAAGTGGAGGG - Intronic
950163496 3:10776947-10776969 CAGGAGAAACTGGCAGGGGAGGG - Intergenic
951104942 3:18731827-18731849 CATGGAAAACAGACAGTACAGGG - Intergenic
951474343 3:23089301-23089323 CAGGGCAAACAGGCAGGAGAAGG - Intergenic
953146003 3:40275493-40275515 CAGGGCAATCAGACAGGAGAAGG + Intergenic
955518624 3:59752731-59752753 CAGGAGGAAGAGAGAGTGGAGGG - Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
957269061 3:78005032-78005054 CTGGAAAAACAGCCAGTGGATGG + Intergenic
958111839 3:89157886-89157908 CAGGGGAAAGAGAGAGTTAATGG + Intronic
958496996 3:94857629-94857651 CAGATTAAACAGACAGTGTACGG - Intergenic
958662497 3:97088764-97088786 CAAGGGACACAGACACTGGGAGG - Intronic
958974395 3:100650423-100650445 CAGAGGAAACACACAGTAAACGG - Intronic
960205575 3:114893354-114893376 CAGGCTAGACAGACAGTGGGTGG + Intronic
962311169 3:134327781-134327803 CAGGGGAGCCTGACAGAGGAAGG + Intergenic
962449691 3:135502654-135502676 CAAGGGAGAGAGACAGTGGTGGG + Intergenic
962613121 3:137097757-137097779 CTGGGAAAACAGTCAGGGGAAGG + Intergenic
962667062 3:137664713-137664735 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962697920 3:137969271-137969293 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962856994 3:139355954-139355976 CAATAGAAACAGACAGGGGAGGG + Intronic
962871108 3:139493907-139493929 CAGGGGCACCTGACAATGGAAGG - Intergenic
963101201 3:141606121-141606143 CAGTGGACACAGACAGCTGAAGG - Intronic
963282109 3:143394599-143394621 CAGGGCAATCAGACAGGAGAAGG + Intronic
963571604 3:147004010-147004032 CATGGGGAAAAGACAGTGAATGG + Intergenic
965035556 3:163433222-163433244 CAGGGCAAACAGGCAGGAGAAGG + Intergenic
967719803 3:192803687-192803709 GAAGGGAAAAAGACAGAGGAGGG + Intronic
967983268 3:195078032-195078054 GAGGGGGAAGAGGCAGTGGAGGG + Intronic
967992505 3:195142083-195142105 CAGGGGAGAGAGGCTGTGGAGGG - Intronic
1202739057 3_GL000221v1_random:37955-37977 CTGGGGATGCAGACAGAGGAGGG - Intergenic
968385890 4:137083-137105 CAGGAGCAAGAGACAGTGAAAGG - Intronic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970018840 4:11543917-11543939 CAGGGAAAACAACCAGGGGAAGG - Intergenic
970510320 4:16775715-16775737 TGAGGGAGACAGACAGTGGAGGG - Intronic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
972063166 4:34906679-34906701 CATGGGAAAGACACAGTGGGAGG + Intergenic
972413888 4:38819906-38819928 CACAGGAAAGAGACAGTGGATGG - Intronic
973116426 4:46465786-46465808 CAGGGCAATCAGACAGGAGAAGG - Intronic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
974506257 4:62776772-62776794 CAGGAGAAAGAGAGAGTGAATGG - Intergenic
974855144 4:67452426-67452448 CAGGAGAAAGAGAAAGTGAAGGG - Intergenic
974981996 4:68968190-68968212 CATGGGAGGAAGACAGTGGAAGG + Intergenic
976918881 4:90411769-90411791 CAGGGCAATCAGGCAGGGGAAGG + Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
978004472 4:103599448-103599470 CAGGGCAATCAGACAGGAGAAGG - Intronic
978334958 4:107657097-107657119 CAATGGAAACAAACAGTGTAAGG + Intronic
978502155 4:109421031-109421053 CAGGAGAGACAGAGAGTGAAGGG + Intergenic
980271816 4:130593781-130593803 CAGGAGAGACAGACAGTAAAGGG - Intergenic
981478590 4:145212844-145212866 CAGAGGAACCAGACAGTGAGTGG - Intergenic
981493550 4:145367043-145367065 CAGGGCAATCAGACAGGAGAAGG - Intergenic
981599254 4:146467285-146467307 AACAGGAAACTGACAGTGGAAGG - Intronic
981642670 4:146963205-146963227 CAGGTGAAACAAACAGAGAAAGG + Intergenic
981884316 4:149654440-149654462 CAGGGGCAACAGAGAGTGGTGGG - Intergenic
982018271 4:151177280-151177302 TAGGGCAAACATACAGTGTAAGG + Intronic
982336610 4:154246586-154246608 CAGTGGAAACAGATATTGAAAGG + Intronic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
985132249 4:186750455-186750477 CAGGAAAACCAGATAGTGGATGG + Intergenic
1202766857 4_GL000008v2_random:155288-155310 CTGGGGATGCAGACAGAGGAGGG + Intergenic
985843017 5:2323584-2323606 CAGGGGAGACAGGGAGTGAAAGG + Intergenic
986571500 5:9170623-9170645 CAGGGGAAAGAGACAAGGCAGGG - Intronic
986750743 5:10785412-10785434 CAGGGGAAACAGATAGAACAGGG + Intergenic
987174773 5:15296084-15296106 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
987893756 5:23917939-23917961 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
988510385 5:31859606-31859628 CAGAGGAAACAAAGAGTGCAGGG - Intronic
989446501 5:41535913-41535935 AAGGGCAATCAGGCAGTGGAAGG - Intergenic
989838749 5:46031826-46031848 CAGGGAAATCAGACAGGAGAAGG + Intergenic
990028547 5:51226159-51226181 TAGGGGAAACAGAGAGGGGCAGG + Intergenic
990201323 5:53379050-53379072 CTGAGGAATCAGACAGTGAAGGG + Intergenic
991201233 5:63996197-63996219 CAGGGGAAATAAACAGTGGTGGG - Intergenic
991603659 5:68378868-68378890 CTGGGGAAGCAGACAGGGAAAGG + Intergenic
994423866 5:99559737-99559759 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
994894889 5:105690144-105690166 AATGGGAAACAGACAATAGATGG + Intergenic
996003094 5:118387105-118387127 CAGGGCAATCAGACAGGAGAAGG + Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996027134 5:118658665-118658687 CAGGAGAAAGAGAGAGTGAAGGG + Intergenic
997022239 5:130015168-130015190 CAGGAGAGACAGAAAGTGAAGGG - Intronic
997061619 5:130511585-130511607 CAGAGTGAACAGTCAGTGGAAGG + Intergenic
997147220 5:131448933-131448955 CATGGGAAACACACAGAGAAGGG + Intronic
997898193 5:137738887-137738909 CAGAGTAAACAGACAATGTACGG + Intergenic
999376674 5:151091554-151091576 CAGGTGAAAGGCACAGTGGAGGG - Intronic
999383593 5:151139041-151139063 ACGAGGAAACAGACAGTGGTGGG - Intronic
999792094 5:154950143-154950165 CAGGAGAGAGAGACAGTGCAGGG + Intronic
1001692716 5:173644710-173644732 CAGTGGAACCAGAAAATGGAGGG - Intergenic
1002194175 5:177493340-177493362 CAGGGGAAATTGGCAGTCGAGGG - Intronic
1002227956 5:177738346-177738368 CATGGGAAACAGACATTGCGAGG - Intronic
1002480758 5:179499234-179499256 AAGGAGAAACAGACACTGAAAGG + Intergenic
1003055823 6:2819320-2819342 CAGAGGAAAAAGACAGGGCAGGG - Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004820979 6:19367552-19367574 CATTGGAGAAAGACAGTGGAAGG - Intergenic
1005430987 6:25756596-25756618 CAGTGGGAACAGACAGCCGAGGG - Intronic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1006874679 6:37285096-37285118 CAGGGGTTGCAGAAAGTGGAAGG + Intronic
1006878361 6:37317831-37317853 CAGAGGAAACAGCCAGTGCAGGG + Intronic
1009510512 6:64545518-64545540 CAGGGCAATCAGACAGGAGAAGG + Intronic
1009546941 6:65032505-65032527 CAAGAGAAAGAGACAGTGGTAGG - Intronic
1009586957 6:65619547-65619569 CAGGGCAATTAGGCAGTGGAAGG - Intronic
1009980580 6:70721535-70721557 AATGGGGAACAGACAGAGGATGG - Intronic
1011362325 6:86540642-86540664 GAGTGGAAACAGAAAATGGAAGG + Intergenic
1013580332 6:111527779-111527801 CATGGTAAACACACAATGGAGGG - Intergenic
1013618846 6:111870233-111870255 AAGGGGCAACAGAGAGTAGACGG - Intronic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1014247854 6:119085863-119085885 CAGGAGAAAGAGAGAGTGGGGGG + Intronic
1014255752 6:119158879-119158901 TAGGGCAACCAGACAGAGGAAGG - Intergenic
1014674226 6:124344826-124344848 CAGGGCAATCAGGCAGTAGAAGG - Intronic
1015619986 6:135121248-135121270 AAAAGGAAACAGACAGAGGAAGG + Intergenic
1017622639 6:156315023-156315045 TCGGGGAGACAGACAGAGGAGGG + Intergenic
1017743232 6:157425738-157425760 CAGGGGAAACAGGGACCGGATGG - Intronic
1018839334 6:167507450-167507472 CAGGGGGGTCAGACAGAGGACGG - Intergenic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1020385919 7:7602221-7602243 CAGGGCAATCAGACAGGAGAAGG + Intronic
1020658217 7:10952438-10952460 CAGGGGAAATATTCAGTGAATGG + Intergenic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1024011509 7:45270991-45271013 CAGGGGAAACAAATAGGGAAGGG + Intergenic
1024344522 7:48299598-48299620 TAGGGGAAAGAAGCAGTGGAAGG + Intronic
1024571172 7:50723852-50723874 CAAGGCAAACAGACATAGGAAGG + Intronic
1024965775 7:55020685-55020707 CAGGGGAAACATGCCTTGGAAGG + Intronic
1025117309 7:56269159-56269181 CAGGAGAAAGAGAGAGTGAAAGG + Intergenic
1026683591 7:72489209-72489231 CAGGGGAAACAGGCAGAACAAGG + Intergenic
1028457883 7:91058400-91058422 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1030128520 7:106177821-106177843 CAAGGGAAAGAGACAGAGCAGGG - Intergenic
1030209916 7:106986136-106986158 TAAGGGAGACAGACATTGGAGGG + Intergenic
1030449318 7:109689121-109689143 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1030626783 7:111853624-111853646 CAGAGGAAAGCAACAGTGGAGGG + Intronic
1031418233 7:121518596-121518618 CATGGGAAAGAGTCAGTGAAGGG + Intergenic
1031865438 7:127034031-127034053 CAGGATAAAGAAACAGTGGATGG - Intronic
1032308913 7:130763970-130763992 CAGGGTAAAGAGACAATGTATGG - Intergenic
1033128615 7:138726377-138726399 AAGGGGAAACAGAACGTGGGGGG + Intronic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034360707 7:150495064-150495086 CAGGGGAAATAGGCAGGAGAAGG + Intergenic
1034929196 7:155147905-155147927 CAGGGGGAAGAGAGAGAGGAGGG - Intergenic
1035304495 7:157922946-157922968 CAGTGGTAGGAGACAGTGGAAGG - Intronic
1035598188 8:878182-878204 CATGGGAAAAAGTCAGTGGTGGG + Intergenic
1036400245 8:8401432-8401454 GAGGGGACACAGACAGTGCCGGG + Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1038919508 8:32067182-32067204 CAGGGCAATCAGACAGGAGAAGG - Intronic
1039447785 8:37646474-37646496 CAGGGGCAAGAGAGAGAGGAGGG + Intergenic
1039604035 8:38866240-38866262 CAGGGGAGGCAGACTGGGGAAGG + Intergenic
1040539103 8:48335937-48335959 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1040830070 8:51666351-51666373 CATGGAAACCAAACAGTGGATGG - Intronic
1041003205 8:53471992-53472014 CAGGGGAAAGAAACAATGAAGGG - Intergenic
1043085423 8:75826171-75826193 CAGGAGAAACAGAGAGTAGGGGG - Intergenic
1045508526 8:102795399-102795421 GAGAGGAAACAGCCTGTGGAGGG - Intergenic
1046391397 8:113577346-113577368 CAGGAGAAAGAGAGAGTGAAGGG - Intergenic
1046541692 8:115591710-115591732 CAAAGGAAACAGAAAGTGCAGGG + Intronic
1046855125 8:119022726-119022748 CTGGGGAGGCAGCCAGTGGAGGG - Intronic
1047167686 8:122458420-122458442 CAGTGGAAACAGTGGGTGGAGGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1047994729 8:130323605-130323627 TAGGGGGAACAGACAGTAGAGGG - Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1051596878 9:18832796-18832818 TAGAGGAAACATACAGTGGCTGG - Intronic
1052334687 9:27307432-27307454 AAGGGGGAAGTGACAGTGGAAGG - Intergenic
1052424266 9:28284150-28284172 CAGAGGAAGCAGACATTGGAAGG - Intronic
1052997589 9:34559491-34559513 CAAGGGAGGCACACAGTGGAAGG - Intronic
1053499071 9:38569829-38569851 CTGGGGATGCAGACAGAGGAGGG + Intronic
1054738742 9:68782991-68783013 CAGGGGCAACAGATAGAGAAGGG - Exonic
1055308122 9:74951959-74951981 AGGGGGAAACAGACCGTGGTCGG - Intronic
1055707386 9:79020490-79020512 GAGGGGAAAGAAAAAGTGGAGGG + Intergenic
1056335036 9:85560017-85560039 CTGGGGACACAGACACTGGCTGG + Intronic
1056586644 9:87931785-87931807 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1056610233 9:88121156-88121178 CTGGGGATGCAGACAGAGGAGGG - Intergenic
1057162119 9:92896171-92896193 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057406232 9:94773307-94773329 CAGGGAAAACAAGCAGGGGATGG + Intronic
1057527698 9:95817230-95817252 AAGGAGAAAAAGACAGTAGAGGG - Intergenic
1057678507 9:97154310-97154332 CTGGGGATGCAGACAGAGGAGGG + Intergenic
1059733263 9:117077117-117077139 CAGGGGAGAGAGACAGAGGTTGG + Intronic
1061604799 9:131700700-131700722 AGGAGAAAACAGACAGTGGAAGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062322102 9:135995106-135995128 CTGTGGAGACAGACGGTGGAGGG - Intergenic
1062484926 9:136769981-136770003 CAGGGCAAAGAGAGAGAGGAAGG - Intergenic
1186984373 X:14996012-14996034 CAGAGGAAAGAGTCAGTGAATGG - Intergenic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1189088795 X:38055463-38055485 CAGAGGAGACAGACACTGGGAGG - Intronic
1189668978 X:43387642-43387664 CAGGAGCAAGAGAAAGTGGAAGG - Intergenic
1190491806 X:50990033-50990055 TAAGTGAAAAAGACAGTGGAAGG - Intergenic
1190607916 X:52164051-52164073 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1191092681 X:56640149-56640171 CAGGGCAAACAGGCAGGAGAAGG + Intergenic
1191233070 X:58112239-58112261 CAGGGAAATCAGGCAGGGGAAGG + Intergenic
1191573216 X:62659505-62659527 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191649699 X:63523263-63523285 CAGGGCAATCAGGCAGGGGAAGG + Intergenic
1191657142 X:63610648-63610670 CAGGGCAAACAGGCAGGAGAAGG + Intergenic
1191660732 X:63647224-63647246 CAGGGCAATCAGGCAGGGGAAGG - Intronic
1191683179 X:63862370-63862392 CAGGGCAATCAGGCAGGGGAAGG - Intergenic
1191783006 X:64888670-64888692 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1192232561 X:69276019-69276041 CAGAGGAAACAGCCAGTTCAAGG + Intergenic
1192352140 X:70365236-70365258 CAGGGAAATCAGACAGGAGAAGG - Intronic
1193086718 X:77453605-77453627 CAGGGGGAACAAACAGTGAGTGG + Intronic
1193476628 X:81974105-81974127 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1194501535 X:94687515-94687537 CAGGGTAAACAGACATTACAAGG + Intergenic
1195157119 X:102134823-102134845 CTGGGGAAACCGGCAGTTGATGG + Intergenic
1195525450 X:105883945-105883967 CAGGGGAAGCAGAAAGTTTAAGG + Intronic
1195981629 X:110584417-110584439 GAGGGGAATCAGACACTGGCAGG + Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1197498667 X:127217887-127217909 CAGGGGAATCAGGCAGGAGAAGG + Intergenic
1198793691 X:140373490-140373512 CAGGGGAAATTGACATTGTATGG + Intergenic
1199253911 X:145696993-145697015 TTGGGGAAATAGACAGTGAAGGG + Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200815025 Y:7522336-7522358 CACAGGAAAGAGACAGTGCAGGG - Intergenic
1201258971 Y:12138995-12139017 CAGGGCAATCAGGCAGCGGAAGG + Intergenic
1201536056 Y:15049679-15049701 CAGGGGAATCAGGCAGGAGAAGG - Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202378903 Y:24259946-24259968 CAAGGGAAACGGATGGTGGAAGG - Intergenic
1202491879 Y:25410175-25410197 CAAGGGAAACGGATGGTGGAAGG + Intergenic